ID: 1089302953

View in Genome Browser
Species Human (GRCh38)
Location 11:117509582-117509604
Sequence CTGGGCTCTCTTCCCCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 495}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089302953_1089302966 30 Left 1089302953 11:117509582-117509604 CCTGGAGGGGGAAGAGAGCCCAG 0: 1
1: 0
2: 4
3: 56
4: 495
Right 1089302966 11:117509635-117509657 TACTAGGAGTGCTGTGAGTGGGG 0: 1
1: 0
2: 2
3: 12
4: 160
1089302953_1089302965 29 Left 1089302953 11:117509582-117509604 CCTGGAGGGGGAAGAGAGCCCAG 0: 1
1: 0
2: 4
3: 56
4: 495
Right 1089302965 11:117509634-117509656 GTACTAGGAGTGCTGTGAGTGGG 0: 1
1: 0
2: 2
3: 9
4: 165
1089302953_1089302959 7 Left 1089302953 11:117509582-117509604 CCTGGAGGGGGAAGAGAGCCCAG 0: 1
1: 0
2: 4
3: 56
4: 495
Right 1089302959 11:117509612-117509634 GGCTCCTCCACCAGCTCATTCGG 0: 1
1: 0
2: 1
3: 9
4: 125
1089302953_1089302962 14 Left 1089302953 11:117509582-117509604 CCTGGAGGGGGAAGAGAGCCCAG 0: 1
1: 0
2: 4
3: 56
4: 495
Right 1089302962 11:117509619-117509641 CCACCAGCTCATTCGGTACTAGG 0: 1
1: 0
2: 0
3: 0
4: 51
1089302953_1089302964 28 Left 1089302953 11:117509582-117509604 CCTGGAGGGGGAAGAGAGCCCAG 0: 1
1: 0
2: 4
3: 56
4: 495
Right 1089302964 11:117509633-117509655 GGTACTAGGAGTGCTGTGAGTGG 0: 1
1: 0
2: 0
3: 11
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089302953 Original CRISPR CTGGGCTCTCTTCCCCCTCC AGG (reversed) Intronic
900249902 1:1663137-1663159 CTGGGGCCTCTTCCTCATCCTGG - Exonic
900260938 1:1729047-1729069 CTGGGGCCTCTTCCTCATCCTGG - Intronic
900387324 1:2416580-2416602 CAGGGCTCACTTCCCCTCCCTGG - Intergenic
900479429 1:2890947-2890969 CTGGGCTGTCTTCCCTCTGTGGG + Intergenic
900629840 1:3628614-3628636 CTGGGAGCTCCTCCCCCTTCTGG + Exonic
900940914 1:5798152-5798174 CAGGGCTCACTTTCCCCTGCAGG + Intergenic
901125526 1:6925898-6925920 ATGGGGCCTCCTCCCCCTCCCGG + Intronic
901142189 1:7042395-7042417 CTGGGCTCCTTTCCCCCCACTGG - Intronic
901154157 1:7124224-7124246 CTGTGCTCTTTTCCCTCTCCTGG + Intronic
901185048 1:7367610-7367632 CTGGGCCCTCTGCACTCTCCTGG + Intronic
901207720 1:7506293-7506315 CTGGGCTCACTTCCCTCCTCTGG - Intronic
901453134 1:9348390-9348412 CTTGCCTCTCCTGCCCCTCCAGG + Intronic
901871362 1:12140853-12140875 CTGGGCCTTCTCTCCCCTCCTGG + Intronic
901988278 1:13092603-13092625 CTGGGCTTTCTTGCCCCTTCCGG + Intergenic
901993534 1:13134164-13134186 CTGGGCTTTCTTGCCCCTTCCGG - Intergenic
902236455 1:15060510-15060532 CTGGATTCTCCTCACCCTCCCGG - Intronic
902856757 1:19211907-19211929 CTGTCCTCCCTTCCCTCTCCAGG + Intergenic
903460360 1:23516527-23516549 CTGGCTTCTCTTCCTCCTCCAGG - Exonic
903530410 1:24026036-24026058 CTAGGCTCACTTCCATCTCCCGG + Intergenic
903539996 1:24091434-24091456 CTGGGCTCTCTGTACCCTCTTGG + Intronic
903572936 1:24319627-24319649 CTCCCCGCTCTTCCCCCTCCAGG - Intronic
903606918 1:24581603-24581625 CTGGGCTCTCTTTCCCAGACAGG - Intronic
903942492 1:26941503-26941525 CCGGGCTCTCTTCTCCCGCCGGG - Exonic
905793530 1:40802634-40802656 CTCGGCCCCCTTCCCCCGCCCGG - Intronic
905922575 1:41729185-41729207 CTGGGCTCTCTGCTTCCCCCAGG - Intronic
906312423 1:44763385-44763407 CAGGCCTCTCCTCCCCTTCCTGG + Intronic
906681050 1:47725575-47725597 CGAGGCTCTCTTCCCACTGCAGG - Intergenic
907064631 1:51468332-51468354 CTTGGCTTTTTTCCCCCTACTGG - Intronic
907394703 1:54181124-54181146 CTGTGCTCTCTCCAGCCTCCAGG + Intronic
907413402 1:54297971-54297993 CTGGGATCTGTTTCCCCTGCTGG - Intronic
908813969 1:68012658-68012680 CTGGGCTCTCATCCTTCTTCTGG + Intergenic
910427949 1:87134227-87134249 CTGGGCTCTGTGCTCCCTCCCGG + Intronic
911374625 1:97036772-97036794 CTGGTCTCTATTTCCCCTCCTGG + Intergenic
911839512 1:102661724-102661746 CTGGGCTCGCTTCTCCCACTGGG - Intergenic
912506204 1:110158305-110158327 CTGGGCTCTATTCTCCTTCCAGG + Intronic
912554839 1:110508450-110508472 CTTGGGTCTCTTTGCCCTCCGGG + Intergenic
912702795 1:111890706-111890728 CTGGCTTCTCTTCTCCTTCCTGG - Intronic
912957401 1:114165195-114165217 CTGGGCTGTCTCCCCACTGCTGG - Intergenic
913318096 1:117569182-117569204 CTGGGGGCTCTGCCCCCTACAGG + Intergenic
913490361 1:119374153-119374175 CTGCCCTCTCTTCCCCATGCTGG + Intronic
914222208 1:145691296-145691318 CTGGGCTCTGGTCCACCTCCAGG + Intronic
914462066 1:147894125-147894147 CTCGGCTCTCTGCAACCTCCTGG - Intergenic
915355745 1:155254554-155254576 CTTGCCTCTCCTCCCTCTCCTGG - Intronic
915981223 1:160420989-160421011 GTGGCCTCTCTTCCCACTCCAGG - Intronic
916014853 1:160741033-160741055 TTGGGGTTTCTTCCCTCTCCAGG + Intronic
916193041 1:162197729-162197751 CTGGGCTCTTTTCCACCACCAGG + Intronic
916770334 1:167901680-167901702 CTAGGCCTTCTTCCCACTCCTGG + Exonic
919919847 1:202161325-202161347 CTGGGCCCTCAGCCCCCTGCAGG + Exonic
920071859 1:203307826-203307848 TTGGCCTCTCTTCCTCCCCCAGG - Exonic
920126613 1:203698709-203698731 CTGGGCTCACTGCAACCTCCTGG + Intronic
920518378 1:206603320-206603342 ACAGGCTCTCTGCCCCCTCCTGG - Intronic
920985237 1:210882672-210882694 TTGTGCTTTCTTCCTCCTCCTGG - Intronic
921042112 1:211442795-211442817 CTGGGCTCCCTTCACTGTCCAGG - Intergenic
