ID: 1089297310

View in Genome Browser
Species Human (GRCh38)
Location 11:117477887-117477909
Sequence CAGAGCACTGAGAAGGCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 0, 2: 1, 3: 63, 4: 505}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089297310_1089297315 19 Left 1089297310 11:117477887-117477909 CCGGCTGCCTTCTCAGTGCTCTG 0: 1
1: 0
2: 1
3: 63
4: 505
Right 1089297315 11:117477929-117477951 TTAAGAGTGCAAAGCCCTTGTGG 0: 1
1: 0
2: 1
3: 10
4: 146
1089297310_1089297316 23 Left 1089297310 11:117477887-117477909 CCGGCTGCCTTCTCAGTGCTCTG 0: 1
1: 0
2: 1
3: 63
4: 505
Right 1089297316 11:117477933-117477955 GAGTGCAAAGCCCTTGTGGTAGG 0: 1
1: 0
2: 0
3: 67
4: 572

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089297310 Original CRISPR CAGAGCACTGAGAAGGCAGC CGG (reversed) Intronic
900379621 1:2377398-2377420 CAGAGCACTCAGGAGGCCCCGGG + Intronic
900481064 1:2899558-2899580 CAGAGTCCTGAGAAGGGAGCGGG - Intergenic
900978811 1:6034738-6034760 GAGAGCACTGGAGAGGCAGCCGG - Intronic
900981786 1:6049932-6049954 CAGAGCAGTGAAAGGTCAGCAGG + Intronic
901148755 1:7086287-7086309 CAGGGCACTGGGGAGGCCGCCGG + Intronic
901226564 1:7616538-7616560 CAGAGTGCTGAAAAGGAAGCCGG + Intronic
901228837 1:7630787-7630809 CTGAGCACTGACAAGGAAGTGGG + Intronic
901329818 1:8397658-8397680 TAGAGAACTGAGAAGCCAGCAGG - Intronic
901953731 1:12769319-12769341 CACAGCACTGCAGAGGCAGCTGG - Intergenic
901974357 1:12932518-12932540 CAGAGGAGAGAGATGGCAGCAGG - Intronic
902010817 1:13269250-13269272 CAGAGGAGAGAGATGGCAGCAGG + Intergenic
902150508 1:14439056-14439078 TAGAGCACTGAGTAGACAGTTGG - Intergenic
902279333 1:15362845-15362867 AGCAGCACTGGGAAGGCAGCAGG - Intronic
902279349 1:15362927-15362949 AGCAGCACTGGGAAGGCAGCAGG - Intronic
902545983 1:17190624-17190646 CAGAGAACGGAGAAAGGAGCTGG - Intergenic
902581967 1:17413500-17413522 CAGAGCACTGATAAGCCAGGGGG + Intronic
902800455 1:18826371-18826393 CTAAGGAGTGAGAAGGCAGCTGG + Intergenic
903293223 1:22327682-22327704 ATTAGCACTGAGAATGCAGCAGG - Intergenic
904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG + Intergenic
904381401 1:30113552-30113574 CTTAACACTGAGAAGGCAGCAGG + Intergenic
905124959 1:35709717-35709739 CAGAGGCCTGAGTAGGCTGCAGG - Intergenic
905186379 1:36199985-36200007 AAGAGCAATGAGAAGGCCCCGGG - Intergenic
905415898 1:37803991-37804013 CAGGGCACTGAGGAGGAAACAGG + Exonic
905533437 1:38700187-38700209 TAAGGAACTGAGAAGGCAGCTGG - Intergenic
906693248 1:47806831-47806853 AATGGCACTGAGAAGGCAGCAGG + Intronic
907328981 1:53659124-53659146 CAGAGCACTCAGAGGGCTTCAGG - Intronic
907504328 1:54906816-54906838 AAGAGCACAGAGAAGGGAGATGG - Intergenic
907515615 1:54991571-54991593 GAGAGAACTGAGGAGGCACCAGG + Intronic
908386559 1:63648231-63648253 CAGAACAATGAAGAGGCAGCCGG + Intronic
908679692 1:66646872-66646894 CAGAGCACCAAAAAGGCAGAAGG + Intronic
910870771 1:91830778-91830800 CAGAGCAGTGAGAGGGCACAGGG + Intronic
913609619 1:120497332-120497354 ACGAGCTCTGAGAGGGCAGCTGG - Intergenic
914040021 1:144041254-144041276 CAGAGCACTGAGACTGCAAAGGG + Intergenic
914581571 1:149024512-149024534 ACGAGCTCTGAGAGGGCAGCTGG + Exonic
914912015 1:151795243-151795265 CAGAGCAGTGAAAAGCCAGGTGG + Intergenic
915288411 1:154867413-154867435 CAGCCCACTGAGAGAGCAGCCGG + Intronic
915473122 1:156137521-156137543 CAGAGGACAGAGTAAGCAGCAGG + Intronic
915579905 1:156807309-156807331 CAGAGTTCTCAGAATGCAGCTGG + Exonic
915621805 1:157090806-157090828 CAAAGCACTGAAGAGGCAGTGGG + Intergenic
915647201 1:157281402-157281424 TAGAGCAGGGAGAAGGGAGCAGG + Intergenic
915769051 1:158399113-158399135 CACAGCAATGAGGAGGCAGTTGG + Exonic
916074472 1:161192451-161192473 CAGAGCACTGAGTATGAATCAGG + Intronic
916076654 1:161203902-161203924 AAGAGCACTTAGAAATCAGCTGG - Intronic
916425451 1:164675746-164675768 TATAGCACTAAGAAGACAGCAGG - Intronic
916746000 1:167685361-167685383 GAGAGCACTGATCAGGCAACAGG - Intronic
916873939 1:168948312-168948334 CAGAGAACTCTGAAGACAGCTGG - Intergenic
916986998 1:170202335-170202357 CAGAGCATTGAAAAGGCAGAGGG - Intergenic
918148731 1:181780475-181780497 CATAGCACTGCCCAGGCAGCTGG + Intronic
918586539 1:186194685-186194707 CAGTGCACTTAGAAGCAAGCAGG - Intergenic
919149782 1:193681157-193681179 CAGAGCTCTGAGAGAACAGCAGG - Intergenic
919320842 1:196035675-196035697 CAGACCACTGAAAAGGAAGATGG - Intergenic
919786995 1:201264504-201264526 CTGGGAACTGAGAATGCAGCGGG - Intergenic
920553331 1:206884136-206884158 CAAAGCACAGAGAAGAGAGCTGG - Intergenic
920693809 1:208166357-208166379 CAGCCCACTGAGCTGGCAGCAGG + Intronic
920846710 1:209599420-209599442 CATAGCAATGAGAAGGCAGATGG - Intronic
921157598 1:212450378-212450400 CAGGGCCCAGAGAATGCAGCTGG + Intergenic
922005502 1:221526644-221526666 CAGAGCTCTGAGAAGGTAGTTGG - Intergenic
922031507 1:221804645-221804667 GAGAGAACAGAGAAGGCAGAGGG - Intergenic
922206981 1:223456491-223456513 CAGACAAATGAGAAGGCACCCGG + Intergenic
922758103 1:228107837-228107859 CAGAGCACCGTGAAGGCCACCGG - Exonic
924748714 1:246864067-246864089 CCGAACACTGAGAAGGCCGGGGG + Exonic
