ID: 1089304307

View in Genome Browser
Species Human (GRCh38)
Location 11:117517077-117517099
Sequence GGAGGGCAAGTCCTCATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089304299_1089304307 3 Left 1089304299 11:117517051-117517073 CCCCACCAAGAAGTGACTGGGAT 0: 1
1: 0
2: 1
3: 26
4: 167
Right 1089304307 11:117517077-117517099 GGAGGGCAAGTCCTCATTTATGG 0: 1
1: 0
2: 1
3: 9
4: 188
1089304296_1089304307 14 Left 1089304296 11:117517040-117517062 CCAAACTGCAGCCCCACCAAGAA 0: 1
1: 0
2: 3
3: 22
4: 239
Right 1089304307 11:117517077-117517099 GGAGGGCAAGTCCTCATTTATGG 0: 1
1: 0
2: 1
3: 9
4: 188
1089304301_1089304307 1 Left 1089304301 11:117517053-117517075 CCACCAAGAAGTGACTGGGATTT 0: 1
1: 0
2: 6
3: 15
4: 255
Right 1089304307 11:117517077-117517099 GGAGGGCAAGTCCTCATTTATGG 0: 1
1: 0
2: 1
3: 9
4: 188
1089304303_1089304307 -2 Left 1089304303 11:117517056-117517078 CCAAGAAGTGACTGGGATTTGGG 0: 1
1: 0
2: 1
3: 28
4: 226
Right 1089304307 11:117517077-117517099 GGAGGGCAAGTCCTCATTTATGG 0: 1
1: 0
2: 1
3: 9
4: 188
1089304300_1089304307 2 Left 1089304300 11:117517052-117517074 CCCACCAAGAAGTGACTGGGATT 0: 1
1: 0
2: 0
3: 16
4: 176
Right 1089304307 11:117517077-117517099 GGAGGGCAAGTCCTCATTTATGG 0: 1
1: 0
2: 1
3: 9
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089304307 Original CRISPR GGAGGGCAAGTCCTCATTTA TGG Intronic
900029342 1:359465-359487 GGAGGGAAGGTCCTGATTAATGG - Intergenic
900049942 1:588237-588259 GGAGGGAAGGTCCTGATTAATGG - Intergenic
900751543 1:4401006-4401028 GAAGTGCCTGTCCTCATTTAGGG + Intergenic
900854232 1:5167863-5167885 GGAGGGCGATTTGTCATTTATGG - Intergenic
903798697 1:25950284-25950306 GAAGGGCAAGTCAACAGTTAGGG - Intergenic
904409676 1:30317969-30317991 GGAGAGCAAGTGCTCCTTGAAGG - Intergenic
904901622 1:33862152-33862174 GCAGGGGAAGTCCTTGTTTAGGG - Intronic
905329013 1:37179061-37179083 GATGGGCATGGCCTCATTTAAGG + Intergenic
912095842 1:106142353-106142375 GAACAGTAAGTCCTCATTTAAGG - Intergenic
912725759 1:112057752-112057774 GGAGAACAAGTCCTCAAATAGGG - Intergenic
912863599 1:113237087-113237109 GGAGAGCAAGAGATCATTTAAGG - Intergenic
913996133 1:143653124-143653146 GGAGGGCAAGTCCTGGTGGACGG - Intergenic
914263124 1:146016061-146016083 GGAGGACAGGTCCTCGGTTATGG + Intergenic
914492687 1:148162073-148162095 GGAGGGCAAGTCCTGGTGGACGG - Intergenic
917589245 1:176459914-176459936 GGAATGCATGTTCTCATTTAGGG + Intergenic
920750950 1:208676373-208676395 GGCGTGCAACTCCTGATTTAAGG - Intergenic
1063197206 10:3754554-3754576 TGATGGCAAATACTCATTTAAGG - Intergenic
1063891008 10:10628358-10628380 GGAGAGAAAGAACTCATTTATGG + Intergenic
1064282609 10:13965225-13965247 GGTGGGCGAGTCGGCATTTAAGG - Intronic
1067731781 10:48817899-48817921 GGAGGGCAGAGCCTGATTTAAGG + Intronic
1071446389 10:85752257-85752279 TGAGTGCAAGTCATCATTTCTGG - Intronic
