ID: 1089297675

View in Genome Browser
Species Human (GRCh38)
Location 11:117479976-117479998
Sequence TAGGAGGCCCTGGAAAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089297675_1089297680 -7 Left 1089297675 11:117479976-117479998 CCAAGCTTTTCCAGGGCCTCCTA 0: 1
1: 0
2: 1
3: 18
4: 232
Right 1089297680 11:117479992-117480014 CCTCCTATCCCCCACTCATGGGG 0: 1
1: 0
2: 2
3: 9
4: 181
1089297675_1089297678 -8 Left 1089297675 11:117479976-117479998 CCAAGCTTTTCCAGGGCCTCCTA 0: 1
1: 0
2: 1
3: 18
4: 232
Right 1089297678 11:117479991-117480013 GCCTCCTATCCCCCACTCATGGG 0: 1
1: 0
2: 0
3: 7
4: 117
1089297675_1089297677 -9 Left 1089297675 11:117479976-117479998 CCAAGCTTTTCCAGGGCCTCCTA 0: 1
1: 0
2: 1
3: 18
4: 232
Right 1089297677 11:117479990-117480012 GGCCTCCTATCCCCCACTCATGG 0: 1
1: 0
2: 0
3: 14
4: 133
1089297675_1089297686 5 Left 1089297675 11:117479976-117479998 CCAAGCTTTTCCAGGGCCTCCTA 0: 1
1: 0
2: 1
3: 18
4: 232
Right 1089297686 11:117480004-117480026 CACTCATGGGGACCATTCTTAGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089297675 Original CRISPR TAGGAGGCCCTGGAAAAGCT TGG (reversed) Intronic
900120651 1:1047330-1047352 CAGGACGCCCTGGAACACCTTGG - Exonic
900385030 1:2406611-2406633 AAGGAGGCCCTGGGGAAGGTGGG + Exonic
900494395 1:2969914-2969936 GAGGAGGCCCTGGCTGAGCTCGG + Intergenic
902231519 1:15030647-15030669 TGGGAGGCCCCGGCACAGCTAGG - Intronic
903214853 1:21838336-21838358 CAGGAGGCCATGGAAATGCTGGG + Intronic
904625058 1:31797843-31797865 TCAGATGCCCTGGAAAAGCCTGG - Intronic
904962980 1:34349356-34349378 TAGGAGGCCCTGGAAAACCAGGG + Intergenic
905618004 1:39414228-39414250 TAGGAGGCACTGCAGCAGCTGGG - Exonic
906283649 1:44571118-44571140 TAGGAAGGTCTGGAAAAGTTAGG - Intronic
908863264 1:68514618-68514640 CAGGAGGCCTTGGACAATCTAGG - Intergenic
912432368 1:109635477-109635499 TAGGATGCCCTGGGCAACCTGGG + Intergenic
915127802 1:153678348-153678370 TAGGAGGCGAGGGAAAAGGTGGG + Intergenic
916509711 1:165461225-165461247 TAGCAGACCCTGGAAAAACCAGG - Intergenic
917660814 1:177175267-177175289 GAGGAGACCATGGAAAAGCGGGG + Intronic
917964014 1:180167181-180167203 TAGGAGGCCCTGGATAGCCCAGG + Intronic
920058014 1:203206635-203206657 GAGGAGGCCTAGGAAAAGCACGG + Intergenic
920571560 1:207021974-207021996 AGGGAGGCCCTGAAGAAGCTGGG - Exonic
1064925723 10:20566679-20566701 AAGGAGTCCCTGGGAAATCTTGG + Intergenic
1067182148 10:43996391-43996413 CAGGAAGCCCTGCTAAAGCTTGG + Intergenic
1067397371 10:45934433-45934455 TAAGATGCCCTGGAAAAATTGGG + Intergenic
1067469158 10:46523626-46523648 TAGGAGGCCCTGGGAAGGGAAGG + Intergenic
1067865691 10:49903520-49903542 TAAGATGCCCTGGAAAAATTGGG + Intronic