1062902070 10:1154015-1154037 AGGAGGACTGAGAAGGCACCTGG - Intergenic
1063108235 10:3012464-3012486 CAGAGCCCTGAGACAGAAGCAGG + Intergenic
1063451762 10:6154787-6154809 CAGATCAGACAGAAGGCAGCTGG - Intronic
1064928951 10:20602557-20602579 GAAAGTACTGAGAAGGCAGTAGG + Intergenic
1065361619 10:24894560-24894582 CAGAGTTCTGTGAAGGCACCCGG + Intronic
1065786944 10:29224648-29224670 CACTGTCCTGAGAAGGCAGCAGG + Intergenic
1066649712 10:37642829-37642851 CAGAGCACCGAGCAGGCTCCTGG - Intergenic
1067029016 10:42868015-42868037 CAGGCCACGGAGAGGGCAGCTGG + Intergenic
1067067196 10:43110792-43110814 CAGAGCACTGCTGGGGCAGCTGG + Intronic
1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG + Intergenic
1067705527 10:48604239-48604261 CAGAACACTCAGAAAGCTGCAGG - Intronic
1067734709 10:48840586-48840608 CACACCAGTGAGAAGGAAGCGGG + Intronic
1068574406 10:58668399-58668421 CAGAGCACTGTGAATTCATCTGG - Intronic
1069470902 10:68688380-68688402 AAAAGAACTGAGAAGCCAGCCGG - Intronic
1069565525 10:69461051-69461073 CAGAGCGCTGAGTGGGCATCTGG + Intronic
1069624571 10:69859931-69859953 CAAAGCCCTGAGAAGGAAGAAGG + Intronic
1069818810 10:71215020-71215042 CTGGGCAATGAGAAGGCTGCAGG - Intronic
1069842071 10:71346140-71346162 CAGACCACTGAAGAGGCAACAGG - Intronic
1070373962 10:75811029-75811051 GAAACCACTGAGAAGGCAGTAGG - Intronic
1071780719 10:88841308-88841330 CAGAGAAGAGAGAAGGCAGTAGG + Intronic
1073783854 10:106866610-106866632 CAGAGCACTGAGAGGGAACAAGG + Intronic
1075438506 10:122461801-122461823 CGGAGCACTGCGAGGGCGGCCGG + Exonic
1076309550 10:129494895-129494917 CACAGCACAGAGAAGGAAGTTGG - Intronic
1076409387 10:130234954-130234976 CAGACCCTGGAGAAGGCAGCTGG - Intergenic
1076618455 10:131771860-131771882 GTGAGCACTGAGGAGGCAGCAGG - Intergenic
1076811808 10:132890271-132890293 CAGGGCACTGGGGAGGCAGAAGG - Intronic
1077082193 11:729092-729114 CAGAGGTCCGAGCAGGCAGCTGG - Intergenic
1077244031 11:1527259-1527281 CAGAGCATGGAGACGGCAGTGGG - Intergenic
1077336302 11:2006349-2006371 CAGAGCAGTGAGATGGAAGGAGG + Intergenic
1077438224 11:2555140-2555162 GAGAGTGCTGAGAAGGCCGCAGG - Intronic
1079009713 11:16817982-16818004 AAGAGCAGTGAGAAAACAGCAGG - Intronic
1083799011 11:65035576-65035598 GAGAGCACCGAGGAGGCATCTGG + Exonic
1084511392 11:69606593-69606615 CAGAGCACTGTGAACGCAGAAGG + Intergenic
1085265642 11:75236435-75236457 CAGAGGGATGGGAAGGCAGCAGG + Intergenic
1085417613 11:76329834-76329856 CAGAGGACTTACAAAGCAGCAGG - Intergenic
1085758315 11:79219932-79219954 CAGAGAACTGCAAAGGTAGCAGG + Intronic
1086049866 11:82577393-82577415 CAAACCACAGAGATGGCAGCTGG - Intergenic
1088735186 11:112722987-112723009 CAGAGAACAGAGACGGGAGCAGG + Intergenic
1088814110 11:113409983-113410005 CAGGGCCGTCAGAAGGCAGCAGG + Exonic
1088860210 11:113791699-113791721 CAGGGGCCTGAGAAGGTAGCGGG + Intergenic
1088920818 11:114258675-114258697 CAGAGTACTGAGGAGTCACCAGG - Intronic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089325668 11:117655142-117655164 CAGGGCATGGAGATGGCAGCTGG - Intronic
1089387030 11:118075141-118075163 CAGGGCAGTGAGAAGCCAGTGGG - Intergenic
1089659103 11:119974373-119974395 CAGGGCTCAGAGAAGACAGCAGG - Intergenic
1089742105 11:120591566-120591588 CAGAGGAGGCAGAAGGCAGCTGG - Intronic
1089788736 11:120926987-120927009 CAGAACGGTGAGAAGCCAGCTGG + Intronic
1090478351 11:127045618-127045640 CAGAGCCCAGAGGTGGCAGCAGG - Intergenic
1090837160 11:130462050-130462072 AAGAGGACTGAGAGGGCAGGAGG - Intronic
1202819286 11_KI270721v1_random:61531-61553 CAGAGCAGTGAGATGGAAGGAGG + Intergenic
1092016931 12:5167368-5167390 CAGAGGACTGCTAAGGCCGCAGG - Intergenic
1093699371 12:22201590-22201612 CGGTGCACTGAGAATGCAGCTGG - Exonic
1094367638 12:29701054-29701076 CAGAGCAGTGAGAGGACAGAGGG - Intronic
1095415122 12:41968232-41968254 CAGCGCACTGGGAGGGCACCAGG - Intergenic
1095655645 12:44666838-44666860 CAGAACACTGAGAGGGGAGAAGG - Intronic
1095919913 12:47518671-47518693 CAGAGCACTGATAGGGGAGGTGG - Intergenic
1096031436 12:48419206-48419228 CAAAGACCAGAGAAGGCAGCAGG + Intergenic
1096677235 12:53232322-53232344 CAGGGCACAGAGGAGGGAGCCGG - Intronic
1097104290 12:56611979-56612001 GAGACCACTGAGAAGACTGCTGG + Exonic
1097193678 12:57232409-57232431 TAAAGCCCTGAGAAGGAAGCAGG - Intronic
1098689232 12:73465683-73465705 CACAGGACTGACTAGGCAGCTGG - Intergenic
1100885007 12:99060039-99060061 CAGAGTGGTGAGCAGGCAGCAGG + Intronic
1101010155 12:100441146-100441168 GAGAGCACAGAGAAGGTAGGAGG - Intergenic
1101364175 12:104056152-104056174 CAAAGCATAGAGAGGGCAGCTGG - Intronic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1102051000 12:109861944-109861966 GGGAGCACAGAGAAAGCAGCAGG - Intronic
1102286872 12:111664797-111664819 CAGAACCCAGAGAAGGCAGTGGG - Intronic
1102686158 12:114726339-114726361 CCGGGCACTTAGAAGGCACCCGG + Intergenic
1102819340 12:115894685-115894707 CAGAGCAAGGGGGAGGCAGCAGG + Intergenic
1103057368 12:117832464-117832486 TTGAGCACAGAGAATGCAGCAGG + Intronic
1103324030 12:120108583-120108605 AAGAGCATTGAGAAGTGAGCTGG - Intronic
1103586449 12:121959784-121959806 CAGAAAACTGAAAAGGTAGCGGG - Intronic