1071960343 10:90803896-90803918 GGATGTGAAGTTCTCATTTAGGG - Intronic
1072166057 10:92814165-92814187 GGAATGCATGTTCTCATTTAGGG - Intergenic
1073471932 10:103727805-103727827 GGAGGGCTCGTCCTGATTTCAGG + Intronic
1074330681 10:112505262-112505284 GGAAGAAAAGTCCTCATTTAAGG - Intronic
1075127302 10:119710828-119710850 GGAGGCCAAGTCCAAAATTAAGG - Intergenic
1076060090 10:127407318-127407340 GGAGGGCCATTCCTCATAGATGG + Intronic
1076191842 10:128488724-128488746 GGAGAAGAAGGCCTCATTTATGG - Intergenic
1078494851 11:11806852-11806874 GGAGGGCAACTCCTAATACAAGG + Intergenic
1081041908 11:38223835-38223857 GGAGATCATGTCCTCATTAAAGG - Intergenic
1081374167 11:42339613-42339635 GGATGTGAAGTTCTCATTTATGG - Intergenic
1081970497 11:47195061-47195083 GAAGGTCAAGTTCTCATGTAAGG - Intergenic
1083661544 11:64253791-64253813 GTAGGGCAAGTCCCCTTCTAGGG + Intronic
1086737394 11:90323050-90323072 GGAATGCTGGTCCTCATTTAGGG + Intergenic
1087439196 11:98161387-98161409 GGACGAGAAGTTCTCATTTAGGG - Intergenic
1088777637 11:113100797-113100819 GGATGTGAAGTTCTCATTTATGG + Intronic
1089304307 11:117517077-117517099 GGAGGGCAAGTCCTCATTTATGG + Intronic
1089388718 11:118085614-118085636 GGATGGCAGGTCCTCAGTTCAGG + Intronic
1090135806 11:124198476-124198498 GGATGTGAAGTTCTCATTTAGGG - Intergenic
1090972275 11:131653911-131653933 GGTGGGCAGGTGCTCATTGAAGG + Intronic
1091383926 12:80082-80104 GGAAGGCAAGTAATTATTTAAGG + Intronic
1093937800 12:25019687-25019709 GGATGCGAAGTTCTCATTTAAGG + Intergenic
1094596824 12:31873536-31873558 GGAATGCCTGTCCTCATTTAGGG + Intergenic
1095174266 12:39072917-39072939 GGAGAGCACGTACACATTTATGG - Intergenic
1097083895 12:56453557-56453579 GGAGAGCAACTTCTCATTCAAGG - Intronic
1097820787 12:64127656-64127678 GGAAGACAAGTCCTCATCCAAGG + Exonic
1098493634 12:71110489-71110511 GGAAGTAAAGTTCTCATTTAGGG + Intronic
1098545663 12:71708137-71708159 GGATGTGAAGTTCTCATTTAAGG + Intergenic
1099050322 12:77774629-77774651 GGAGAGCAAGTACTTATGTAGGG + Intergenic
1103148977 12:118620543-118620565 GGAGGGCATGTCCTAAGTGAGGG - Intergenic
1105542935 13:21330287-21330309 GGACTGCAAGTCCTTATTGAGGG + Intergenic
1105973024 13:25448082-25448104 GGATGTGAAGCCCTCATTTAGGG + Intronic
1107475526 13:40732201-40732223 GGAAGGAACGTCTTCATTTAAGG - Intronic
1107676583 13:42804022-42804044 GTAGAGCAAGTCTTCTTTTAAGG - Intergenic
1107998119 13:45881423-45881445 GGAAGGCTACTTCTCATTTATGG - Intergenic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1108920007 13:55661532-55661554 GGATGTGAAGTTCTCATTTAGGG - Intergenic
1110260511 13:73479613-73479635 GGAGAGCAAATCATCATTTTGGG + Intergenic
1111034868 13:82659365-82659387 GGATGTGAAGTTCTCATTTAGGG - Intergenic
1112001406 13:95213186-95213208 GGAGGGCAAGTCCTCTCTCATGG - Intronic
1115379729 14:32722474-32722496 GGAATGCATGTTCTCATTTAGGG - Intronic