1068355848 10:55907408-55907430 CAGGTGGACCTGGAGAAGCTGGG + Intergenic
1069582615 10:69576005-69576027 CAGGAGGCCCTAGAGAAGCATGG - Intergenic
1070561637 10:77571863-77571885 TAGAAGGCCCTGGGAACTCTGGG - Intronic
1073329431 10:102661004-102661026 GAGGAGGCCCAGAAAGAGCTGGG + Intergenic
1074004055 10:109401342-109401364 GAGGAGGCCCTGGAAATGTCAGG - Intergenic
1074054218 10:109907567-109907589 TAGCAAGCCCTGGAAGGGCTTGG + Intronic
1075153473 10:119955592-119955614 GAGGAGCCCCTGGAGAACCTGGG + Intergenic
1075425103 10:122336042-122336064 TATGAGGTACTGGAAAATCTGGG - Intronic
1078022588 11:7668205-7668227 TAGGAGCCCCTGGGACAGCATGG + Intronic
1081229170 11:40563747-40563769 AAGGAAGCCCTTGAAAAGCCTGG + Intronic
1082282809 11:50288374-50288396 TAGGAGGCAAAGGAAATGCTAGG - Intergenic
1083412259 11:62502174-62502196 AAGGAGGCAGAGGAAAAGCTTGG - Intronic
1084733772 11:71091535-71091557 GAGGAGGCTCTGGAACAGCAAGG - Intronic
1085935388 11:81135506-81135528 TTGAAGGGCCTGGAAAAGGTGGG + Intergenic
1085991541 11:81852826-81852848 TAGGAGGCCAAGGAGAAGTTTGG + Intergenic
1088724133 11:112619605-112619627 TAGGAGGCCCAGCAAAGGCAGGG + Intergenic
1088986736 11:114915736-114915758 TAGGAGGCAATGGGAAACCTGGG + Intergenic
1089297675 11:117479976-117479998 TAGGAGGCCCTGGAAAAGCTTGG - Intronic
1089607936 11:119652389-119652411 TGGGAGGCACTGGAGAGGCTGGG - Intronic
1090432322 11:126656415-126656437 TTGGAGTCTCTGGAAAACCTAGG + Intronic
1091441902 12:517500-517522 GAGGTGGCCCTGTAAAATCTAGG + Intronic
1091821391 12:3478083-3478105 TGGGAGGCCCAGGAAAGGTTTGG + Intronic
1096621721 12:52869588-52869610 TAGCAGGGCCTGGGGAAGCTGGG - Intergenic
1098260201 12:68661883-68661905 TAGTAGGAACTGGAAGAGCTGGG - Exonic
1101379908 12:104205431-104205453 TAGGAGGGCAGGGAAATGCTGGG - Intergenic
1103620732 12:122185720-122185742 TTGGTGGCCCTGGAGAAGCGAGG + Intronic
1103708523 12:122894611-122894633 TAGGTGGGCCAGGAAGAGCTGGG + Intronic
1103828773 12:123762401-123762423 GAGCAGGTCCTCGAAAAGCTGGG - Intergenic
1106418410 13:29565503-29565525 TAAGAGGTCCTGGAGAAGGTGGG - Intronic
1106893994 13:34277976-34277998 AAGGAGGCCCTGGATATTCTTGG + Intergenic
1107773604 13:43814251-43814273 TAGGAGGCACTGCAAAAGAATGG - Intergenic
1108455755 13:50611994-50612016 TAGGTGACCCTGGAAGAGCCAGG - Intronic
1108745118 13:53385601-53385623 AAGGAGGAGCTGGATAAGCTGGG + Intergenic
1108981030 13:56514744-56514766 AAGGAGACACTGGAAAAGCCAGG - Intergenic
1109897151 13:68708452-68708474 AAGGGTGCCCTGGAAAACCTCGG + Intergenic
1110804612 13:79739662-79739684 TAGGAGGCCCATGGAAATCTTGG - Intergenic
1112749309 13:102566048-102566070 TGGGAGGCCCTGGCAGAGATGGG - Intergenic
1113005481 13:105697041-105697063 TAGGAGGCATTGGAAAAGTTTGG - Intergenic