921333460 1:214063481-214063503 CTGGCATCTTTTCTCCCTCCTGG - Intergenic
922720489 1:227897566-227897588 CAGGGCTGTCTCCTCCCTCCAGG + Intergenic
923533474 1:234830038-234830060 CTGGGATGTCTTCCTGCTCCAGG + Intergenic
923674157 1:236065374-236065396 CCGCGCTCTGCTCCCCCTCCCGG - Intergenic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1063144970 10:3288641-3288663 CTGGGCTCTTTCTCCCGTCCAGG + Intergenic
1064092587 10:12397406-12397428 CTGGCTTCTCTTCCCCCACACGG + Intronic
1064659551 10:17592640-17592662 GTGGGTTCTCTTCCTCCTCATGG - Intronic
1065028406 10:21561313-21561335 CTTGGCTCTGTTCTGCCTCCTGG + Intronic
1067346113 10:45440277-45440299 CAGGGCCCTTTACCCCCTCCAGG + Intronic
1067419524 10:46134107-46134129 CTGGTCTCTCCTCTGCCTCCCGG - Intergenic
1067426494 10:46215304-46215326 CTGGTCTCTCCTCTGCCTCCCGG + Intergenic
1067439357 10:46299933-46299955 GAGGGCTCTCCTCCCCCTCGGGG + Intronic
1067478652 10:46581806-46581828 CTGGGCACCCATCCCCATCCTGG - Intronic
1067504876 10:46840704-46840726 CTGGTCTCTCCTCTGCCTCCCGG - Intergenic
1067616085 10:47759995-47760017 CTGGGCACCCATCCCCATCCTGG + Intergenic
1068958493 10:62843460-62843482 CTTGGCTCTCTTTTCCCACCAGG - Intronic
1069531926 10:69225986-69226008 CTGAGCACTCTCCACCCTCCAGG - Intronic
1069606871 10:69744255-69744277 TTGGGCTTTCTTCCTCTTCCTGG + Intergenic
1069831227 10:71283628-71283650 CAGAGCCCTCTTCCTCCTCCAGG - Intronic
1069867461 10:71512601-71512623 CTGCCCTCTCTTCCCTCTCATGG + Intronic
1070702256 10:78612768-78612790 CTGGCCTCTCTTACCCTTCCTGG - Intergenic
1070929801 10:80253040-80253062 CTGGGACCTCATCCACCTCCTGG + Intergenic
1071205662 10:83273222-83273244 CTGTGTTCTCTGCCTCCTCCAGG - Intergenic
1072550636 10:96474581-96474603 CCAGCCTCTCTTCCCACTCCTGG - Intronic
1072609123 10:97004931-97004953 CAGAGCGCTCTTCCCCCACCTGG + Intronic
1073321813 10:102620284-102620306 CTTGTCACTCTTCCCCCTGCAGG - Intronic
1073464142 10:103684067-103684089 CTGGGCTCTCTGGCCCTCCCTGG - Intronic
1075670808 10:124262990-124263012 CTGAGCTCACTGCCCACTCCAGG + Intergenic
1075800765 10:125152077-125152099 CTGTGCCCTCTTCCCCCCGCAGG - Intronic
1075815078 10:125258850-125258872 CGGGGCTCTTTTCCCCCACTTGG + Intergenic
1076067231 10:127458545-127458567 CAGGGCTCACCTCCCCTTCCAGG + Intergenic
1076133766 10:128030794-128030816 CTGTGCTCTCTGTCCCCTGCAGG + Intronic
1076315093 10:129534243-129534265 CAGGGCTCTCTTTGCCCTCTCGG + Intronic
1076721940 10:132396775-132396797 CCGGGCCCCCCTCCCCCTCCGGG - Intergenic
1077151668 11:1075594-1075616 TTGGGCAGCCTTCCCCCTCCGGG + Intergenic
1078077557 11:8175512-8175534 CTGGGCTCTGTTTCCCTTGCAGG - Intergenic
1078080143 11:8198200-8198222 ATGGGATGTCTTCCCCATCCGGG + Intergenic
1078455395 11:11470869-11470891 GTGGGATGTTTTCCCCCTCCAGG + Intronic
1080840024 11:35975588-35975610 CTGAGTTCTCTACCCCCTACAGG - Intronic
1081858875 11:46320688-46320710 CTGGCCTCTCTTCTCTCTCCAGG + Exonic
1082032728 11:47617503-47617525 CAGGGGTCTCTTCCCTCCCCTGG - Exonic
1082171526 11:49011137-49011159 CTGGGCTCACTGCAGCCTCCTGG + Intergenic
1082761555 11:57131604-57131626 CCAGTCTCTCTTCCCCATCCAGG + Intergenic
1083161758 11:60858741-60858763 ATGGGCTTTCTTCTCCCTCTAGG + Intergenic
1083289851 11:61683739-61683761 CTGAGCTTTCTTCCCAGTCCTGG + Intronic
1083327677 11:61881366-61881388 CTGGGCTCACTTAGCCTTCCAGG + Intronic
1083331906 11:61902648-61902670 CAGGCCTCCCTTCCCCCACCCGG + Intronic
1083829079 11:65219603-65219625 CTGGGCACACTTTCCCCTGCAGG - Intergenic
1083931662 11:65849673-65849695 GTGGGCACTCTTCCTCCACCTGG + Intronic
1083970264 11:66070241-66070263 CCGGGCTCCCCGCCCCCTCCCGG + Intergenic
1084041903 11:66547297-66547319 CTGGGCTCCCCACCCCCACCAGG + Intronic
1084085069 11:66851280-66851302 CTGGGCTCTCTCACCCTTGCAGG - Exonic
1084510570 11:69601097-69601119 CTGGGCTCCATACCCCCACCAGG + Intergenic
1084973268 11:72782641-72782663 CTGGGCTCTCTTACCTCCCCAGG + Intronic
1085506222 11:77061638-77061660 CTCAGCTCACTTCCGCCTCCTGG - Intergenic
1087068173 11:94047079-94047101 CTGGGCTCTTTTCCTCCACCTGG + Intronic
1089302953 11:117509582-117509604 CTGGGCTCTCTTCCCCCTCCAGG - Intronic
1089339307 11:117746735-117746757 CAGGGCTCTGTTACTCCTCCAGG + Intronic
1089412040 11:118252240-118252262 CTGCGCTCTCTTCCCTCTGCTGG - Exonic
1089518615 11:119049185-119049207 CAGGGCTCTCCTCTTCCTCCTGG + Exonic
1089633996 11:119800805-119800827 CTGTGATCTCTTCTCCCCCCAGG + Intergenic
1090064701 11:123492574-123492596 CTGGAACCTCTTCCTCCTCCAGG - Intergenic
1091202050 11:133788520-133788542 CTGGAGTCTCTTCCACATCCAGG + Intergenic
1091686701 12:2567537-2567559 CTCGGATCTCATCCCTCTCCTGG + Intronic
1092365164 12:7871591-7871613 CTGGAGTCTCTGACCCCTCCAGG + Intronic
1092486570 12:8907411-8907433 TTGGGCTTACTTCTCCCTCCTGG + Intergenic
1095741795 12:45615525-45615547 ATAGCCTCCCTTCCCCCTCCGGG + Intergenic
1096777094 12:53970889-53970911 CTCTGCTTCCTTCCCCCTCCTGG - Intergenic
1097178907 12:57159803-57159825 CTGGTCCCTCTTCCCCCAACAGG + Exonic
1097558683 12:61173240-61173262 CTGGGGTCACTTTCACCTCCTGG + Intergenic