1117181129 14:53192949-53192971 GGATGGCAAGTCTAAATTTAAGG + Intergenic
1120806093 14:88752685-88752707 GGAGTGCATGTTCTCATTGAGGG - Intronic
1123501212 15:20882759-20882781 GGAAGGCAGGCCCTCATTCAGGG - Intergenic
1123558464 15:21456464-21456486 GGAAGGCAGGCCCTCATTCAGGG - Intergenic
1123594695 15:21893739-21893761 GGAAGGCAGGCCCTCATTCAGGG - Intergenic
1124219021 15:27833339-27833361 GGAGTGCAGCTCCGCATTTATGG - Intronic
1130803476 15:87292218-87292240 GGAATGCTTGTCCTCATTTAGGG + Intergenic
1131257075 15:90870007-90870029 GGAGGGGAAGTCCCCACTTTGGG + Intronic
1131671483 15:94624470-94624492 GGAGGGCAAGTCCAGAGTTCAGG + Intergenic
1202966814 15_KI270727v1_random:183614-183636 GGAAGGCAGGCCCTCATTCAGGG - Intergenic
1133229234 16:4358642-4358664 GGAGGGAAAGCCCTGATTTGTGG + Intronic
1134271186 16:12734812-12734834 GGGGTGCAAGTCCTGATTCATGG - Intronic
1137862904 16:51864847-51864869 GGAGAGGAAATCATCATTTAGGG - Intergenic
1138612970 16:58142071-58142093 GGTGGGAAAGTGCTTATTTATGG - Intergenic
1138730539 16:59189254-59189276 GGCTGGAAAGTCCTCATTTGGGG + Intergenic
1138825301 16:60312214-60312236 GGAGAGAAAGTCCTCCTTTGAGG + Intergenic
1140564557 16:76026728-76026750 GGAATGCATGTTCTCATTTAGGG - Intergenic
1142689825 17:1598813-1598835 TGAGGGCAAGGCCTCATCCATGG - Intronic
1149347617 17:55753941-55753963 GGAGGGTGAGTCCTCATTATTGG + Intronic
1149722929 17:58863979-58864001 GGATGTGAAGTTCTCATTTAGGG + Intronic
1149979732 17:61300444-61300466 GTAGGGCAAGTTTTAATTTAGGG + Intronic
1151533242 17:74721176-74721198 GGAATGCATGTTCTCATTTAGGG + Intronic
1152076205 17:78161422-78161444 GGACAGCAAGTCCTGATTAAAGG - Intronic
1152950416 17:83227091-83227113 GGAGGGAAGGTCCTGATTAATGG + Intergenic
1153762194 18:8342008-8342030 GGAGAGCAAGTCAGCTTTTATGG + Intronic
1154155965 18:11944316-11944338 GGAGTGCCCGTTCTCATTTAGGG + Intergenic
1155496822 18:26451048-26451070 GGTGGGCAGATACTCATTTAGGG - Intergenic
1155800889 18:30102272-30102294 GGAATGCCTGTCCTCATTTAGGG - Intergenic
1159868993 18:73739591-73739613 GGGGGGGACATCCTCATTTAAGG - Intergenic
1160127421 18:76189340-76189362 GGAGGTGAAGTTCTCATTTAGGG - Intergenic
1161433244 19:4246553-4246575 GGATGGGAAGTCCTCGTTAAGGG + Intergenic
1164636139 19:29792733-29792755 GGAGGGGAAGTCACCATCTAGGG - Intergenic
1166538290 19:43589804-43589826 GGAGGGGAAGTCCTCTCTGAGGG + Exonic
925458455 2:4039781-4039803 GGAGGGCAGATCTTCCTTTAGGG + Intergenic
926189844 2:10720724-10720746 GGAGGGGGAGTCCACGTTTAAGG + Intergenic
926394016 2:12423266-12423288 GGAATGCCTGTCCTCATTTAGGG - Intergenic
928103872 2:28455087-28455109 GGAATGCCTGTCCTCATTTAGGG - Intergenic
928846471 2:35679543-35679565 AGAGTGCAAGACCTTATTTAAGG + Intergenic
930889948 2:56373291-56373313 GGGGGGAAATTCATCATTTAGGG - Intronic
932337867 2:70941284-70941306 GGAGGGCAAGACATCATCTGTGG - Exonic