1103853937 12:123951602-123951624 AAGTGCACAGAGAGGGCAGCAGG - Intronic
1105637767 13:22231943-22231965 CAAAACACTGAAAGGGCAGCCGG - Intergenic
1105843106 13:24272513-24272535 GAGAGCTCTGAGAGGGCAGGGGG + Intronic
1106486693 13:30179068-30179090 CTCTGCACAGAGAAGGCAGCTGG - Intergenic
1107667146 13:42702901-42702923 CAGGGCAGTGAAAAGGCAGTGGG - Intergenic
1108756605 13:53510552-53510574 CAGGGCACTGAGATGGAAGTGGG - Intergenic
1109044380 13:57390017-57390039 CAGAGCTCTGAGATGGCACAGGG + Intergenic
1110405067 13:75141838-75141860 CAGAGCTCTGAGAAGTAGGCAGG + Intergenic
1112673039 13:101663471-101663493 CCAAGCACTGTGATGGCAGCTGG - Intronic
1112737163 13:102433433-102433455 CACATCACTGAGAAGCCAGAAGG + Intergenic
1112786094 13:102953246-102953268 CAAAGCACTGGGTAGGTAGCGGG + Intergenic
1113531447 13:111030356-111030378 CAGCGCACAGAGAACGCATCCGG + Intergenic
1117148203 14:52856454-52856476 AAGATCACTGGGAAGGCAGCGGG + Intergenic
1119477753 14:74940998-74941020 CAAAGCACTGAGGAGGAAGACGG + Intergenic
1119760317 14:77146246-77146268 CAGAGCACGCAGGAGGCAGAGGG + Intronic
1121168697 14:91835873-91835895 CCGAGCACGGAGCAGGGAGCCGG + Intronic
1121335857 14:93077100-93077122 TGGAGCATTGGGAAGGCAGCGGG - Intronic
1121413300 14:93762454-93762476 CAGGGCACAGAGAAGATAGCTGG - Intronic
1122094498 14:99361356-99361378 AAGATCACTGAGAAGTTAGCAGG - Intergenic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1122848647 14:104514596-104514618 CTGGGCAGTGAGAAGGCAGGTGG + Intronic
1123142376 14:106093960-106093982 CTGAGCACACAGAGGGCAGCAGG + Intergenic
1123149697 14:106169163-106169185 CTGAGCACACAGAGGGCAGCAGG + Intergenic
1123163929 14:106307796-106307818 CTGAGCACATAGAGGGCAGCAGG + Intergenic
1123223451 14:106878032-106878054 CTGAGCACACAGAAGGCAGCAGG + Intergenic
1123459639 15:20458194-20458216 CAGAGCACTGAGGTGGCAGTGGG + Intergenic
1123658423 15:22542226-22542248 CAGAGCACTGAGGTGGCAGTGGG - Intergenic
1124006854 15:25801502-25801524 CAGAGCACTGAGAATGAGGGCGG + Intronic
1124082680 15:26516306-26516328 CAGAGCACTGGCAAAGCAGGAGG + Intergenic
1124265868 15:28234031-28234053 CAGAGCACTGAGGTGGCAGTGGG + Intronic
1124312288 15:28636718-28636740 CAGAGCACTGAGGTGGCAGTGGG - Intergenic
1124713445 15:32033679-32033701 CAGAGCGCTGAGATTTCAGCTGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126525456 15:49649434-49649456 GAGAGCATTAAGAAGTCAGCAGG + Exonic
1126919712 15:53507530-53507552 CAGAGGACAGGGAAGGCAGATGG - Intergenic
1127530516 15:59839164-59839186 CAGAGCAGTGTGAAGGAAGCTGG - Intergenic
1127532007 15:59852579-59852601 CAGAGCACAACCAAGGCAGCAGG + Intergenic
1127992959 15:64134172-64134194 CAGACTACTGGGAAAGCAGCAGG - Intronic
1128065889 15:64764182-64764204 CACAGCACCAAGAAGGCTGCAGG - Intronic
1128682307 15:69660969-69660991 CAGAACATTGAGATGGAAGCTGG + Intergenic
1128907086 15:71476880-71476902 CAGATAACTGATGAGGCAGCTGG - Intronic
1129064603 15:72890265-72890287 CAGAGAGCTGAGACGGCAGCTGG + Intergenic
1129522211 15:76192997-76193019 CAGGGCAGTGAGGACGCAGCCGG + Intronic
1129589296 15:76900763-76900785 CAAAGCAGTGAGAAGCCTGCTGG + Intronic
1130112602 15:80977924-80977946 CAGAGAACTGAGAATGCAGAGGG + Exonic
1130566573 15:85001279-85001301 TAGAGCACTAAGAAGGAAGTAGG + Intronic
1130867558 15:87945526-87945548 CAGAGCCCTGAGAGGTCAGTGGG + Intronic
1131157508 15:90084265-90084287 CAGAGCCCTGGGCAGGCAGTAGG - Exonic
1131202884 15:90415610-90415632 CAGATGACTGAAAAGGCAGGGGG - Intronic
1131248976 15:90818731-90818753 CAGGGCTCAGAGAAGCCAGCTGG + Intergenic
1131902493 15:97103753-97103775 CAGAGCACTGAGCTGGCACCTGG + Intergenic
1132037188 15:98494189-98494211 CAGAGTGGTGAGAAGGCAGGAGG + Intronic
1132286026 15:100663222-100663244 CACATCACAGAGAAGCCAGCAGG + Intergenic
1132788010 16:1668910-1668932 CCCACCACGGAGAAGGCAGCAGG - Intronic
1133293236 16:4736478-4736500 TGGTGCACTGAGAAGGCATCTGG + Exonic
1133463462 16:6007413-6007435 CACATGACTGAGCAGGCAGCTGG + Intergenic
1133708114 16:8375069-8375091 CAGGGCTCTGAGAAGGCCCCGGG + Intergenic
1134176116 16:12007815-12007837 AAGAGCAAAGACAAGGCAGCTGG - Intronic
1134278131 16:12794892-12794914 CAGAGAACTAAGAAAGCAGATGG + Intronic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136287195 16:29251510-29251532 AAGGGCGCTGAGAAGGGAGCTGG + Intergenic
1136704056 16:32171427-32171449 CAGAGCACTGAGGTGGCAGTGGG + Intergenic
1136763853 16:32757979-32758001 CAGAGCACTGAGGTGACAGTGGG - Intergenic
1136804246 16:33112407-33112429 CAGAGCACTGAGGTGACAGTGGG + Intergenic
1137622159 16:49883203-49883225 CAGAGCCCTCAGAGGGCACCTGG + Intergenic
1138103486 16:54273722-54273744 CTGAGCACTGGAAATGCAGCTGG - Intergenic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1139408702 16:66740811-66740833 TAGAGCCCTGGGAAGACAGCTGG - Intronic
1139671836 16:68497491-68497513 CAGAGCAGAAAGGAGGCAGCAGG - Intergenic
1139915369 16:70424989-70425011 CAGGGCACAGAGATGGCAGCTGG + Intronic
1140245534 16:73244839-73244861 CAGAGGACTTAGAAACCAGCAGG + Intergenic
1140458669 16:75120371-75120393 AAGAGAACAGAGAAGGCACCAGG + Intergenic
