ID: 1089300453

View in Genome Browser
Species Human (GRCh38)
Location 11:117495600-117495622
Sequence TCTAGCACACAGCTCTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089300449_1089300453 -7 Left 1089300449 11:117495584-117495606 CCTTAGGCTTGCCTGGTCTAGCA 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1089300453 11:117495600-117495622 TCTAGCACACAGCTCTAGGGAGG 0: 1
1: 0
2: 2
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089300453 Original CRISPR TCTAGCACACAGCTCTAGGG AGG Intronic
901939365 1:12650472-12650494 TCCAGCACAGAGCTATAGAGAGG + Intronic
902950542 1:19879467-19879489 TCTCGCACACTGCTGTTGGGAGG - Intergenic
904298815 1:29541117-29541139 TCCAACTCACAGCTCCAGGGTGG + Intergenic
906608158 1:47185202-47185224 TGTTGCACACAGCTCTGGGAAGG - Intronic
907208461 1:52796454-52796476 TCTGGCACACAGCTTTTGGGGGG - Intronic
907477198 1:54713665-54713687 GCTAGGACCCAGGTCTAGGGTGG + Intronic
911671204 1:100610227-100610249 TCCAGCACACAGCTGCAGGAGGG - Intergenic
915624042 1:157103719-157103741 TCTAGCCCACAGCACAAGAGGGG - Intergenic
918078934 1:181190981-181191003 TCTAGCTCAGAGCTGAAGGGTGG + Intergenic
920200675 1:204257949-204257971 TCAAGCACCCTGCTCTAGGCTGG - Intronic
921306091 1:213798445-213798467 TCTACCACACAGCTATAGCAGGG + Intergenic
922131604 1:222785949-222785971 TCTAGCACACACATCTATAGAGG + Intergenic
924704783 1:246491672-246491694 ACTAAGACACAGCTCTAGAGAGG + Intronic
1064648301 10:17482571-17482593 CCTAGCACACAGCTTCAGGAGGG + Intergenic
1067718391 10:48707473-48707495 TCCAGCACACAGGGCTGGGGTGG - Intronic
1070823858 10:79379749-79379771 TCCCGCACACAGCCCTGGGGTGG - Intergenic
1073510521 10:104039891-104039913 TCAAGCTCAAAGCTCTTGGGAGG + Intronic
1077215089 11:1392007-1392029 TTTAGAAAACAGCTCGAGGGGGG + Intronic
1078433303 11:11303913-11303935 TCTAGCACACACCCCTTGGAGGG + Intronic
1079601965 11:22320310-22320332 TATAGCATACAGCTCCATGGGGG + Intergenic
1080678196 11:34447249-34447271 TCTATCAGACATCTCTAGGGGGG + Intronic
1081808960 11:45904754-45904776 TCCAGGACACAGCTGGAGGGCGG - Exonic
1085402484 11:76243149-76243171 CCTGGCACACTGCTCTAGGGTGG - Intergenic
1089165404 11:116472139-116472161 CCCAGCCCCCAGCTCTAGGGAGG + Intergenic
1089300453 11:117495600-117495622 TCTAGCACACAGCTCTAGGGAGG + Intronic
1093301012 12:17454997-17455019 TCTAGTACAGAGCTCTATGCAGG + Intergenic
1093822160 12:23634492-23634514 GCTAGCACAAAACTCTAGGAAGG + Intronic
1101042382 12:100769738-100769760 TCTACCACACAGCTATGGGGTGG - Intronic
1101212138 12:102545094-102545116 TCTAGAACACAGGGATAGGGAGG + Intergenic
1102057554 12:109908024-109908046 TCTAGCACCCAGCTCTCCGTGGG + Intronic
1102648785 12:114421607-114421629 TATAGGACACAGCTCTTTGGGGG + Intergenic
1104503392 12:129307582-129307604 TCAAGCAGACAGCTGTATGGAGG - Intronic
1105586891 13:21754051-21754073 ACTAGCACACAATTTTAGGGTGG + Intergenic
1116259312 14:42602507-42602529 TCTAGAAAACAGCTGTAGGATGG - Intergenic