1099202398 12:79691051-79691073 CTCGGCTCCCTTCCCGCCCCTGG - Exonic
1100215911 12:92448314-92448336 CTGGCCTCTCCTCCTACTCCTGG + Intergenic
1100690621 12:97035121-97035143 CTGGCCTGTCTTCCCTCTCCAGG - Intergenic
1101483965 12:105132244-105132266 CTGCAATCTCTTCCGCCTCCCGG + Intronic
1102904754 12:116665977-116665999 CTGGTTTCTTTCCCCCCTCCTGG - Intergenic
1103188581 12:118981664-118981686 CTGGGCTTTCTTCGCCCTTCTGG - Exonic
1103253856 12:119523548-119523570 CTGGGTTCTCTGCCCTCACCTGG - Intronic
1104553417 12:129778524-129778546 TTCGGCTCTCTTCCACCCCCAGG + Intronic
1104645653 12:130495463-130495485 CTGCGCTCCCCTCTCCCTCCAGG + Intronic
1104697202 12:130872334-130872356 CTCCGCTCTCATCCCCGTCCCGG + Intronic
1106033666 13:26024989-26025011 CTGGGCTCTCTCCCTCTTTCCGG - Exonic
1106104180 13:26719348-26719370 CTGGTTTCTCTTCCCCCTGAAGG - Intergenic
1108527294 13:51296742-51296764 CTGGGGGCTCTTCACCTTCCTGG + Intergenic
1110639571 13:77806604-77806626 CTGGGCTCTCTTTCTGCTCCTGG + Intergenic
1111134713 13:84026062-84026084 GTGGGCTTTCTTTCCCCTGCTGG + Intergenic
1112104751 13:96228863-96228885 CTGGTCCCTCTTCCTCCTTCTGG - Intronic
1112325670 13:98441493-98441515 CGGGGCTCCTTTCGCCCTCCTGG - Intronic
1112379306 13:98873426-98873448 CTGTTCTCTCTTCCCTCTCATGG + Intronic
1112562354 13:100525866-100525888 CTGGGCACTGTTCTCTCTCCAGG - Intronic
1113054354 13:106251998-106252020 CTCATCTCTCTTCCTCCTCCTGG - Intergenic
1113055572 13:106263393-106263415 CCGGCCTCTCTTCCTCCTCTGGG + Intergenic
1113083435 13:106541176-106541198 TGAGGCTCTCCTCCCCCTCCAGG - Intergenic
1113910244 13:113838281-113838303 CTGGGCTCCCTCCCTGCTCCAGG - Intronic
1113910293 13:113838439-113838461 CTGGGCTCCCTCCCTGCTCCAGG - Intronic
1113964171 13:114143074-114143096 CCAGGCTCTCTCCACCCTCCAGG + Intergenic
1113984053 13:114299745-114299767 CTGGGCTTACCTTCCCCTCCGGG + Intronic
1114412076 14:22510393-22510415 CTGGACTCTCTACCCCTTCCTGG + Intergenic
1114485146 14:23057606-23057628 CTGGGCTCTCCTCTCCCGCGCGG - Intergenic
1115399294 14:32939264-32939286 TTTGCCTCTCTCCCCCCTCCCGG - Intronic
1116090271 14:40295800-40295822 CTTTGTTCTCTTCCTCCTCCTGG + Intergenic
1116443499 14:44981401-44981423 CTTGGCTCTCTTCCAACTCGTGG - Intronic
1119438978 14:74615670-74615692 CTGGGCTCCCTTCCTCTCCCCGG + Intergenic
1120784720 14:88522351-88522373 CTCAGCTCACTTCCACCTCCTGG - Intronic
1121011391 14:90522231-90522253 CTGGACATTCTTCCCCCTCCCGG - Intergenic
1121260087 14:92559628-92559650 ATGTGCTCTCTTCCTGCTCCAGG - Intronic
1122083880 14:99286048-99286070 CTGGGCCACGTTCCCCCTCCAGG - Intergenic
1122118807 14:99540974-99540996 CTGGGTGGTATTCCCCCTCCTGG + Intronic
1122323944 14:100871613-100871635 CGGAGCTCTCTTCCTCCACCTGG + Intergenic
1122634702 14:103124500-103124522 CTAGGCTCTGTCCCACCTCCAGG - Intronic
1122721646 14:103725620-103725642 CTGGGCTCTCAGCCCCTGCCAGG - Intronic
1123058566 14:105584102-105584124 CTGTGGGCTCATCCCCCTCCTGG + Intergenic
1123082898 14:105704336-105704358 CTGTGGGCTCATCCCCCTCCTGG + Intergenic
1124135770 15:27035114-27035136 CTGGGTTCTCTTCTTCTTCCAGG - Intronic
1124623791 15:31296810-31296832 CTGCCCTCTCCTGCCCCTCCCGG - Intergenic
1124665276 15:31586865-31586887 CTGGGTCCTCCTCCTCCTCCTGG + Intronic
1124965250 15:34428704-34428726 TTGGGCCCTCTTCCCCTTTCAGG - Intronic
1124981867 15:34574914-34574936 TTGGGCCCTCTTCCCCTTTCAGG - Intronic
1125472933 15:40022083-40022105 CAGGCTTCTCTGCCCCCTCCTGG + Intronic
1125604448 15:40932055-40932077 CTGGGCCCTCTTCCTACTCCTGG - Intronic
1128075355 15:64822337-64822359 CTGGGCTCACTGCCCCCCACAGG - Exonic
1128322033 15:66701168-66701190 CTGGGCCCCCCTCCCCCCCCGGG - Intergenic
1129081078 15:73041697-73041719 CTCGGCTCACCTCCGCCTCCCGG + Intergenic
1129776032 15:78237088-78237110 TTGGACTCTCTTCCCCTTCCTGG - Intronic
1131521127 15:93116520-93116542 GTGGGCTGTCTCCTCCCTCCTGG - Intergenic
1132481466 16:168347-168369 CTGTGCTCTTCTCCCCATCCAGG + Intergenic
1132677651 16:1127287-1127309 CTGGACTCTGTGCCCCGTCCAGG - Intergenic
1132842191 16:1983634-1983656 CTGGGCTCTTGTCCCCTCCCTGG - Intronic
1132854767 16:2039774-2039796 CCAGGCTCTCTGCCCCCTCAGGG + Intergenic
1132930250 16:2455373-2455395 CTGGGCTCTCTCCACCTTGCAGG + Exonic
1133376218 16:5289342-5289364 ATGGGCCCTCCTCCTCCTCCTGG - Intergenic
1133593668 16:7270181-7270203 CAGGGCTCTGTTCCGCCCCCAGG + Intronic
1134569696 16:15280713-15280735 CTGGGCTCTCTGGGCCCTCTGGG - Intergenic
1134732683 16:16475336-16475358 CTGGGCTCTCTGGGCCCTCTGGG + Intergenic
1134934757 16:18236632-18236654 CTGGGCTCTCTGGGCCCTCTGGG - Intergenic
1135409441 16:22222278-22222300 CTGGGCTCACTTGAACCTCCTGG + Intronic
1136283021 16:29225204-29225226 CTTGGCTCTCAACACCCTCCTGG - Intergenic
1136378059 16:29877018-29877040 CTTTGCTCTGTGCCCCCTCCCGG + Intronic
1136518957 16:30784307-30784329 TTGGTCTCTCTTCCCTCCCCCGG + Intronic
1137527423 16:49248689-49248711 CTGGTCTCTTTTCCCCCACTGGG - Intergenic
1137751183 16:50862314-50862336 CGTGGCTCTCTTTCCCGTCCTGG - Intergenic
1138210042 16:55155851-55155873 TTTGAGTCTCTTCCCCCTCCAGG + Intergenic