1113303214 13:109045750-109045772 TGGAAGGACCTGGAAAAGGTGGG - Intronic
1113412574 13:110103206-110103228 TAGAAGGCTCTGGAAAGCCTGGG + Intergenic
1113817969 13:113188483-113188505 TTGGAGGCCCTGCAAAGGCCAGG - Intronic
1118360948 14:65055925-65055947 AATTAGGGCCTGGAAAAGCTGGG - Intronic
1119954637 14:78783824-78783846 TAGAAGGCCATGGAAAAGGGTGG + Intronic
1120139123 14:80907706-80907728 TATGAGGCCCAGGAAAACCAAGG + Intronic
1121791969 14:96705467-96705489 TTGGAGGTTCTGGAAAATCTGGG - Intergenic
1123020534 14:105395881-105395903 TAGGAGGAGCTGGGGAAGCTGGG + Exonic
1124999077 15:34753051-34753073 TAGGAGGTCCTGGAGGAACTGGG - Exonic
1125883647 15:43213010-43213032 GAGGAAGCCCTGAAAAATCTGGG + Intronic
1127017709 15:54707847-54707869 GAGGAGGCCCTGGAGAGGATAGG + Intergenic
1127165087 15:56236494-56236516 TAGGAGGCACTGGACAAGAGTGG + Intronic
1128173499 15:65532867-65532889 TAGCATGCCCTTGAAAAGCTGGG - Intronic
1128495473 15:68196003-68196025 GAGGTGAACCTGGAAAAGCTGGG + Intronic
1129191979 15:73942604-73942626 TAAGACTTCCTGGAAAAGCTTGG - Intronic
1129769605 15:78194609-78194631 TACGAGGCCCTGGATAAGTATGG - Exonic
1132672253 16:1106663-1106685 GAGGTGGCCCAGGAAAAGCCTGG - Intergenic
1133192738 16:4146500-4146522 AAGGAAGACCTGGGAAAGCTGGG - Intergenic
1133255661 16:4514284-4514306 TAGGTGGCCCTGGGAAAGGTGGG - Intronic
1133598852 16:7319592-7319614 TCTGAGGCCCAGGAAAAGCATGG - Intronic
1137569771 16:49557783-49557805 CAGGAGGCCCAGGAAAGGCCAGG + Intronic
1138622481 16:58222997-58223019 TAGGAGCTCCTGGAAAATATAGG - Intergenic
1138659378 16:58508563-58508585 TGGGAGGTCCTGGAAGAGCAGGG + Intronic
1140101619 16:71922538-71922560 AAGGAGGCCCTGGAAGAGGAGGG + Exonic
1141413743 16:83854224-83854246 AATGAGGCCCTGGGAAAGCAAGG + Intergenic
1143340056 17:6203752-6203774 CAAGAGGCCCTGAAAAAGCTAGG + Intergenic
1145210363 17:21008620-21008642 GAGGAGGCACTGGAGATGCTGGG + Intronic
1146141561 17:30372607-30372629 TAGCAGGACATGGAACAGCTGGG - Intergenic
1149452674 17:56762130-56762152 TAGTGGGTCCTGGAAAAGGTGGG - Intergenic
1151472186 17:74325449-74325471 CAGGAGGCCCTGGGAAAACTTGG - Intergenic
1152237616 17:79146778-79146800 TGGGAGGTCCTGCAGAAGCTGGG + Intronic
1152306202 17:79522064-79522086 GGGGAGACCCTGGAAAAACTCGG + Intergenic
1155133604 18:22964472-22964494 TAGGAGTTCCAGGAAAAGCAAGG - Intronic
1155497714 18:26459055-26459077 CAGGAGGCCCGGGAAAATCAGGG - Intronic
1155536748 18:26826474-26826496 AAGCAAGCCCTGGAGAAGCTGGG - Intergenic
1157190151 18:45574890-45574912 TAGGAGGCTGTAGAAAAGCTTGG - Intronic
1157905225 18:51563698-51563720 CAGGAGGCACTGGAGAGGCTGGG - Intergenic
1158903559 18:61988609-61988631 TAGGAGGCCCTTGCAATGATCGG + Intergenic