1140852540 16:78948568-78948590 CAGAGGGATGAGGAGGCAGCAGG - Intronic
1141633111 16:85299577-85299599 CAGAGAACGGAGTAGGCAGAGGG - Intergenic
1142092805 16:88224143-88224165 AAGGGCGCTGAGAAGGGAGCTGG + Intergenic
1203066000 16_KI270728v1_random:1018301-1018323 CAGAGCACTGAGGTGGCAGTGGG - Intergenic
1142469899 17:157405-157427 CAGAGCCCTGAGGAAGCAGGGGG - Intronic
1142757156 17:2023402-2023424 CATACCACAGCGAAGGCAGCCGG + Intronic
1145286056 17:21506657-21506679 CAGCTCACTGACCAGGCAGCGGG + Intergenic
1145370538 17:22303214-22303236 CAGAGCCCTGACAACGAAGCAGG - Intergenic
1145391550 17:22459634-22459656 CAGCTCACTGACCAGGCAGCGGG - Intergenic
1146662191 17:34672314-34672336 CCCAGCACTGGGAAGGCAGAAGG + Intergenic
1147037381 17:37691872-37691894 CAGGGCACTGACAAGGGGGCAGG - Intronic
1147937788 17:44023536-44023558 CAGAGCAAGGTCAAGGCAGCTGG - Intronic
1147993524 17:44349437-44349459 CACAACACTGAGCAGGCATCTGG + Exonic
1148080677 17:44966485-44966507 GAGAGCACTGGGAAGGGAGGTGG + Intronic
1148683276 17:49486708-49486730 CACAGCACACAGGAGGCAGCAGG - Intergenic
1149307036 17:55357992-55358014 GAGAGCAATGAAGAGGCAGCTGG + Intergenic
1149563392 17:57625388-57625410 AAAAGCTCTGAGTAGGCAGCAGG + Intronic
1150302221 17:64056074-64056096 GAGACCAGTGAGAAGGCACCTGG + Intronic
1150343684 17:64388052-64388074 CAGAGGCCTGAGGAGGCAGTGGG + Intronic
1150435011 17:65146990-65147012 CAGGGAACTGAGGAGGCAACAGG - Intronic
1150572827 17:66402717-66402739 CAGAGCACTGAGATGTTTGCTGG + Intronic
1150731078 17:67694458-67694480 CTGAGCACTGAGAGGGAAGCAGG - Intronic
1151397606 17:73834383-73834405 AACAGCAGTGAGGAGGCAGCCGG + Intergenic
1151526278 17:74671179-74671201 CAATGCCCTGAGAACGCAGCCGG + Intronic
1151527059 17:74677730-74677752 CAGATCCCAGAGCAGGCAGCTGG + Intronic
1151686102 17:75647575-75647597 CTGGGGACTGAGATGGCAGCAGG + Exonic
1152446325 17:80346700-80346722 AAGAGATCTGAGTAGGCAGCCGG - Exonic
1152516825 17:80830164-80830186 CACAGAACAGAGAAGCCAGCGGG - Intronic
1152778037 17:82214106-82214128 ACAAGCACTGAGAAGGCAGCAGG - Intergenic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153335690 18:3922052-3922074 CAGGGAATTGGGAAGGCAGCAGG + Intronic
1153660670 18:7323065-7323087 CAGACCACGAAGTAGGCAGCTGG - Intergenic
1153785460 18:8529803-8529825 CAGAGCACTGAGAAGGAACACGG + Intergenic
1155436080 18:25814452-25814474 AAGGCCACTGAGAAGGTAGCTGG - Intergenic
1157479242 18:48042586-48042608 GTGGGCACTGGGAAGGCAGCAGG + Intronic
1157719129 18:49910095-49910117 CCGAGCACTGAGAAGCAGGCAGG + Intronic
1158438906 18:57455979-57456001 CAGAGCTCTGAGAGGGAACCGGG - Intronic
1158498983 18:57983187-57983209 TAGGGAACTGAGAAGACAGCTGG + Intergenic
1159135505 18:64332430-64332452 CAGAGCTCTGAGGAAGGAGCAGG - Intergenic
1160766689 19:811920-811942 AAGAGCACAGAGAAGACAGGAGG - Exonic
1160793316 19:932912-932934 CAGAGCAATGAACAGCCAGCTGG - Intronic
1160847233 19:1171998-1172020 CAGAGCACAGAAGAGGCAGCAGG - Intronic
1161058311 19:2201420-2201442 AAGAGCACAGGGAAGACAGCAGG - Intronic
1161159726 19:2755157-2755179 CCGGGCACAGGGAAGGCAGCTGG - Exonic
1161293724 19:3508926-3508948 CAGGGCACTGAGCAGGCCGGAGG - Intronic
1161926629 19:7305530-7305552 CAGAGGGCAGAGTAGGCAGCGGG - Intergenic
1163092736 19:15032370-15032392 GAGAGCACTGAGAATGGAGTCGG - Intergenic
1163188825 19:15660447-15660469 TAGACCACTGAGAAGGGAGAAGG + Exonic
1163215971 19:15877697-15877719 TAGATCACTGAGAAGGGAGAAGG - Intergenic
1163653589 19:18532678-18532700 CAGGGCACTTAGCAGGCAGCCGG + Exonic
1163817276 19:19474504-19474526 CAAAACACTCAGAAGGAAGCCGG - Intronic
1164811122 19:31156876-31156898 TACGGCACTGAGAAGGTAGCTGG + Intergenic
1164896654 19:31882859-31882881 GTGAGCAAGGAGAAGGCAGCTGG - Intergenic
1165739359 19:38196263-38196285 CTGAGCAGTGAGACGCCAGCAGG + Intronic
1165762070 19:38327268-38327290 CAGGGCACGGAGGGGGCAGCAGG - Exonic
1165903815 19:39181411-39181433 CAAAGCTCTGAGAAGGCTGGAGG + Intronic
1166049256 19:40248353-40248375 CAGGGCACTGTGGATGCAGCAGG + Intronic
1167030690 19:46957931-46957953 GAGAACACTGAGGAGGGAGCTGG + Intronic
1167136815 19:47621385-47621407 CAAAGCACTGGGAAGACATCAGG - Intronic
1168076836 19:53985078-53985100 AAGTTCACTGAGAAGGCAGAGGG + Exonic
925284963 2:2709778-2709800 CTTAGCACAGAGCAGGCAGCTGG + Intergenic
925324474 2:3007231-3007253 CACAGCACTTAGAACACAGCTGG - Intergenic
925664736 2:6240640-6240662 CGGAGCACAGAGAAGGCAACGGG + Intergenic
925919377 2:8628512-8628534 CATGGCACGGAGAAGGCAGTTGG + Intergenic
926149137 2:10415092-10415114 CAGAGCACTGAGACTCAAGCTGG - Intronic
926228402 2:10984437-10984459 CTGGGCACTGAGAAGGAGGCAGG - Intergenic
926302772 2:11616458-11616480 CAGAGCACTGAGGAGACAGGAGG - Intronic
927703676 2:25283964-25283986 CAGAGCACACAGCAGGCACCCGG - Intronic
928198651 2:29232557-29232579 CAGACCACTGAGAGGTCACCAGG - Intronic
931629674 2:64287387-64287409 CAGAGTCCTGAGAAAGTAGCAGG - Intergenic
932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG + Intronic
932720823 2:74138062-74138084 GAGAGCAGGGAGAAGGCATCAGG - Intronic
932813330 2:74842629-74842651 CAGAGGACAGAGAAGTCAGAAGG + Intronic