1138223131 16:55270007-55270029 CTGGGCTCTGTTCCTCCACGTGG - Intergenic
1138502586 16:57456927-57456949 CTGGTCTGTCTTCCTCTTCCTGG - Exonic
1139348418 16:66320082-66320104 CTGGCCTCACTTCACCCTCAGGG - Intergenic
1139461527 16:67126661-67126683 CTTGGCTCACTGCCACCTCCTGG + Intronic
1140471683 16:75218933-75218955 CTGGGCTCCCTGCCCCCCCAAGG + Intergenic
1140745488 16:77976888-77976910 TTGGTCTCTCTTCCCCCAACTGG - Intronic
1141121591 16:81362753-81362775 CCCGGCTCTCCTCCCCTTCCTGG + Intronic
1141382394 16:83588103-83588125 CTGGGCTCTTTTCCACCTTGAGG - Intronic
1141620575 16:85234985-85235007 CTGGGCCCTGATCCCCCTCCTGG + Intergenic
1141751640 16:85962248-85962270 GTGGTCTCTCTTCTTCCTCCAGG - Intergenic
1142087398 16:88191105-88191127 CTTGGCTCTCAACACCCTCCTGG - Intergenic
1142215841 16:88829459-88829481 GTGGGGTCTCTTCCACCTTCAGG + Intronic
1142434362 16:90047435-90047457 CTGGGCTCTCCTCCGCGCCCCGG + Intergenic
1142918603 17:3164152-3164174 CTGCAATCTCTTCCACCTCCCGG - Intergenic
1144239733 17:13298524-13298546 CACGGCCCCCTTCCCCCTCCGGG - Intergenic
1144798615 17:17910283-17910305 CTTGACTCCCTTCCCCCTCTGGG + Intronic
1145785124 17:27588550-27588572 CTGTGCCCTGCTCCCCCTCCAGG - Intronic
1146355775 17:32132599-32132621 CTTGGCTCACCTCCACCTCCCGG - Intergenic
1146405552 17:32533727-32533749 CTGAGCTCTCTGCTCCCTCCTGG + Intronic
1146647253 17:34583467-34583489 CTGGGCTGCCCTCCTCCTCCAGG + Intronic
1146824014 17:36008024-36008046 ATGGGCTCTCTTTCCCTTCATGG - Intergenic
1146913430 17:36662862-36662884 CTGTGCTCCCTTCCTCCTACAGG - Intergenic
1148033109 17:44636102-44636124 CTCGGCTCACTTCTGCCTCCTGG - Intergenic
1148575655 17:48709171-48709193 CTGGGCTCTGTTCTCCCTTTAGG + Intergenic
1148735598 17:49862991-49863013 CTGGGATCCCCTCCCCCACCAGG - Intergenic
1148743141 17:49904025-49904047 CTAGATTCTCTTGCCCCTCCTGG - Intergenic
1150422554 17:65051538-65051560 CTTGGCTCACCTCCGCCTCCTGG - Intronic
1151398584 17:73841267-73841289 CTGGGCTCTCTACCCCACACTGG - Intergenic
1151560212 17:74865948-74865970 CTGGTCCCTCCTCCCCCACCTGG + Intronic
1151979802 17:77502054-77502076 CTTGGCCCTCTTGACCCTCCAGG - Intergenic
1152013598 17:77735550-77735572 CTGCGCTTGCTTCCCCCTCAGGG + Intergenic
1152140698 17:78534755-78534777 CTGGGGTCTCTGCCCCTTGCTGG + Intronic
1152257387 17:79248115-79248137 CGGGGCTCTCCTCTACCTCCGGG + Intronic
1152452374 17:80389955-80389977 CTGCGCTCCCTTCTCCCTGCAGG + Intronic
1152567431 17:81106558-81106580 CTGGCCTCCCTTCCTCCTCCTGG - Intronic
1153028038 18:688846-688868 CAGTGCTATCTTCCCCTTCCGGG - Intronic
1153906419 18:9665621-9665643 CTGTAGTCTCTACCCCCTCCTGG - Intergenic
1154307715 18:13242958-13242980 CTGGGTGCTCTTCTCCCTGCCGG + Intronic
1158495818 18:57954430-57954452 CTGGGCACTCTTCCCTCCTCTGG - Intergenic
1160136148 18:76273377-76273399 CAGGGCTCGCTTCGGCCTCCCGG - Intergenic
1161056003 19:2190885-2190907 ATGGCCTCTCGTCCCCCTGCAGG - Intronic
1161266616 19:3367259-3367281 CGGAGCACCCTTCCCCCTCCTGG - Intronic
1161614745 19:5263839-5263861 CGGGCCTCCCTTCCCCCGCCCGG - Intronic
1161681490 19:5681899-5681921 CTGGTCCCACTTCCCCCTGCCGG + Intronic
1161791969 19:6365403-6365425 CTCAGCTCACTTCCACCTCCTGG - Intronic
1161809003 19:6460646-6460668 CTGGGCTCCCTTCCCCCTAATGG - Intronic
1161818566 19:6515513-6515535 CTGCACCCTCTTCCCACTCCAGG - Intergenic
1161888849 19:7019218-7019240 CCTGGCTTTCTTCACCCTCCTGG + Intergenic
1161890519 19:7032803-7032825 CCTGGCTTTCTTCACCCTCCTGG - Exonic
1161890929 19:7037930-7037952 CCTGGCTTTCTTCACCCTCCTGG + Exonic
1161892605 19:7051531-7051553 CCTGGCTTTCTTCACCCTCCTGG - Exonic
1161893012 19:7056391-7056413 CCTGGCTTTCTTCACCCTCCTGG + Exonic
1161946908 19:7443129-7443151 CTCGGCTCACCTCCACCTCCCGG + Intronic
1162017048 19:7851594-7851616 AGGGGCTCTCTTCCCTCCCCAGG - Intronic
1162163660 19:8738295-8738317 CAGGGCTCTCCTCACCCACCAGG - Intergenic
1162168210 19:8768720-8768742 CAGGGCTCTCCTCGCCCACCAGG - Intergenic
1162169275 19:8776173-8776195 CAGGGCTCTCCTCGCCCACCAGG - Intergenic
1162169954 19:8781485-8781507 CAGGGCTCTCCTCGCCCACCAGG - Intergenic
1162287359 19:9749112-9749134 CTGATCTCTCTTCTTCCTCCTGG + Intergenic
1162452301 19:10762589-10762611 CTGCGCTCTGTGCTCCCTCCTGG - Intronic
1163447053 19:17353028-17353050 CTGGGATGCCCTCCCCCTCCTGG + Intronic
1163495698 19:17645475-17645497 CTGGGCTCTGCTCACCCTCCTGG + Intronic
1163831349 19:19548543-19548565 CTGGGCTACCGTCCGCCTCCTGG + Intergenic
1163839390 19:19596840-19596862 CTTGGCTCACTTCAGCCTCCTGG - Intronic
1164536035 19:29087285-29087307 CTGGTCTCTCTCCTCCCACCTGG - Intergenic
1164634133 19:29780324-29780346 CTGGCCCCTCTTCTTCCTCCAGG + Intergenic
1164703120 19:30300340-30300362 CTGGGGTCTCTTTGCTCTCCAGG + Intronic
1165952616 19:39482733-39482755 CTTGGCTCCCAGCCCCCTCCTGG + Intronic
1166213849 19:41323491-41323513 CTGGGGTCTCCTCCCTCCCCTGG - Exonic
1166612523 19:44211962-44211984 CTTGGCTCACTGCACCCTCCAGG + Intronic
1166720021 19:44991258-44991280 CTGGATCCTCTTCCCGCTCCTGG + Exonic
1166786825 19:45372431-45372453 CTTGGCTCACTTCTGCCTCCTGG - Intergenic
1167270188 19:48501972-48501994 CTGGCTCCTCTTCCCTCTCCTGG + Intronic