1159439076 18:68454834-68454856 GGGGAGCCCCTGGAAAAGTTGGG + Intergenic
1160054016 18:75462670-75462692 TGGGAGGCCCTGGAAGCACTGGG + Intergenic
1160256058 18:77249943-77249965 TCGGAATCCCTGGAAAAGCCGGG + Intergenic
1160770690 19:829393-829415 AAGGGGGCCCTGGAAAGTCTCGG + Intronic
1162855188 19:13462698-13462720 TAGGAGGTACTGGCAGAGCTGGG + Intronic
1162965911 19:14156030-14156052 TAGGACACCCTGGAAGAGGTGGG + Intronic
1163625200 19:18385602-18385624 TAGGAGGCACTTGATAAACTGGG - Intronic
1164676670 19:30105690-30105712 GAGGAGGACCTGGAAAAACGAGG - Intergenic
1164861041 19:31562468-31562490 CAGAAGGCCCTGGCAAGGCTGGG + Intergenic
1165066652 19:33232986-33233008 TAGAATGCCCTGGAAATGCCAGG - Intergenic
1165682868 19:37792393-37792415 AAGGAGGCCCTGGAAGAGGAGGG + Intronic
1165686838 19:37829218-37829240 TGGGAGGCGCTGGATAGGCTAGG - Intergenic
1166331221 19:42079098-42079120 CAGGAGGCCCTAGAACAACTGGG - Exonic
1166785329 19:45363862-45363884 CAGGAAGCCCAGGAAATGCTCGG + Exonic
1167112471 19:47470439-47470461 AAGGGGGCCCTGGAGAAGGTGGG - Intronic
925195421 2:1920117-1920139 CAGGAAGACCTGGAACAGCTGGG + Intronic
925294120 2:2766556-2766578 CAGGAGGCCCGGGAGGAGCTGGG - Intergenic
926757555 2:16248583-16248605 TTCGAGTCCCTGGGAAAGCTAGG - Intergenic
927552377 2:24010863-24010885 TAGGAAGCCCTGAACAGGCTGGG - Intronic
928038151 2:27845841-27845863 TAGGTGCCCCAGGAAATGCTTGG + Intronic
931243087 2:60469767-60469789 GAGGAGGACTTGGAAAAGCTAGG - Intronic
931472911 2:62557345-62557367 TATGAGGCCCAGGAACATCTGGG + Intergenic
933332818 2:80916320-80916342 TAAAAGGCCCAGGAAAAACTGGG - Intergenic
933834328 2:86232973-86232995 GAGGAGGCCCTGGAAAATTCCGG - Intronic
936051431 2:109227008-109227030 TAGGCCACCATGGAAAAGCTTGG - Intronic
936100380 2:109572465-109572487 TATGTGGCCCTGGACAAACTTGG - Intronic
938796150 2:134719281-134719303 CAGGCGGCCCTGGCAGAGCTTGG + Intergenic
938840873 2:135161557-135161579 CAGGAGGACTTGGAAAAGCCTGG + Intronic
939480482 2:142741726-142741748 TAGGAGCCCCTTTAAAAGATTGG + Intergenic
940657619 2:156507843-156507865 AAGCAGCCCCTGGATAAGCTAGG + Intronic
942192385 2:173483081-173483103 AAGGGTGCCATGGAAAAGCTTGG + Intergenic
943689674 2:190856761-190856783 TAGGAGGTCCTTGAAAGGGTAGG + Intergenic
944542634 2:200767942-200767964 TAGGGGGCCCTGGGAGACCTGGG - Intergenic
945120277 2:206450329-206450351 TAGGAAGACCTGGAAAACTTGGG - Intronic
946441090 2:219696675-219696697 TAGGAGGAGCTGTCAAAGCTTGG + Intergenic
947735803 2:232454781-232454803 CAGGAGGACCCGGGAAAGCTCGG + Intergenic
947950051 2:234139200-234139222 TAAGAGGCCATGGTAAAGCAGGG + Intergenic
948160822 2:235822662-235822684 GAGGAGGAGCTGGAGAAGCTTGG + Intronic
948513683 2:238489531-238489553 GGGGAGGCCCTGGAGCAGCTGGG - Intergenic