933704669 2:85280846-85280868 CCGAGCAAAGAGAAGGCTGCGGG + Intronic
933779015 2:85788608-85788630 GAGAGCACTGTCAAGGCAGAAGG + Intergenic
934759285 2:96844584-96844606 CAGAGCACTGAGGGAGGAGCGGG - Intronic
934937241 2:98474278-98474300 CCAAGCACTGGGAAGGCTGCGGG - Intronic
935386568 2:102505504-102505526 AAGAGAACTGAAAATGCAGCAGG - Intronic
935697643 2:105783974-105783996 CAGGTCACTGAGTAAGCAGCAGG + Intronic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
936401940 2:112171303-112171325 CAGGGCACTGAGAAGTCAAATGG + Intronic
937088589 2:119189435-119189457 CATAGCACTGAGAGAGCAGCTGG - Intergenic
938373878 2:130791526-130791548 CAGCACACTGAGAGGGAAGCTGG + Intergenic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
939393186 2:141594319-141594341 CACAACACTGGGAAGGCAGATGG + Intronic
939601447 2:144196737-144196759 CAGATCACTGAGGAGGAAACTGG + Intronic
941118779 2:161504283-161504305 CCGAACACTGAGAAGGCCGGGGG + Intronic
941344231 2:164348098-164348120 CAGAGCACTGAGAAGAAACATGG - Intergenic
943313765 2:186359774-186359796 ATGAGCACTAAGAAGGCAGGTGG - Intergenic
943657614 2:190526266-190526288 CAGGGCACTGAGGGGACAGCAGG - Intronic
943697137 2:190948943-190948965 CAGGGCACTGTGTGGGCAGCTGG + Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944125747 2:196290791-196290813 CAGAACACTGAGCTGGAAGCAGG - Intronic
944499153 2:200340528-200340550 CAGAGAACAAAGATGGCAGCTGG - Intronic
944696118 2:202201750-202201772 TAGAGCTCTGAGTAGGCAGTCGG + Intergenic
945924557 2:215790067-215790089 CAGATCACTTAGAAAGCAGCAGG + Intergenic
946073007 2:217050503-217050525 CTGAGCATTGGGAGGGCAGCAGG - Intergenic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
946912056 2:224473364-224473386 CAGAGCACAAAGTTGGCAGCTGG - Exonic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
947166006 2:227263181-227263203 CAAAGGACTGAGAAACCAGCCGG - Intronic
947567179 2:231201635-231201657 CAGAGCAGTGAGGAAGCAGTGGG - Intronic
947732729 2:232440100-232440122 AAGGGCACTGAGGAGGGAGCTGG - Intergenic
948426103 2:237887308-237887330 CAGGGGACTGAGAATGCTGCTGG - Intronic
948594084 2:239068300-239068322 GAGAGCCCAGAGCAGGCAGCGGG - Intronic
948770841 2:240250638-240250660 CTGAGGACAGAGAAGGCACCTGG + Intergenic
948794594 2:240395740-240395762 CTGAGCACTGGGCAGGCTGCGGG + Intergenic
1168998651 20:2150828-2150850 CAGAGCACTGAGTAGGTGGCTGG - Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170440709 20:16376354-16376376 TAAAGCACTGAGAAGGCAATGGG + Intronic
1170757852 20:19220433-19220455 CAGAGGACAGAGAAAGGAGCAGG + Intronic
1171345162 20:24460271-24460293 CAGAGCCCAGAGAAGTAAGCAGG - Intergenic
1171880956 20:30617076-30617098 CAGTGCACTGAGAGTGCACCTGG + Intergenic
1172032889 20:31994155-31994177 CTGGGCACTGAGAAGGGAACAGG + Intronic
1172306891 20:33887071-33887093 CAGAGAACAGGGAAGGCAGTGGG + Intergenic
1172882116 20:38208866-38208888 CAGTGCACAGAGAGGGAAGCAGG + Intergenic
1173565981 20:44039062-44039084 CAGAGGGCTGGGCAGGCAGCCGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173838342 20:46140082-46140104 CAGCCCACTCAGAAGGCTGCAGG + Intergenic
1174031944 20:47635942-47635964 CAGGGCACTGAGAGAGCTGCTGG - Exonic
1174417098 20:50374732-50374754 GAGAGCAGGGAGGAGGCAGCAGG - Intergenic
1175928899 20:62484401-62484423 CAGGGCACTTTGCAGGCAGCAGG + Intergenic
1175962741 20:62645399-62645421 CAGGGGCCAGAGAAGGCAGCAGG - Intronic
1176262820 20:64191716-64191738 CAGAGCACTGATAATCCTGCGGG - Intronic
1176306009 21:5123501-5123523 AAGGGCACTGAGAAAACAGCTGG + Intronic
1176309630 21:5142748-5142770 CACAGGACTGAGAAAGCTGCCGG + Intronic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1177223881 21:18228549-18228571 CAGAGAACTGAAAACACAGCTGG - Intronic
1177807515 21:25888804-25888826 AAGAGCACTTAAAAGGCAACCGG + Intronic
1177925087 21:27204058-27204080 CTGATCACTGGGAAGGCAGAAGG + Intergenic
1178603984 21:34019132-34019154 CACAGCAGTGAGAAGGGAGCAGG - Intergenic
1179175466 21:39005039-39005061 CAGAGCCTTGAGCAGGAAGCGGG + Intergenic
1179471918 21:41616430-41616452 CGGAGGGCTGGGAAGGCAGCTGG - Intergenic
1179732756 21:43376596-43376618 CAGAGCTCAGAGGAGGCAGGCGG - Intergenic
1179847428 21:44119285-44119307 CACAGGACTGAGAAAGCTGCCGG - Intronic
1179851048 21:44138530-44138552 AAGGGCACTGAGAAAACAGCTGG - Intronic
1180080121 21:45482858-45482880 CCGAGCACTGAGTGGGCACCAGG - Intronic
1180913457 22:19469460-19469482 GAGAGCACTAAGCAGGCAGGAGG + Intronic
1180939159 22:19645509-19645531 CAGATGCCTGTGAAGGCAGCAGG - Intergenic
1181513253 22:23398163-23398185 CAGAGGACGGAGGAGGCAACAGG + Intergenic
1181546803 22:23606867-23606889 CAGGGGCCTGAGAAGCCAGCAGG - Intergenic
1181814700 22:25429480-25429502 CAGAGCCCTGAGAAGGGGGCAGG - Intergenic
1181891087 22:26064156-26064178 CAGAGCACGGAGCATGAAGCAGG + Intergenic
1181894349 22:26093668-26093690 CAGAGCACTGATGTGGGAGCTGG + Intergenic
1181915153 22:26273893-26273915 AAGTGGACTGAGAAGTCAGCAGG + Intronic
1182841378 22:33392924-33392946 CAGAACACTGAGAAGGCTATGGG - Intronic
1183373254 22:37447689-37447711 CTGAGCACTGGGATGCCAGCTGG + Intergenic