1167285986 19:48599244-48599266 CTGGGCTGCCGTCCTCCTCCGGG - Exonic
1167414533 19:49363126-49363148 CAAAGCTCTCTTCCCCGTCCCGG - Intronic
1167815389 19:51876385-51876407 CTGAGCTCTCTGGCCCCTGCTGG - Intronic
1168261906 19:55200048-55200070 ATGGGCTCTCTTCTTCCTCAGGG + Intronic
1168416429 19:56172055-56172077 CTGGGCTTTACGCCCCCTCCTGG + Intergenic
924995731 2:358939-358961 CTGGGTTCTCATCCACCTGCAGG + Intergenic
925036754 2:692820-692842 CTGAGCTCTTTTCGCCCACCCGG - Intergenic
925041506 2:734670-734692 CAGGTCTCTCTTCCTCCTCCTGG - Intergenic
925173803 2:1768448-1768470 CTGGGCCTGCTTCCCCTTCCAGG + Intergenic
925463489 2:4085637-4085659 CTGGGCCCTCCTCCAACTCCAGG - Intergenic
926143751 2:10384391-10384413 CTGGGCTCTCCTCTCTCCCCAGG - Intronic
927214698 2:20661768-20661790 GTTGCCTCTCCTCCCCCTCCCGG + Intergenic
927961462 2:27242850-27242872 CATGGCTCTCCTCACCCTCCAGG + Exonic
928167192 2:28980017-28980039 CAGGCCTCTCTTTCCCCACCTGG + Intronic
928332704 2:30369869-30369891 CTGTGCTCACTTCCACCCCCTGG + Intergenic
929155999 2:38789127-38789149 CTCAGCTCACTTCCGCCTCCTGG - Intergenic
931076755 2:58724095-58724117 CTGTTCTCTCTCACCCCTCCAGG - Intergenic
931228200 2:60352006-60352028 CAGGGCTCCCTTCCCCCTTCTGG + Intergenic
931919306 2:66995749-66995771 CAGGGCACTCTTCTGCCTCCTGG - Intergenic
932537206 2:72611287-72611309 CTCGGCTCGCTGCCGCCTCCTGG - Intronic
932786196 2:74606050-74606072 CTGGCCTCTGTTCCCCCGGCTGG - Intronic
933678565 2:85078767-85078789 CTCTGCTCTCCTTCCCCTCCAGG - Intergenic
935241268 2:101180124-101180146 CAGGGCTCACTTCCCTCTGCAGG - Intronic
935280944 2:101517229-101517251 CTGTGCTTACTTCCCCCTTCTGG - Intergenic
935975154 2:108570822-108570844 TTGGCCTCCCTTTCCCCTCCAGG - Intronic
936064064 2:109317361-109317383 CTGGACTCTCCTCCACCCCCTGG - Intronic
937003857 2:118493253-118493275 CTGAGCCCTCTTCCCCAACCTGG - Intergenic
937221975 2:120346910-120346932 CTGGGCGCGCGTCCCCCTCCCGG + Intronic
937235989 2:120432290-120432312 CTGAGCTCCCTTCCTCCCCCGGG + Intergenic
937875641 2:126823383-126823405 CTCTCCTCTCTTCCCTCTCCTGG + Intergenic
937912207 2:127081175-127081197 CTGGGCACCCTTCCTCCTTCTGG - Intronic
938203438 2:129396884-129396906 CTCTGCTCTCTTCCCCGTGCTGG - Intergenic
938724251 2:134092683-134092705 CTGGGCTCTCTTGCACCTCCAGG - Intergenic
939250907 2:139680660-139680682 CGAGGCTCTCTTCCCTCTACTGG + Intergenic
939877951 2:147599058-147599080 TTGTGCTCTCTTGTCCCTCCAGG - Intergenic
940201303 2:151153828-151153850 CAGGGCTATTTTCCCCTTCCAGG - Intergenic
940322247 2:152389882-152389904 CCGGGTTCTCTTCTCCCACCGGG - Intronic
945941925 2:215959063-215959085 CTCAGCTCTCTTCCCTCTGCTGG + Intronic
946395531 2:219442109-219442131 CAGGCCTCCCTGCCCCCTCCCGG - Intronic
947499889 2:230664268-230664290 CTGGGCTCTCCTCCCAGTCCTGG - Intergenic
947708594 2:232295989-232296011 CAGGGCTCTCTTATCCCTTCAGG + Intronic
947911518 2:233803846-233803868 CTGGGCTCCCTCCCCACCCCAGG - Intronic
948072831 2:235141165-235141187 CAGGCCTCTCTACCCACTCCGGG - Intergenic
948444699 2:238023190-238023212 CAGGGCTCTGTGCCCCCTTCTGG - Intronic
948505449 2:238424596-238424618 GTGGGCTGTCTTGCCCCTCCAGG - Intergenic
948587200 2:239026878-239026900 CGGGGCTCTCTTCCCCGCCAGGG + Intergenic
948703627 2:239776305-239776327 CTGGGCTGTCTGCCGGCTCCTGG - Intronic
948965053 2:241372748-241372770 CTGGGCTCTCTTGCCTCTGCTGG + Intronic
1168842268 20:917035-917057 CTGTCCTCTCTTCTCCCTCAGGG + Intergenic
1169262686 20:4149469-4149491 CTGTGCTGACTTCCCCCTCTGGG + Intronic
1170390276 20:15865773-15865795 CTGGGCTCCCTGCCACCTCCAGG - Intronic
1170769958 20:19324041-19324063 CTGGGCTCTCATCCTGCGCCGGG - Intronic
1170840559 20:19921773-19921795 CTCTGATCTCTTTCCCCTCCAGG - Intronic
1171191413 20:23162123-23162145 CTGGCCTCTCTTCTCCCTGGTGG - Intergenic
1171365270 20:24618311-24618333 CTGGGCTCTCTGCCCTCACTGGG - Intronic
1172463869 20:35140407-35140429 CTTGGCTCACCTCCACCTCCTGG - Intronic
1172989034 20:39018270-39018292 CTGGACTTTCTACCACCTCCAGG - Intronic
1173134534 20:40427730-40427752 CTTGGCTCACCTCCACCTCCTGG + Intergenic
1173454039 20:43189600-43189622 CTGGGCTCCCCGCTCCCTCCTGG - Intronic
1173903705 20:46610446-46610468 CTGTGTTCTCTTCACTCTCCTGG + Exonic
1174039088 20:47686501-47686523 CTGGCCTCTCTTCCCAGTCAAGG + Intronic
1174130675 20:48341597-48341619 ATTCGCTCTGTTCCCCCTCCTGG + Intergenic
1174348476 20:49949369-49949391 CTGGGCTCTGATCCCTCCCCTGG + Intronic
1175412214 20:58777764-58777786 CTGGGCTCCCTCCCACCTCGTGG + Intergenic
1175618955 20:60427113-60427135 CTGGGCTCACTGCCCTCCCCTGG - Intergenic
1175892768 20:62322786-62322808 CTGGGCCCTCTCACCCCCCCAGG + Intronic
1175922599 20:62457155-62457177 CCGGGCTGTCTGCCCCCTCAGGG - Intergenic
1175935989 20:62514256-62514278 CTGGGCACCCTTCCCTCCCCTGG - Intergenic
1175987567 20:62771542-62771564 CTGGGGTCTCTGCCCTCTCCGGG + Intergenic
1177900817 21:26913128-26913150 CTGGGTTCCCCTCCCTCTCCAGG - Intergenic
1178396693 21:32249366-32249388 CTGTGCTGTCTTTCCCCGCCCGG - Intergenic
1179164076 21:38921807-38921829 CTGGGGCTTCTTCCCCCGCCTGG + Intergenic