948901836 2:240960192-240960214 GGGGAGGCCCTAGACAAGCTGGG + Intronic
1171145039 20:22774292-22774314 TAGGAGGCCAGGGAAGAGATTGG + Intergenic
1171148762 20:22808716-22808738 TAGGAAGCCTTTGAAAAGCACGG - Intergenic
1173226781 20:41166830-41166852 GAGGAGGCACTGGAGAAGATTGG + Exonic
1174137761 20:48392597-48392619 TAGGAGGCCCTGGAGAGCCCTGG + Intergenic
1175074166 20:56359312-56359334 TCGGGGACCCTGGAAGAGCTCGG - Intronic
1175308220 20:57992617-57992639 TGGAAGGTCCTGGAAAATCTAGG - Intergenic
1175528007 20:59648868-59648890 TAGGAGGGACTGGGACAGCTTGG + Intronic
1179441332 21:41396568-41396590 TAGGATCCCCTGGAGAAGATGGG - Intronic
1183082112 22:35463283-35463305 AATGATGCCCTGGAAAGGCTGGG - Intergenic
1183705078 22:39471040-39471062 AAGGAGGCCCAGGAAAAGCCGGG - Intronic
1184177131 22:42794811-42794833 TAGCAGGCTCAGGAAAAGCCTGG + Intergenic
1184428672 22:44428342-44428364 TAGGAGGCCCCGGAAGAGGAGGG + Intergenic
1184838062 22:47035720-47035742 AAGCTGGCCCTGGAAAAGCATGG - Intronic
1185204208 22:49528543-49528565 TAGGAGGCCCTGTGACACCTGGG + Intronic
1185204310 22:49528958-49528980 TAGGAGGCCCTGTGACACCTGGG + Intronic
1185204406 22:49529318-49529340 TAGGAGGCCCTGTGACACCTGGG + Intronic
1185204433 22:49529408-49529430 TAGGAGGCCCTGTGACACCTGGG + Intronic
1185204447 22:49529453-49529475 TAGGAGGCCCTGTGACACCTGGG + Intronic
950361304 3:12451242-12451264 CAGGAGGCCCTAAAAATGCTGGG + Intergenic
951108972 3:18778496-18778518 TATGAGACCCTGGAAAAGAAAGG - Intergenic
951411794 3:22374697-22374719 TAGGAGGCCGTGGAAGCACTAGG + Intergenic
952988654 3:38811755-38811777 TAGAAAGTCCTGGAAAATCTGGG - Intergenic
953144569 3:40262544-40262566 CAAGAGGCCCAGGAAAAGCTGGG + Intergenic
955665036 3:61341248-61341270 CAGGAAGCACTGGAAAGGCTGGG + Intergenic
959558643 3:107753353-107753375 TAGGAGATCCTGGAAATGTTGGG + Intronic
960141431 3:114155265-114155287 AAACAGGCCTTGGAAAAGCTGGG - Intronic
961549305 3:127659766-127659788 TGGGAGGCCCTGGAAAACTCTGG + Intronic
962978726 3:140469019-140469041 AAGGAGGCCCTCTAAAAGCTAGG - Intronic
964362296 3:155911243-155911265 GAAGAGGCCCTCAAAAAGCTTGG + Exonic
967136325 3:186515813-186515835 GTGGAGGCCTTGGAAAGGCTGGG - Intergenic
967451302 3:189626413-189626435 CAGGATGACCTGGAAAGGCTAGG + Intergenic
968865806 4:3210547-3210569 TAGGAGGCCATGCAAAGCCTTGG + Intronic
968890611 4:3366695-3366717 CAGGAGGCCCTGGTTAGGCTGGG + Intronic
969837834 4:9857854-9857876 TAGCAGGACTTTGAAAAGCTGGG - Intronic
975498188 4:75057462-75057484 TAGGAGGAGCTGGCAAGGCTGGG + Intergenic
976847583 4:89507814-89507836 GAGGAGTCCTTGGAAAAGCGGGG - Intergenic
978675476 4:111309616-111309638 TGGGAAGCCCTGGAAAAGTTGGG + Intergenic