1183519378 22:38287735-38287757 CAGAGCGCTTAGGAGGCACCTGG + Intergenic
1183569033 22:38638274-38638296 CAGAGGACTGAGCAGGAAGTGGG + Intronic
1184242918 22:43220896-43220918 CAGAGCTCTCAGCACGCAGCAGG - Intronic
1184503215 22:44886160-44886182 CAGGGCCCTGAACAGGCAGCAGG + Intronic
1184660831 22:45964792-45964814 CTGAGCACTGAGGAGGAGGCAGG + Intronic
1184803890 22:46779716-46779738 CGGAGCACTGAGAACCCAGTAGG - Intronic
1185184929 22:49393343-49393365 TAGAGCCCAGAGAAGCCAGCAGG + Intergenic
1185250604 22:49799694-49799716 CTGTCCACTGAGAAGGGAGCAGG - Intronic
1185338801 22:50282648-50282670 AAGGGCACTGAGGAGGCAGCTGG + Intronic
949838281 3:8292738-8292760 GTGTGCACTAAGAAGGCAGCTGG - Intergenic
949859456 3:8492203-8492225 CAGGGCACTGAGAGGACAGTAGG + Intergenic
950311336 3:11960972-11960994 CAGAGAACGGAGGAGGCAGGAGG + Intergenic
950579454 3:13852927-13852949 GAGAGCACTGGGCAGGCAGGAGG + Intronic
951197132 3:19836642-19836664 CAGAGCACTGAGAAGGAACATGG + Intergenic
952880216 3:37980711-37980733 CAGTGCATGGAGGAGGCAGCAGG - Intronic
953719380 3:45341965-45341987 CAGAGCAGTGAGGAGGCAAACGG + Intergenic
954176482 3:48849286-48849308 CAGAGCATTCAAAAGGCATCTGG + Intergenic
954186279 3:48919199-48919221 CCGAGAGCTGAGAAGGCGGCGGG - Exonic
954957462 3:54534400-54534422 ATGAGCTCTGAGAAGGCAGGAGG - Intronic
955055951 3:55456310-55456332 CAGTGAGCAGAGAAGGCAGCTGG - Intergenic
955444009 3:58988494-58988516 CAGAGCATTGAGATGGGAACAGG + Intronic
955575559 3:60359054-60359076 CCCAGCACTGAGAATACAGCAGG + Intronic
955805152 3:62726015-62726037 CTGACCACTGAGAAGGGAGGAGG + Intronic
956126847 3:66018693-66018715 CCGAGCACTCAGAATGCAGAAGG - Intronic
956177073 3:66483263-66483285 GAGAGCACTGCGAACCCAGCTGG - Intronic
956421175 3:69087270-69087292 CAAAGCACTGAGATTGCAGGCGG + Intronic
956447444 3:69339463-69339485 CACAGAACTGAGAAGGCAACAGG + Intronic
958073262 3:88641954-88641976 CAGATCACTGAGAAGGGAAGAGG - Intergenic
958574172 3:95926294-95926316 AATATCACTCAGAAGGCAGCTGG - Intergenic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
959254927 3:103997296-103997318 CAGTGCAGAGAGAAGGCAGAAGG + Intergenic
959591784 3:108090459-108090481 CTAAGCACTGAGAAGGGAGAGGG + Intronic
960003630 3:112759690-112759712 CATAGCACTAAGAAGACAGGGGG + Intronic
960159491 3:114334436-114334458 CAGAGCACAGACAGGACAGCTGG + Intergenic
961208751 3:125109068-125109090 AAGAGGACTGAGTAGCCAGCTGG - Intronic
961385088 3:126518658-126518680 GCAAGCACTCAGAAGGCAGCTGG - Intergenic
962940001 3:140117109-140117131 CTGAGGAATGAGAAAGCAGCAGG - Intronic
963916352 3:150862115-150862137 CAGAGCCTGGAGCAGGCAGCAGG - Intergenic
966769919 3:183494549-183494571 CAGTGCCCTGAGAAGGCTTCAGG + Intronic
967539999 3:190656293-190656315 CAGAGCTCAGAGAGGGCTGCAGG + Exonic
967986133 3:195096656-195096678 CAGGGCACTGAGAAGGCCTGAGG - Intronic
968073744 3:195804484-195804506 CACAGCACTTAGAAAGCCGCAGG - Intronic
968921865 4:3526535-3526557 CGGGACACTGGGAAGGCAGCCGG - Intronic
969081737 4:4624459-4624481 CAGAGCACTGAGCAGGCTAGTGG + Intergenic
969463755 4:7342813-7342835 CAGAGCTGTGAGCAGGCAGATGG + Intronic
970955393 4:21805063-21805085 CAGAGGGCTGAGAAGGCAGAAGG + Intronic
971189708 4:24415629-24415651 CAGAACACTGAGAAAGAAGAGGG + Intergenic
971296876 4:25401603-25401625 CAGTGCACGGAGAGGGCAGCTGG - Intronic
972138142 4:35918881-35918903 CAGAGAAGTGAGAAAGGAGCTGG + Intergenic
973559919 4:52124923-52124945 CAGAGCACAGAGCAGGGAGAAGG - Intergenic
974003421 4:56532789-56532811 CAGAGAACTGAGAAGCCAAATGG - Intronic
975627453 4:76363898-76363920 GAGACCAGTGAGAAGGCAACTGG + Intronic
977005868 4:91569233-91569255 CAGAGCAATGAGAAGGAACATGG - Intronic
977012361 4:91653705-91653727 AAGAGCACTGTAAAGGCTGCTGG - Intergenic
978208320 4:106105510-106105532 CAGAGCACTGAGAGGGAACATGG + Intronic
978536500 4:109768716-109768738 CAGGGCACTGAGGAAGGAGCGGG - Intronic
978600615 4:110423690-110423712 CAAAGCACTGAGTAGGCATGAGG + Intronic
979203174 4:118003734-118003756 CAGAGCACTAAGACAGGAGCTGG + Intergenic
979346466 4:119592964-119592986 CAGATCTGTAAGAAGGCAGCAGG + Intronic
979685763 4:123508840-123508862 CAGAGCACAGAGGGGGCACCCGG + Intergenic
979869447 4:125800429-125800451 AAGAGAACTGAGTAGGGAGCTGG - Intergenic
980972961 4:139584139-139584161 CAGGGCACTTTGAAGGCTGCTGG - Intronic
982260258 4:153488437-153488459 CAGGGCCCAGAGGAGGCAGCCGG + Intronic
982453484 4:155579434-155579456 CACAGCACTGGGAACACAGCAGG + Intergenic
985009748 4:185570241-185570263 CAGAGCACAGAGGAAGCAGTAGG + Intergenic
985315838 4:188658407-188658429 CTGACCACTGAGAAGTCTGCTGG - Intergenic
985701778 5:1377956-1377978 CAGAGCGCTCAGAGGGCAGCGGG - Intergenic
985754373 5:1704436-1704458 AAGAGAACGGAGAAGGCAGTGGG - Intergenic
986236412 5:5914635-5914657 CAGAGCAGGTAGAAGGCATCCGG - Intergenic
987595059 5:19987575-19987597 CTGAGCACTGAAACTGCAGCAGG - Intronic
987812653 5:22858020-22858042 CTGAGCACTGACTAGGCATCAGG + Intergenic
989335240 5:40308619-40308641 CAGAGCCCTGAGAAGGAAAAAGG + Intergenic
992781578 5:80132906-80132928 AAGAGCAGTGAGAAGGCTGTTGG + Intronic