1179413685 21:41181116-41181138 TTGGCCACTCTTACCCCTCCAGG - Intronic
1179937652 21:44615321-44615343 CTGGACTCTCTTCCGCAGCCTGG - Intronic
1179987430 21:44929458-44929480 TTGAGAGCTCTTCCCCCTCCAGG - Intronic
1180052346 21:45337023-45337045 CTGGGCTTCCTTCCCACCCCAGG - Intergenic
1180833891 22:18920188-18920210 CTGGGCCCTCTGCCTGCTCCGGG - Intronic
1181065930 22:20306051-20306073 CTGGGCCCTCTTCCTGCTCTGGG + Intergenic
1181313429 22:21957595-21957617 CAGGGCTCCCTTCTCCCGCCAGG - Exonic
1181346535 22:22223667-22223689 CAGGGCTCCCTTCTCCCGCCAGG - Intergenic
1181497733 22:23297288-23297310 CTTGGCTCTCTGCAACCTCCCGG + Intronic
1181571152 22:23768326-23768348 CTCCGCTCTCTGCCCCCTCCCGG + Exonic
1182093255 22:27610017-27610039 CTGGGCCCTCAGACCCCTCCTGG + Intergenic
1182582563 22:31323482-31323504 CTCGGCTCACCTCCACCTCCCGG - Intergenic
1182665424 22:31955516-31955538 CTGGGCTCACTGCAACCTCCGGG + Intronic
1183404693 22:37624716-37624738 CTGGGCCCGCTCCCGCCTCCAGG - Intronic
1183712645 22:39514528-39514550 CTGTGCTCTCTGCCGCCCCCTGG + Exonic
1183732716 22:39627738-39627760 CTGGGCTGTCAGCCCCCACCAGG + Intronic
1183772458 22:39938636-39938658 CTGTTCTCTCTTCCCCATCTGGG - Intronic
1184263729 22:43335076-43335098 CTGGGCTCTAGTCCCCACCCAGG + Intronic
1184282024 22:43442736-43442758 CTGGCCTCCCTTCTCCCTCATGG + Intronic
1184728016 22:46357538-46357560 CTTGGCTCTCTTCCTCTTGCTGG + Intergenic
1184965080 22:47965658-47965680 CCCGGCCCTCTTCCCCTTCCCGG - Intergenic
1185060879 22:48606142-48606164 CTCCGCTCTCCTCCACCTCCTGG + Intronic
1185061930 22:48611662-48611684 CTGGCCTTTCTTGCCTCTCCTGG + Intronic
1185163626 22:49244369-49244391 CTGGGCTCTGCTCTCCCTCGAGG - Intergenic
1185280574 22:49968211-49968233 CTGACCTCTCTTCCCACACCTGG - Intergenic
1185333301 22:50261091-50261113 CTGGGCTGGGTTCCCCCACCCGG - Intronic
1185398054 22:50602536-50602558 TTGGGTTCCCTTCCCCCTCGTGG - Intronic
1203283977 22_KI270734v1_random:145486-145508 CTGGGCCCTCTGCCTGCTCCGGG - Intergenic
949459944 3:4280697-4280719 CTGGGCTCTGTTCCCTCTGAGGG + Intronic
949961434 3:9315370-9315392 CTAGCCTCCCTTCCCCATCCTGG + Intronic
950615254 3:14152846-14152868 TTGGGTTCACTGCCCCCTCCTGG - Intronic
954161161 3:48723667-48723689 CTGATCTCTCTTCTTCCTCCTGG - Intronic
954619578 3:51987938-51987960 CTCGGCTCACCTCCGCCTCCCGG + Intronic
955473959 3:59316115-59316137 CTCGGCTCACCTCCACCTCCGGG + Intergenic
956251504 3:67239051-67239073 ATGGGTTCTCTTGCCCCTCCAGG + Intergenic
956772719 3:72540087-72540109 CTGGGTTCTGTGCCCACTCCTGG + Intergenic
957646593 3:82939044-82939066 CTGGGCTCTCTCCCTGCTCCTGG + Intergenic
957847355 3:85755233-85755255 CTTTCCTCTCCTCCCCCTCCAGG + Intronic
961165834 3:124763298-124763320 CTGGGCTGTCTCTCCCTTCCAGG - Exonic
961384932 3:126517958-126517980 CTGGGCTCACTTCCCCTTCCAGG + Intergenic
961435399 3:126913019-126913041 CTTGGCTCTCTCCGCCCACCAGG - Intronic
961627877 3:128276091-128276113 CTTGGCCCTCCTCACCCTCCTGG + Intronic
961693091 3:128684555-128684577 CTGGGCCCACTTCGGCCTCCCGG + Intergenic
961782752 3:129330572-129330594 CTGGGCTCTCTTACCCTCCCTGG + Intergenic
962355032 3:134686387-134686409 CTGAGCTCTCCAGCCCCTCCCGG - Intronic
962400598 3:135055949-135055971 CTGGGCTCTCTTCCACCTGGGGG + Intronic
963558837 3:146834126-146834148 CTTGCCTCTCTTCCAGCTCCTGG + Intergenic
966945387 3:184773903-184773925 CCGGGCTCTCTTCCCCTTCATGG + Intergenic
968426743 4:528759-528781 CTTGGCCCTCTTCCCTTTCCTGG + Intronic
968460871 4:724148-724170 CAGGGCTCCGTGCCCCCTCCCGG - Intronic
968462138 4:731478-731500 CAGGGCTATCTCTCCCCTCCCGG + Intronic
968524178 4:1047525-1047547 CAGGGCTCTCTACTCCCTCCAGG + Intergenic
968833734 4:2947709-2947731 CTGGGCTCCCCTGCCCCACCTGG - Intronic
969648873 4:8451194-8451216 CTGGGCTCCCTCCCACATCCTGG + Intronic
972072327 4:35038063-35038085 ATGGGCTGTCTGCCTCCTCCTGG - Intergenic
972336779 4:38114075-38114097 CTGGGGTCTCTGACCCCTCTAGG - Intronic
972584463 4:40424589-40424611 CAGGTCTCTCCTCCTCCTCCTGG + Exonic
972772263 4:42208628-42208650 CTCGGCTCACTTCCACCTCCCGG + Intergenic
972868269 4:43261225-43261247 CTTGGCTCACCTCCACCTCCTGG - Intergenic
974716219 4:65670769-65670791 CTGATCTCCCTTCCGCCTCCCGG - Intergenic
975959244 4:79880779-79880801 GTGGTCTCTCTTCTCACTCCAGG - Intergenic
980594131 4:134929959-134929981 TTGGGCTCTCTTCCCCAGGCTGG - Intergenic
980745463 4:137007349-137007371 CCGTGCTCTCCTCCACCTCCTGG + Intergenic
981780864 4:148427573-148427595 CTGGGCTGTCCTCACCCTGCTGG - Intronic
982040143 4:151389257-151389279 CTTGGCTCACCTCCACCTCCCGG - Intergenic
982227851 4:153182188-153182210 CTTGGCGCTCTTACCCCTTCTGG - Intronic
983431150 4:167652561-167652583 CTGGGCTCCTTTCGCCCACCAGG - Intergenic
985828734 5:2212783-2212805 CTGGCCTCTCTGCCTCCTCATGG - Intergenic
987045980 5:14108677-14108699 ATGGGCACTCCTCCCCCTACTGG - Intergenic
987345117 5:16972158-16972180 CTGGGCACCTTTCCTCCTCCAGG - Intergenic
989578056 5:43007257-43007279 CTTGGCTTTCTCCTCCCTCCTGG - Intergenic
989660322 5:43791014-43791036 CTGATCTCTCCTCCTCCTCCTGG + Intergenic