980180575 4:129395433-129395455 GGGGAGGCCCTGGCAAAGCAAGG - Intergenic
981105044 4:140871238-140871260 TAGGAGGCCCTGTACTAGATTGG - Intronic
981155916 4:141434822-141434844 TAGGAGGCACTGAAAAAACATGG - Intergenic
982064366 4:151640018-151640040 TAGGTAGCTCTGGAAAAGCCAGG + Intronic
982391818 4:154873090-154873112 TAGGAGGCAATGGAAAATGTAGG - Intergenic
984391439 4:179138990-179139012 TAGGAGACCCTGGAAAGAGTTGG - Intergenic
985588368 5:752246-752268 GAGGAGGCCCTGGAGGAGCCCGG + Intronic
985603041 5:844701-844723 GAGGAGGCCCTGGAGGAGCCCGG + Intronic
987621152 5:20339581-20339603 TAGGAAGTCCTGGATAAGTTGGG - Intronic
996647543 5:125834674-125834696 TGAGAGGCCCTGGATAGGCTGGG - Intergenic
996776626 5:127139702-127139724 TTGGAGTCCCTGGAAAAGGGAGG - Intergenic
1000872063 5:166588962-166588984 GAGGAGGACCTGGAGAAGTTGGG - Intergenic
1001526257 5:172430745-172430767 TTGGAGGCCCTGGCACAGGTTGG - Intronic
1002836346 6:868455-868477 AAGGAGGTGCTGGAAAGGCTGGG - Intergenic
1002854251 6:1023344-1023366 TAGGAGGCCAGGGCACAGCTAGG - Intergenic
1003889125 6:10548325-10548347 TGGGAGGCCCAGGAATATCTTGG - Intronic
1004500499 6:16205781-16205803 GAGGAGCCAGTGGAAAAGCTAGG - Intergenic
1006611076 6:35294931-35294953 CAGGGGGCCCTGGAATAGCCAGG - Intronic
1007629923 6:43267694-43267716 TAGGAGTTGCGGGAAAAGCTAGG + Intronic
1008444419 6:51571515-51571537 TAGGATGGCTTGTAAAAGCTTGG + Intergenic
1009624008 6:66113435-66113457 CAGTAGGCCCTGCAAAAGCCAGG - Intergenic
1013693134 6:112668374-112668396 GAGGAGGCCCTGGAGAGGGTGGG - Intergenic
1018190384 6:161305016-161305038 CAGGAGGCACGGGAAAAGCTGGG + Intergenic
1019623079 7:2002090-2002112 TCGCAGGCCCTGGAGGAGCTGGG - Exonic
1020810960 7:12849263-12849285 TAGCAGGCCTTGGAAAAGGCTGG + Intergenic
1020821522 7:12974022-12974044 TAGGAGATGCTGGAACAGCTTGG - Intergenic
1021100777 7:16584760-16584782 TCTGAGGCCCTGGAGAAGTTGGG + Intergenic
1021902284 7:25298106-25298128 CAGGATGCCCAGTAAAAGCTAGG - Intergenic
1022459709 7:30594081-30594103 GTGGAGGGCCTAGAAAAGCTGGG - Intergenic
1023827891 7:44021710-44021732 TGGGTCACCCTGGAAAAGCTTGG - Intergenic
1024819224 7:53307452-53307474 TAGGAGACCATGGCAAAACTGGG + Intergenic
1025606942 7:63046318-63046340 TAGCAGGACCTGGAAAACCCTGG + Intergenic
1026893361 7:73996110-73996132 AAAGAGGCTCTGGAAAAGCCAGG + Intergenic
1027178827 7:75923223-75923245 GAGGAGCACCTGGGAAAGCTTGG + Intronic
1027347427 7:77275707-77275729 TAGGAGGCCCAGGAAAATCATGG - Intronic
1029537530 7:101165071-101165093 GAGGAGGCCCTGGGTAAGCGAGG - Intronic
1029756195 7:102575133-102575155 TGGGTCACCCTGGAAAAGCTTGG - Intronic
1029774135 7:102674205-102674227 TGGGTCACCCTGGAAAAGCTTGG - Intergenic
1031431092 7:121670420-121670442 TAGTAGGCCCTGAAAAAACACGG - Intergenic