993111683 5:83664338-83664360 GAGAGCACTGAGGGGGCAGTGGG - Intronic
994807860 5:104475409-104475431 TAGAGCAATGAGGAAGCAGCTGG + Intergenic
995253549 5:110019885-110019907 CAGAGCACTGAGAAGGAGTATGG + Intergenic
996341194 5:122440987-122441009 TAGAGCAGTGATAAGGGAGCAGG - Intronic
997591920 5:135079282-135079304 CAGAGGACTGAGAAGTCAGGAGG - Intronic
997612074 5:135222347-135222369 CAAGGCACTGAGAAGACAGATGG - Intronic
997779576 5:136643321-136643343 TAGAGCACAGAGAAGGCAAAAGG + Intergenic
997829394 5:137136736-137136758 AAGAGCAGTGTGAAGACAGCTGG - Intronic
997970182 5:138395152-138395174 GAAAATACTGAGAAGGCAGCTGG + Intronic
999623077 5:153491553-153491575 GACAGCAAAGAGAAGGCAGCTGG - Intronic
1000698713 5:164421776-164421798 CAGAGCACTGAGAGGGAACATGG - Intergenic
1000847763 5:166302920-166302942 GAAAGCACAGAGAAGCCAGCAGG - Intergenic
1001294330 5:170488620-170488642 CAGAGCTCCGAGAAGCAAGCAGG + Intronic
1002484347 5:179524211-179524233 CAGAGCTTTGTGAAGTCAGCAGG + Intergenic
1002500228 5:179643277-179643299 CAGAGCTTTGTGAAGTCAGCAGG - Intronic
1002501744 5:179651484-179651506 CAGAGCTTTGTGAAGTCAGCAGG + Intergenic
1003370680 6:5523101-5523123 CAGAACTCTGTGAAGGCAGTGGG - Intronic
1004013380 6:11710671-11710693 CAGAACTGAGAGAAGGCAGCCGG + Intergenic
1004339357 6:14794732-14794754 CACAGCCCTGAAAAGGCAGTAGG + Intergenic
1007081206 6:39105858-39105880 CATTGCTCTGAGAAGGCTGCTGG + Intronic
1007083258 6:39123912-39123934 GGGAGCACTGATAGGGCAGCAGG - Intergenic
1007869070 6:45011994-45012016 CATAGCAATCAGAAGGCAGTGGG - Intronic
1008805105 6:55417371-55417393 CATGGCACTGAGACTGCAGCAGG - Intergenic
1011027527 6:82885696-82885718 CTGAGCACTGAGAAGTCAGGAGG + Intergenic
1013429268 6:110041285-110041307 GAGATCACTGTGAAGACAGCTGG - Intergenic
1013482806 6:110566661-110566683 CAGTGCCCTGAGATGGAAGCAGG - Intergenic
1013496949 6:110707012-110707034 AAAAAAACTGAGAAGGCAGCCGG + Intronic
1013601864 6:111712557-111712579 CAGAGCACAGAGCTGGCAGGTGG - Intronic
1014637281 6:123863141-123863163 CAGAGCCCTGTGGAGGCAGAGGG + Intronic
1015197355 6:130537755-130537777 CAGAGAACTGAGAAGGAACATGG + Intergenic
1016941808 6:149488602-149488624 TAGAGCACTGAGAAGAGAGTAGG + Intergenic
1017702893 6:157093067-157093089 CAGCGAAGGGAGAAGGCAGCGGG - Intronic
1017821245 6:158050438-158050460 CAGAGAACTAAGAAGTCAGTCGG - Intronic
1018199246 6:161379973-161379995 TAGGGCAGTGAGAAGGCATCTGG - Intronic
1018414563 6:163590169-163590191 CAGAGCAGAGGGAGGGCAGCTGG - Intergenic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1019493771 7:1326795-1326817 CAGAGCACAGGGCAGGCTGCAGG + Intergenic
1019602122 7:1889975-1889997 CACAGGGCTGTGAAGGCAGCTGG + Intronic
1019623487 7:2003725-2003747 CAGGGCAGTGTGAGGGCAGCAGG - Intronic
1020382899 7:7566230-7566252 CATAGCAGTGAGGAGGCAGTAGG - Intergenic
1020632511 7:10656617-10656639 CAGAGAACTAAGAAGGCGGGTGG + Intergenic
1021730034 7:23587013-23587035 AAGAGCACTGAGAAGGGAGGGGG - Intergenic
1023337653 7:39186935-39186957 CAGAACACAGAGCAGGCGGCAGG - Intronic
1023635505 7:42205505-42205527 CAAAGAACAGAGAGGGCAGCTGG + Intronic
1023747639 7:43336493-43336515 CAGAGTCCTGAGAGGGAAGCTGG - Intronic
1023842030 7:44103517-44103539 CAGAGGACCCAGAAGGCAGGTGG - Intergenic
1024088195 7:45914635-45914657 CAGAGCCCTCAGAAGGGTGCAGG - Intronic
1024823966 7:53367486-53367508 GAAAGCACTGAGGAGGCACCAGG + Intergenic
1025620893 7:63169779-63169801 CAAAGCACTGAGTAGGCATGAGG + Intergenic
1026204244 7:68241854-68241876 CAAAACACTGAGAACTCAGCTGG + Intergenic
1028790214 7:94844842-94844864 CACAAGACTGTGAAGGCAGCTGG + Intergenic
1029137511 7:98384543-98384565 CAGAGCACTGAACAGGTAACAGG + Intronic
1029307137 7:99628701-99628723 CAGGGGACTGAGCAGGCACCTGG + Intronic
1029956193 7:104642772-104642794 CAGATCCGTCAGAAGGCAGCTGG + Intronic
1030624562 7:111830588-111830610 GAGGTCTCTGAGAAGGCAGCAGG - Intronic
1030745059 7:113155213-113155235 CATACCAGTGAGAAGACAGCAGG - Intergenic
1031490144 7:122377375-122377397 AAGAGTACAGAGAAGGCAGATGG - Intronic
1031924832 7:127629440-127629462 CAGAGCACTGGGTAGGCTGCAGG - Intergenic
1032537736 7:132678479-132678501 CCAAGCACTGAGAAGGCAGGAGG + Intronic
1033134307 7:138772382-138772404 CAGAGCCCTGTGCAGTCAGCAGG + Intronic
1033224486 7:139549729-139549751 CAAAGCCCTGTGAAGTCAGCAGG - Intergenic
1034143635 7:148848585-148848607 CAGATGACAGAGAAGGCAGATGG + Intronic
1034226754 7:149490536-149490558 CAGGGCAGTGAAAAGGCAGCAGG + Intronic
1034390683 7:150785232-150785254 AAGAGCAGTGGGAAAGCAGCAGG + Intergenic
1034429900 7:151036036-151036058 CAGTGCATTCAGGAGGCAGCTGG - Intronic
1035120419 7:156562033-156562055 CAGGGCTCAGAGAAAGCAGCTGG + Intergenic
1035128447 7:156628588-156628610 CAGAACACTCAGAAGGCAAAGGG - Intergenic
1035669826 8:1408853-1408875 CAGGGCACAGAGAAGAAAGCTGG + Intergenic
1036077575 8:5518884-5518906 CAGAGAAATGAGAGGGCAGCTGG - Intergenic
1036790059 8:11711269-11711291 AAGAGCCCAGAGAAGGCAGGTGG - Intronic
1038233490 8:25728662-25728684 CAGAGCACTGAGAGGGAACATGG - Intergenic
1038397357 8:27257156-27257178 TGGAGCAGTGAGAAGGCAGAGGG - Intronic