991925675 5:71703034-71703056 CTGGGTTCCCTCCCCTCTCCAGG - Intergenic
992424139 5:76638377-76638399 CTGGGCTTTTTTCCCTCCCCGGG - Intronic
993044932 5:82856272-82856294 CTGCGTCTTCTTCCCCCTCCTGG - Intergenic
994757313 5:103810619-103810641 CTCGGCTCACCTCCACCTCCTGG + Intergenic
995164420 5:109022379-109022401 CTTGTCTCTCTTCCCATTCCTGG - Intronic
997542317 5:134673530-134673552 CTCGGCTCACCTCCACCTCCTGG + Intronic
997813717 5:136996443-136996465 TTGTGCTCTCCTCACCCTCCTGG + Intronic
997822190 5:137076111-137076133 CTGGGCTCTCTGCTGCATCCAGG - Intronic
998162882 5:139823291-139823313 CTGGGCTCTCTTGCCCTCGCAGG + Intronic
998197278 5:140085195-140085217 CTGTCCTCTTTTCCTCCTCCAGG + Intergenic
999237553 5:150108131-150108153 CTGTGCACTCTTACGCCTCCAGG - Intronic
1000245714 5:159446995-159447017 CTGGGGTCCCTGCCCCCTGCAGG - Intergenic
1000607363 5:163339084-163339106 CTGATCTCTCTTCTTCCTCCTGG + Intergenic
1002064096 5:176643593-176643615 CTTGGCTCTCTGCTTCCTCCTGG + Intronic
1002310272 5:178309812-178309834 CTGTGCTCGATTCTCCCTCCTGG + Intronic
1003151888 6:3559587-3559609 CTTGGCTGTCTTCTTCCTCCTGG + Intergenic
1003624022 6:7726823-7726845 GCGGGCTCGCTTCCCCTTCCTGG - Exonic
1003668106 6:8130315-8130337 CTTGGCTCACCTCCACCTCCTGG - Intergenic
1003831297 6:10014941-10014963 GTGGGCTCTCGTGCCCCTTCTGG - Intronic
1004014937 6:11723586-11723608 ATGGGTTCTCTTCCCCTGCCTGG - Intronic
1004253691 6:14043530-14043552 CTGGGCTCGATTCCCCAACCTGG + Intergenic
1004662611 6:17723511-17723533 CTCGGCTCACTACCACCTCCTGG + Intergenic
1005866976 6:29944005-29944027 CTGTGCTCTCTTCCCCATCCCGG + Intronic
1005987623 6:30884376-30884398 CAGCCCTCCCTTCCCCCTCCCGG - Intronic
1005990284 6:30897998-30898020 GTGGGCTCTCTCTCCTCTCCTGG + Intronic
1006441592 6:34056773-34056795 CTGGTCTCTCTCCCTCCGCCTGG - Intronic
1006538130 6:34716658-34716680 CTTGGCTCACCTCCACCTCCTGG - Intergenic
1006642046 6:35494647-35494669 CTGGGCTCCTCTCCCCATCCTGG + Intronic
1006923426 6:37640843-37640865 CGGCTCTCTCTTCTCCCTCCTGG - Intronic
1007992763 6:46274636-46274658 CTGGTCACTCCTCCCTCTCCAGG - Intronic
1008374675 6:50778107-50778129 CTGGGCTTTCTTCCTCCGCTGGG - Intergenic
1010109108 6:72203496-72203518 CTGGGCTCTTTTCTCTCTACAGG - Intronic
1011697984 6:89930505-89930527 CAGGACTCTCTTCCCCAGCCGGG + Exonic
1011904759 6:92351149-92351171 CTCGGCTCACTGCCGCCTCCCGG + Intergenic
1012350276 6:98241772-98241794 CTGTGCTCTCTTTTGCCTCCAGG - Intergenic
1012465822 6:99515437-99515459 CTGCGCGCTCGTCCCGCTCCCGG + Intronic
1013362919 6:109411126-109411148 CTGGCCACTCTTGCCCCTCCAGG + Intronic
1013488915 6:110625709-110625731 CTGGGCTCTTTTCTCACTCTAGG - Intronic
1013536886 6:111071103-111071125 CTGGGCTTTCTTCCCTGACCTGG - Intergenic
1016809512 6:148245912-148245934 CTGGGCTCACCTCCATCTCCCGG - Intergenic
1017039415 6:150295685-150295707 TTAGTCTCCCTTCCCCCTCCAGG - Intergenic
1017949222 6:159121723-159121745 CTGGGCTCTCTTCCCCCACATGG + Intergenic
1018423882 6:163663083-163663105 CTGGGCTCTGCACCACCTCCCGG - Intergenic
1019669941 7:2272054-2272076 CTGGGCCCTCTGCCACCTCTAGG - Intronic
1019701660 7:2477222-2477244 TAGGGCTCTGTGCCCCCTCCAGG - Intergenic
1022114986 7:27253222-27253244 CTGTGCTCCCATCTCCCTCCAGG - Intergenic
1022471022 7:30682040-30682062 CTGCGCTCTCTCCCGCCGCCAGG - Exonic
1022500499 7:30879585-30879607 TCGGGCTCTCTCCCACCTCCTGG + Intronic
1022981671 7:35610462-35610484 CTGGGGGCCCTTCCTCCTCCAGG + Intergenic
1023347427 7:39285820-39285842 CTCTGCTTTCTTCCCACTCCTGG + Intronic
1023955271 7:44881465-44881487 ATGGCCTCTCTTCCCACTGCAGG - Exonic
1024211757 7:47212284-47212306 CTGTGCTTCCTTCCTCCTCCAGG + Intergenic
1024231948 7:47369386-47369408 CTGGGCACTCAGGCCCCTCCTGG + Exonic
1026904666 7:74056249-74056271 CTTGGCTCCCTTCCCTCTGCAGG + Exonic
1027858610 7:83545657-83545679 CAGGGCTCTCTTGCCTCTACTGG + Intronic
1029364255 7:100107008-100107030 CTGGGCCCATTGCCCCCTCCTGG - Exonic
1029371496 7:100153816-100153838 CTGTGCTCCCTTCCCTCTCCTGG + Intronic
1029505986 7:100964586-100964608 CTCTGCTCCCTTCCCCCTTCTGG + Intronic
1029744906 7:102511426-102511448 CTGAGCTCCCTTCCCCTCCCTGG - Intronic
1029762898 7:102610588-102610610 CTGAGCTCCCTTCCCCTCCCTGG - Intronic
1030194048 7:106835801-106835823 CTGGTCTCTCCTCTTCCTCCTGG + Intergenic
1030349608 7:108469128-108469150 CTGGGCTCTCTCTACCCTCTAGG + Intergenic
1032466294 7:132147739-132147761 CAGGGTCCTCTTCCCCCACCTGG + Intronic
1032533114 7:132638079-132638101 CTGGGCTCTCATCCACCCCTAGG + Intronic
1032645120 7:133815304-133815326 CTCGGCTCACCTCCACCTCCTGG - Intronic
1033927420 7:146480755-146480777 CTCGGCTCACCTCCGCCTCCCGG + Intronic
1034197754 7:149261573-149261595 CTGGGGTCCCTTCCTCCTCCCGG - Intergenic
1034903459 7:154922659-154922681 CTGTGTTCTCTTCCTCCTGCTGG + Intergenic
1035022077 7:155805964-155805986 CAGGGCTGTCTTCCCTCGCCTGG + Intronic
1035048734 7:155985977-155985999 CTGGGCTCTCTTGCCACTGTTGG + Intergenic
1035268318 7:157704570-157704592 CTGGGCACCCTACCACCTCCTGG + Intronic
1035470542 7:159106429-159106451 CTGGCCTCTCTGCCCCTCCCTGG - Intronic
1035470600 7:159106616-159106638 CTGGCCTTTCTGCCCCTTCCCGG - Intronic