1034470373 7:151251626-151251648 AAGGAGGCCCGGGAAGAGCGTGG + Intronic
1034553070 7:151833415-151833437 GAGGAGGCCCTGGAAAGGAGAGG + Intronic
1034820708 7:154213850-154213872 GAGGAGACCCTGGAAAAGCAGGG + Intronic
1035667503 8:1389738-1389760 TAGGTGGCCGTGGAGCAGCTGGG + Intergenic
1036611579 8:10355166-10355188 GAGGCGGCACTGGAAAGGCTGGG - Intronic
1036638027 8:10564849-10564871 GAGAAGGCCCTGGAAAGGCCTGG + Intergenic
1036777984 8:11626687-11626709 TAGCAGGGCCTGGAAAACCTGGG - Intergenic
1036782085 8:11656753-11656775 TAAGAGGCCCTAGAGAAACTTGG + Intergenic
1039406013 8:37313077-37313099 TCTGAGGCCCTGGAGAAGATGGG - Intergenic
1039411785 8:37360992-37361014 CAGGAGGCCTGGGAAAAGCCTGG + Intergenic
1039943651 8:42111910-42111932 TAGGAGGCCAGGGAAAAGGGAGG + Intergenic
1045767989 8:105698939-105698961 TTTGAGGGCCTGGAAAAGGTTGG + Intronic
1046306237 8:112371074-112371096 TAGGAGGCCAGGGGAAATCTGGG - Intronic
1049001033 8:139825831-139825853 GAGGAAGCCCTGGAAATCCTTGG - Intronic
1049225321 8:141447999-141448021 GAGGAGGGCCAGGAAGAGCTTGG + Intergenic
1049400743 8:142425879-142425901 AAGGCAGCCCTGGGAAAGCTGGG - Intergenic
1049802751 8:144525779-144525801 GATGGGGCCCTGGGAAAGCTGGG + Exonic
1051823645 9:21195029-21195051 TAGGAGGCCCCGGGGAGGCTGGG + Intergenic
1051825463 9:21213565-21213587 TAGGAGGCCCCGGGGAGGCTGGG + Intronic
1053346583 9:37382835-37382857 CAGGAGGCCCTGGGAAATCTGGG - Intergenic
1053415111 9:37942548-37942570 CTGAAGGCTCTGGAAAAGCTGGG + Intronic
1058085292 9:100741654-100741676 TGGCAGGCCATGGAAAGGCTAGG + Intergenic
1058569677 9:106327268-106327290 TAAGAAGCCCTGGGAAAACTGGG - Intergenic
1059527536 9:115006445-115006467 TGGGAGGGCCTGGGAAAGGTAGG - Intergenic
1060201968 9:121656563-121656585 GAGGAGGGACTGGAAAGGCTAGG - Intronic
1060237018 9:121871715-121871737 GAGGAGGCCCGGGAAGAACTCGG - Intronic
1060470060 9:123941061-123941083 TATGTGGCCCTTCAAAAGCTGGG + Intergenic
1061413224 9:130432155-130432177 TAGGAGGGCCTGGGAGAGATGGG - Intronic
1061483236 9:130907371-130907393 TGGAAGGCCAGGGAAAAGCTGGG - Intronic
1061553493 9:131351226-131351248 TAGGAGGCCCAGGAGGAGTTTGG + Intergenic
1185737817 X:2506417-2506439 CAGGAGGCCCTGGAAAGAATTGG + Intergenic
1186772377 X:12830730-12830752 TAGGAGGATCTGGAAGAGATGGG - Intergenic
1189110471 X:38285356-38285378 TAGGAGGCACTGGTAAATTTTGG - Exonic
1189386217 X:40539113-40539135 TAGAAGGCTCTGGAGAAGCTAGG - Intergenic
1191608602 X:63087587-63087609 TAGGTGTCCCTGGCAAAACTTGG - Intergenic
1192189689 X:68983318-68983340 ATGGAGTCCCTGGAAAATCTGGG - Intergenic
1197758023 X:130009880-130009902 GAGGGGGCCCGGGAAGAGCTGGG - Intronic
1197966253 X:132065416-132065438 TTGGAAGCACTGGCAAAGCTAGG + Intergenic