1039822944 8:41149892-41149914 AAGTGGGCTGAGAAGGCAGCTGG - Intergenic
1040981973 8:53253104-53253126 CAGAGCATTGAGAAGCCCTCAGG + Intergenic
1041191411 8:55359164-55359186 AAAAGCACGGAGAAGGCAGAAGG + Intronic
1041289421 8:56294625-56294647 CAGGGCAGTGAGAAGGGAGCAGG + Intergenic
1042779616 8:72476137-72476159 CAGTGCACTGGAGAGGCAGCAGG - Intergenic
1043280992 8:78465966-78465988 CAGAGCACTGAGAGGGAACATGG + Intergenic
1043849707 8:85202288-85202310 CAGAGCACTGAGAAGAAAAAAGG - Intronic
1045105388 8:98887760-98887782 CAGAGCAAGGAGCAGTCAGCAGG + Intronic
1045249702 8:100473254-100473276 CAGAGCAGTGGGAAGGGAGGAGG + Intergenic
1046379445 8:113433644-113433666 CAGATCTCTGGGTAGGCAGCAGG - Intronic
1047132741 8:122039088-122039110 CAGAGTGTTGAGAAGGAAGCGGG - Intergenic
1047329615 8:123874870-123874892 CAGAGAAATGAGATGGTAGCTGG - Intronic
1047520323 8:125591058-125591080 CAGAGCTCTGAGGGGGAAGCTGG + Intergenic
1048871284 8:138801481-138801503 CTGAGCACTGAGAACACAGAAGG + Intronic
1049392705 8:142380356-142380378 CAGAGCAGGGAGGACGCAGCTGG + Intronic
1049659306 8:143812630-143812652 CAGAAGGCTGAGGAGGCAGCTGG - Intronic
1050451482 9:5786292-5786314 CAGAGCACTGAGCTGCCATCTGG - Exonic
1051215343 9:14791778-14791800 CAAATCATTGAGAAGGCAGGAGG + Intronic
1052094540 9:24368934-24368956 CAGAGCACTGAGAGGGAACATGG - Intergenic
1052616025 9:30843072-30843094 CAGAGAACTGAGAAGACATCTGG - Intergenic
1052834881 9:33242850-33242872 CAGAGCACTGGGATGGGGGCAGG - Intronic
1053444060 9:38137908-38137930 TAGCTCACTGGGAAGGCAGCAGG + Intergenic
1053568955 9:39284359-39284381 CAGAGCATTCAGAAACCAGCAGG - Intronic
1053834921 9:42125394-42125416 CAGAGCATTCAGAAACCAGCAGG - Intronic
1053916363 9:42947835-42947857 CAGTGCACTGAGAATGCACCTGG - Intergenic
1054090584 9:60843326-60843348 CAGAGCATTCAGAAACCAGCAGG - Intergenic
1054111995 9:61118883-61118905 CAGAGCATTCAGAAACCAGCAGG - Intergenic
1054128189 9:61334649-61334671 CAGAGCATTCAGAAACCAGCAGG + Intergenic
1054595617 9:67062135-67062157 CAGAGCATTCAGAAACCAGCAGG + Intergenic
1055467252 9:76577864-76577886 CAAGGCATTGAGAAGGAAGCTGG - Intergenic
1056273325 9:84968319-84968341 CAGAGCTCTGAGAATACACCAGG - Intronic
1056677022 9:88684365-88684387 CAGATCACTGAGCTGGCTGCGGG + Intergenic
1056737187 9:89219971-89219993 CAGAGCAATGAAAAGCCAGAGGG + Intergenic
1056787765 9:89605183-89605205 CAGGGCGCTGAGAAAGCCGCTGG + Intronic
1057519880 9:95752151-95752173 CGGGACACTGAGAGGGCAGCGGG - Intergenic
1057710771 9:97441524-97441546 CAAAGGACTTAGAAGGGAGCAGG - Intronic
1057868595 9:98701114-98701136 CAGAGGTCTGAGATGTCAGCAGG - Intronic
1058679770 9:107430746-107430768 CAGAGGAGTGAGAAGGCCACAGG + Intergenic
1060117293 9:120952184-120952206 CAGCGCACTGAGAAGGTAGGTGG - Intergenic
1060186089 9:121564989-121565011 CAGAGCGTTAAGAAGGCTGCGGG + Intergenic
1060496536 9:124123384-124123406 CAGAGGCCAGAGAAGGCAGATGG + Intergenic
1060557493 9:124516174-124516196 CTGAGGAATGGGAAGGCAGCTGG + Intergenic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1060995854 9:127874630-127874652 CAGAGCACTGACACGGCTCCCGG - Exonic
1061230288 9:129311984-129312006 CAGACCCCAGAAAAGGCAGCTGG - Intergenic
1061444814 9:130631849-130631871 CAGGGCACTGAGGGGGCAGTCGG - Intronic
1061484535 9:130913753-130913775 CACTCCCCTGAGAAGGCAGCGGG + Intronic
1061750937 9:132776587-132776609 CAGAGCTCTGAGAGTGCTGCGGG + Intronic
1061764002 9:132869950-132869972 CAGAGCCCTGGAGAGGCAGCAGG - Intronic
1061876286 9:133545742-133545764 CGGAGCACTGGGAAAGCCGCAGG + Intronic
1061950135 9:133931499-133931521 CAGAGGACAGGGAAGGCAGCTGG - Intronic
1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG + Intergenic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1185501522 X:600248-600270 CAGGGCAATGAGCAGGCAGGGGG - Intergenic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1186063247 X:5733451-5733473 CAGTGCACTGAGAAAGGAGATGG - Intergenic
1186644625 X:11493485-11493507 AATAGCATTGAGAAGCCAGCAGG + Intronic
1190094562 X:47468304-47468326 CAGAGCACTTTGAAGGTAGCAGG - Intronic
1191716420 X:64196860-64196882 CAGAACACTGGGAAGGAAGGTGG + Intronic
1191824779 X:65353106-65353128 CTGAGCACTAAGAAGGAGGCCGG - Intergenic
1192450276 X:71240491-71240513 CACAGGGCAGAGAAGGCAGCTGG + Exonic
1193582675 X:83285171-83285193 CAGAGGAATGATCAGGCAGCAGG - Intergenic
1194260875 X:91694065-91694087 CAGAGAGATGAGAAAGCAGCAGG - Intergenic
1194653286 X:96541629-96541651 AAGAGGACTGAGAAATCAGCAGG - Intergenic
1196810645 X:119626428-119626450 CACAGGACTATGAAGGCAGCAGG + Intronic
1198048638 X:132927406-132927428 GAGAGCAGTGAGAAGGCATTGGG - Intronic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1199405373 X:147452268-147452290 CAAAGCAGGAAGAAGGCAGCCGG + Intergenic
1199600256 X:149537434-149537456 GAGAGGAGTGAGAAGGCAGCAGG + Intergenic
1199650328 X:149942506-149942528 GAGAGGAGTGAGAAGGCAGCAGG - Intergenic
1199785329 X:151100132-151100154 CCATGCACAGAGAAGGCAGCTGG + Intergenic
1199991095 X:152988167-152988189 CAGTACACTGGGAAGGGAGCAGG + Intergenic
1200579527 Y:4932867-4932889 CAGAGAGATGAGAAAGCAGCAGG - Intergenic