1035470614 7:159106656-159106678 CTGGCCTCTCTGCCCCTCCCTGG - Intronic
1035470621 7:159106675-159106697 CTGGCCTCTCTGCCCCTCCCTGG - Intronic
1035470628 7:159106694-159106716 CTGGCCTCTCTGCCCCTCCCTGG - Intronic
1035747564 8:1973543-1973565 CCGGGCGCTTCTCCCCCTCCAGG - Intergenic
1036261338 8:7242925-7242947 CTGGGCTCACCTCCGCTTCCCGG + Intergenic
1036305262 8:7596630-7596652 CTGGGCTCACCTCCGCTTCCCGG - Intergenic
1036313378 8:7701469-7701491 CTGGGCTCACCTCCGCTTCCCGG + Intergenic
1036356113 8:8044626-8044648 CTGGGCTCACCTCCGCTTCCCGG - Intergenic
1037939126 8:22938284-22938306 CTGTGCTCTCTCCCACCTCTAGG + Intronic
1038455344 8:27669106-27669128 CTGGGCTCACTTCTCCCCCAGGG - Intronic
1038658385 8:29474918-29474940 CTTGGCTCTCCTCCACCTCCCGG - Intergenic
1039375448 8:37028163-37028185 CAGTGCCCTCTTCCCCCTACTGG + Intergenic
1039448011 8:37648139-37648161 ATGGGCTCTGTTCCCAATCCTGG - Intergenic
1040873030 8:52120547-52120569 CTGGGCTTCCTTCCTCCTCTTGG - Intronic
1041656464 8:60355758-60355780 CTGGATTCTCCTCCCTCTCCAGG - Intergenic
1041808659 8:61883925-61883947 CTGGGCTCTCTTCTTCATGCTGG - Intergenic
1042517282 8:69672892-69672914 CGGGGCTCTCTTCCAGCCCCGGG + Exonic
1044861168 8:96525351-96525373 CTGTGCTCACTTCCACCTGCAGG + Intronic
1045058936 8:98394805-98394827 TTGGGTTCTCTTCTCCTTCCAGG + Intergenic
1045349430 8:101324595-101324617 ATGTGCTCTCTTCCCTCTCTTGG + Intergenic
1047750265 8:127875206-127875228 CTGGGGTCTGTTCTTCCTCCGGG + Intergenic
1047781015 8:128111240-128111262 CTCGGCTCACTCCACCCTCCAGG + Intergenic
1048544581 8:135374582-135374604 CTGGGCTCGCTCCCCTCACCAGG + Intergenic
1048931839 8:139321428-139321450 CTGTACTTTCTTCCCCCACCTGG - Intergenic
1049104271 8:140601594-140601616 CTGGGCTGTCTGCCCCAGCCTGG + Intronic
1049273365 8:141707749-141707771 CTGGGCTCACTCCCCACCCCAGG - Intergenic
1049656406 8:143800451-143800473 CTGGCCGCCCTTCCCCCTTCGGG - Intronic
1049777527 8:144413549-144413571 CCGGGCTCTCCTCCGCCACCTGG + Exonic
1049850368 8:144827293-144827315 CTGGGCCCTCCTCTCCCTCGCGG + Intergenic
1050331731 9:4552641-4552663 CTGGACTCTCTTGCCCCTCTAGG - Intronic
1051188542 9:14486357-14486379 CTGGGCTTTCTCCTGCCTCCTGG - Intergenic
1052641105 9:31166635-31166657 CTGGGACCTCTTCCTCCTCAAGG + Intergenic
1053399122 9:37801473-37801495 CTGGGCTCGCTCCCCGCGCCCGG + Intronic
1056919333 9:90772316-90772338 CTGGTCTCACCTTCCCCTCCTGG - Intergenic
1056992496 9:91424202-91424224 CTTGGCTCCCTTCACCCTCCCGG + Intergenic
1057140349 9:92722944-92722966 CTGGGCTCCCTCTCCTCTCCAGG - Intronic
1057311288 9:93944919-93944941 CTGGGCTCCCTTCAGGCTCCAGG + Intergenic
1058935308 9:109764367-109764389 CTGCGCTCTTTTACACCTCCTGG + Intronic
1060053026 9:120390513-120390535 CAGGGCTCGCCTGCCCCTCCTGG - Intronic
1060078937 9:120622820-120622842 CTGGGCTTTCTTTCCCTTCTGGG - Intronic
1060985562 9:127817203-127817225 CTGCTCTCTCTTTCTCCTCCAGG - Exonic
1061009868 9:127948523-127948545 CCTGTCTCTCTGCCCCCTCCTGG + Intronic
1061037013 9:128119523-128119545 CTGTGTTCTCATCCCCATCCTGG - Intergenic
1061276398 9:129571367-129571389 CTCTGCCCTCTTCTCCCTCCTGG - Intergenic
1061283886 9:129611547-129611569 CAGGGCTCTCTTCCCTCGGCTGG + Intronic
1061425632 9:130496685-130496707 CAGGGCCCTCCTGCCCCTCCAGG - Intronic
1061870740 9:133519056-133519078 GTGGTCTCTCTTGCTCCTCCTGG + Intronic
1061897423 9:133655705-133655727 CTGGCCACCCTTGCCCCTCCAGG - Intronic
1062053880 9:134460825-134460847 TTGGGGTCTCTGCCCCCTTCTGG + Intergenic
1062070246 9:134551470-134551492 CTTTGCCCTCTGCCCCCTCCAGG - Intergenic
1062114812 9:134802648-134802670 CGTGGCCCTCTTCCCCCACCTGG - Intronic
1062239908 9:135531384-135531406 CTGGGATCCCTTCACCCTCTGGG + Intergenic
1062280799 9:135750820-135750842 CTGGGCTCCCCTCCCACACCCGG - Intronic
1062282922 9:135759965-135759987 CTGGCCTCACTGTCCCCTCCTGG - Intronic
1062510449 9:136902439-136902461 CTGGGGTCTCTGCCACCTCCAGG + Intronic
1187002975 X:15201052-15201074 CTGGGCTCCCTTCCCTCAACGGG - Intergenic
1187489354 X:19736561-19736583 CTGGTCTCTCTTTCCCTTCCTGG + Intronic
1187503519 X:19859770-19859792 TTGGGCTCCCTGTCCCCTCCTGG + Intronic
1189293328 X:39901268-39901290 CTGGGCTCTCCTTCCCCTTCTGG + Intergenic
1190599749 X:52078257-52078279 CTGTGCTTTCTTCCTGCTCCTGG - Intergenic
1191035152 X:56017398-56017420 CTGTGCCCTCTGCCTCCTCCAGG - Intergenic
1192799583 X:74453114-74453136 CTTGGCTCACTTCCGCCTCCTGG + Intronic
1195023492 X:100852392-100852414 CTGGGCTCACTGCGACCTCCTGG - Intronic
1195085645 X:101411482-101411504 CTTGGCTCACCTCCACCTCCTGG + Intronic
1197251060 X:124216923-124216945 CTGGGAACTCTTTCCTCTCCTGG + Intronic
1198185604 X:134251302-134251324 CAGGGCTTTCTTCCCCCTTCTGG - Intergenic
1198233555 X:134715866-134715888 CTGGGCCTTCTCCCACCTCCAGG - Intronic
1199609406 X:149600168-149600190 CTGTGTTCTCTCCCCTCTCCTGG + Intronic
1199629711 X:149769186-149769208 CTGTGTTCTCTCCCCTCTCCTGG - Intergenic
1200042419 X:153379770-153379792 CTGGGCTCTCCTCCTCCCCCAGG - Intergenic
1201723732 Y:17132425-17132447 CTGATCTCTCTTCTTCCTCCTGG - Intergenic