1118878499 14:69805697-69805719 ACTAGGACACATCTCTAGGTTGG - Intergenic
1128664389 15:69527638-69527660 CCAAGCACACAGATCTAGGGAGG + Intergenic
1129005283 15:72367711-72367733 TGAAGTACACAACTCTAGGGTGG - Intronic
1131271424 15:90949789-90949811 TCTAACACCCAGCTCTGGCGTGG - Intronic
1133287363 16:4696852-4696874 CCTGGCACACAGCTTCAGGGTGG + Exonic
1135137575 16:19896279-19896301 TCTTGCTCACAGCTCTGGGTGGG - Intergenic
1141153600 16:81581760-81581782 TCACGCAGACAGCTCTGGGGTGG + Intronic
1141197914 16:81875293-81875315 TCTTGCACAGGCCTCTAGGGGGG - Intronic
1143325079 17:6093400-6093422 TCCAGAACACAGCTCCTGGGGGG - Intronic
1148180432 17:45601170-45601192 TCCAGGACACAGCTGGAGGGCGG + Intergenic
1148268468 17:46244724-46244746 TCCAGGACACAGCTGGAGGGCGG - Intergenic
1151988547 17:77559257-77559279 CCTAGCACGCATCTCTAGGTGGG + Intergenic
1154341210 18:13504046-13504068 TCTCTCCCTCAGCTCTAGGGTGG - Intronic
1158355707 18:56616658-56616680 TTTAGCACATAGCTCTACGATGG + Intronic
1159088744 18:63822845-63822867 TCTAGCACCCAGCGCTAAGGAGG + Intergenic
1159244842 18:65792449-65792471 GCTAACACGCAGCCCTAGGGTGG - Intronic
1159781912 18:72669634-72669656 TCTACCTCACAGCCTTAGGGTGG - Intergenic
1162125619 19:8498279-8498301 TCTACCCCACAGATCTACGGAGG - Exonic
926380826 2:12287601-12287623 TCTGGCTCACAGCTCCAGGCTGG + Intergenic
928166411 2:28975775-28975797 TCTAGCACACAGATCTAGGTGGG + Intronic
933839160 2:86272548-86272570 TCTAGAACAGAGCTCTAGGGAGG - Intronic
936572383 2:113627458-113627480 TCTCGCCCACACCGCTAGGGAGG - Intronic
937333447 2:121046033-121046055 TCTAGGGCACAGCTGTAGTGAGG + Intergenic
937876881 2:126832675-126832697 TCTGGCACACAGCTCTTTGGGGG + Intergenic
938313138 2:130307784-130307806 TGTAGCACAGAGCACTATGGGGG - Intergenic
938828417 2:135030079-135030101 TCTAGCACCCAGCTTGAGGAAGG + Intronic
945569101 2:211441743-211441765 TCTTCCACACAGCCCTAGGGAGG + Intronic
946037464 2:216755450-216755472 TCTTGCTCACATCTCCAGGGTGG + Intergenic
946281804 2:218671474-218671496 TCTCTCACACAGCACTAGTGAGG - Intronic
947743258 2:232494595-232494617 TCCAGCCCACAGCCCCAGGGTGG - Intergenic
947803990 2:232951995-232952017 CCAAGCACACAGCCCTAGGAAGG + Intronic
1171815031 20:29778395-29778417 TCTAGGCCACAGCTCAAGGAGGG + Intergenic
1171903406 20:30878326-30878348 TCTAGGCCACAGCTCAAGGAGGG - Intergenic
1172880696 20:38198057-38198079 TTTAGCAAAGAGCTCTAAGGAGG - Intergenic
1175828567 20:61950248-61950270 TCTGGCACACGGCTGTAAGGTGG + Intergenic
1180060999 21:45385052-45385074 CCTAGCGCACGGCTCCAGGGAGG - Intergenic
1180336798 22:11584284-11584306 TCTAGGCCACAGCTCAAGGGGGG - Intergenic
1181626201 22:24123926-24123948 TCAACCACACAGCTCCAGGCAGG - Intronic
1185427806 22:50783421-50783443 TCTCGCCCACACCGCTAGGGAGG + Intronic
954500085 3:51005221-51005243 TCTAGAACACTGCGCTAAGGTGG + Intronic
954646380 3:52134101-52134123 TTTAGCTCACAGGTCTAGGTAGG - Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
958502367 3:94928798-94928820 TCTACCACACATCTAAAGGGAGG - Intergenic
961448504 3:126992084-126992106 TCCAGCACACAGCCCTGGGCTGG + Intronic
967095044 3:186170774-186170796 TCTTGTACACAGCTCTAAGAAGG - Intronic
967969246 3:194986955-194986977 TCAAGCCCACGGCTCTGGGGTGG - Intergenic
982016505 4:151159657-151159679 TCTAGCACATAGATCTTGGTTGG - Intronic
990988002 5:61659011-61659033 TTTAGCACACAGCCCCATGGAGG - Intronic
991002318 5:61794686-61794708 TGCACCGCACAGCTCTAGGGAGG - Intergenic
991668558 5:69024385-69024407 TCTGTTAAACAGCTCTAGGGAGG - Intergenic
999601716 5:153273485-153273507 TCTAGCAGTCAGTTCTAGTGTGG + Intergenic
1000251340 5:159498485-159498507 TCTAGTGCACATCTTTAGGGAGG - Intergenic
1002117100 5:176971208-176971230 TTTAGCAAAAAGCTCTAGAGTGG - Intronic
1005976363 6:30803133-30803155 TCAAGAATACAGCTCTAGGCCGG + Intergenic
1007304892 6:40896141-40896163 TCTAGCACCCAGCTCAAGATTGG - Intergenic
1011934748 6:92762145-92762167 TTTAGCACAAAGCACTAAGGAGG + Intergenic
1017909004 6:158776893-158776915 TCCAGCACACAGCTTGAGAGTGG - Intronic
1020688663 7:11327489-11327511 TCAATCACACAGGTCTTGGGGGG + Intergenic
1028399576 7:90410128-90410150 TCTAGGATACAGCTCTCTGGTGG - Intronic
1028957278 7:96708165-96708187 TCTACGACACAGCTCTATGTTGG + Intronic
1031367834 7:120924976-120924998 TATAGCACACATCTATAGGATGG + Intergenic
1032237111 7:130134757-130134779 TCTGGCATTGAGCTCTAGGGTGG + Exonic
1032756899 7:134899549-134899571 TGTAAGGCACAGCTCTAGGGTGG - Intronic
1037960360 8:23092981-23093003 TCTCGCCCACAGCTCCTGGGAGG + Intronic
1040029917 8:42814725-42814747 CCGAGCACACCGCTCTAAGGAGG + Intergenic
1042026734 8:64431982-64432004 TCTGGGACACAGCCCTTGGGAGG - Intergenic
1047776444 8:128074801-128074823 GGTTGCACACAGCTCCAGGGAGG - Intergenic
1049672444 8:143875987-143876009 TCGACCCCACAGCTCTGGGGCGG + Intronic
1051584264 9:18710410-18710432 TTTAACACACAGCACTGGGGAGG + Intronic
1053437068 9:38082945-38082967 TCCCGCACTCAGCCCTAGGGAGG - Intergenic
1053866585 9:42444092-42444114 TCCAGCAGACACCACTAGGGTGG - Intergenic
1055112080 9:72569851-72569873 TCTAGCAGACAGCACTCAGGGGG - Intronic
1056886037 9:90444859-90444881 TTTATCACACAGCTCCAGTGGGG - Intergenic
1057345207 9:94244353-94244375 TATAGCACACAGGTCTTGGTGGG - Intergenic
1057724983 9:97562068-97562090 CCTAGCACACAGTGCTGGGGTGG + Intronic
1058606205 9:106726240-106726262 TCTAGCACACAGCTCTGGTTTGG + Intergenic
1203759705 EBV:5804-5826 TACAGCACACAGGTCTGGGGGGG - Intergenic
1186935316 X:14443766-14443788 ACTAGCTCACTGCTCTTGGGAGG - Intergenic
1192167131 X:68833204-68833226 TCTAGCTCACAGTCCTGGGGAGG + Intronic
1192213325 X:69141420-69141442 ACATGCACAGAGCTCTAGGGGGG + Intergenic
1193469212 X:81878688-81878710 TCCAGGCCATAGCTCTAGGGTGG - Intergenic
1198799140 X:140431876-140431898 TCTGGCACTCAGTTCTGGGGCGG - Intergenic
1201071987 Y:10155518-10155540 TCTAGGCCACAGCTCAAGGAGGG - Intergenic