933352956 2:81178640-81178662 GGAATGCCTGTCCTCATTTATGG + Intergenic
939527910 2:143320388-143320410 GGTGGGGAAGTCCTGATTTGTGG - Intronic
940105822 2:150098890-150098912 GGAGAGGAAGTCCTCATTTCAGG - Intergenic
944297310 2:198080964-198080986 GGAGGGAATGTCTTGATTTAAGG + Intronic
946107019 2:217379859-217379881 GGAGTACAAGGCCTCACTTAAGG + Intronic
946764938 2:223031774-223031796 GGAGGTGAAGACATCATTTAAGG + Intergenic
947279325 2:228431613-228431635 GGATGGCAAGTCATCAGTGACGG + Intergenic
948747814 2:240108788-240108810 GGAGGGAATGTCCTCATGCAAGG + Intergenic
1173702147 20:45082096-45082118 GGAGGCCAAGAACTCATTTGAGG + Intergenic
1177624345 21:23640576-23640598 GGAGGGAAAGTACTTAATTAAGG + Intergenic
1179422206 21:41245639-41245661 GGAGTGCAGGTCCTCAATGAAGG + Intronic
1181312250 22:21951794-21951816 GGAGGGCAAGCACCCATTTAAGG + Intronic
1181753200 22:25004346-25004368 GGAGGCCAAGGCCTCACTTGAGG - Intronic
1182980442 22:34665714-34665736 GGAGGGCAAGCACACATTTGAGG + Intergenic
952561728 3:34603397-34603419 GGAATGCATGTTCTCATTTAGGG - Intergenic
953668246 3:44941351-44941373 TGAGAGCAGGTCCTCATTTTGGG + Intronic
959376475 3:105594043-105594065 AGAATGCCAGTCCTCATTTAGGG + Intergenic
959742267 3:109734644-109734666 GGAGGGGCAGTTCTCATTTGGGG + Intergenic
960395363 3:117130928-117130950 GGATGTGAAGTTCTCATTTAGGG - Intronic
963102786 3:141622468-141622490 GGAATGCCTGTCCTCATTTAGGG - Intergenic
964453179 3:156832225-156832247 GGAGAGAAAGTCCTCACTTCAGG + Intronic
970784346 4:19778050-19778072 GGAAGTCCAGTCCTCATTCATGG + Intergenic
971005426 4:22369685-22369707 AGAGGGCAAGTCCCCAGTGAGGG + Intronic
971955187 4:33408307-33408329 GGAGGGAAATTCCATATTTAAGG - Intergenic
979966320 4:127080294-127080316 AGAGGGCAAGTACTCATTGGGGG - Intergenic
980821571 4:138023493-138023515 GGAATGCCTGTCCTCATTTAGGG + Intergenic
980888614 4:138789971-138789993 GGAGGGAATGACCTCCTTTAGGG - Intergenic
984245890 4:177275060-177275082 GGAATGCATGTTCTCATTTAGGG - Intergenic
984251489 4:177341478-177341500 AGAGAGCAAGTCCTGCTTTACGG - Exonic
988481025 5:31630714-31630736 GGAGGCCATGTCTTCATTGAAGG + Intergenic
993570888 5:89537357-89537379 GGAGGACAAGTCCTCTGGTATGG - Intergenic
994217119 5:97150483-97150505 GGAGGGCAAGTCAAATTTTATGG + Intronic
994433272 5:99695635-99695657 GGATGTGAAGTTCTCATTTAGGG + Intergenic
996576699 5:124983741-124983763 GGATGTGAAGTTCTCATTTAGGG - Intergenic
1001616503 5:173047394-173047416 GGATGTGAAGTTCTCATTTAGGG - Intergenic
1002744648 5:181460906-181460928 GGAGGGAAGGTCCTGATTAATGG + Intergenic
1003409064 6:5847513-5847535 GGACTGCAAGTCCTTATTGAGGG - Intergenic
1004262186 6:14117995-14118017 GCAGGGCAAGTCCACATCTTCGG - Exonic
1004872914 6:19925343-19925365 GGAGGCCAAATCCTCATGAATGG - Intergenic
1005838380 6:29724275-29724297 GGAGCGCAGGTCCTCGTTCAGGG - Exonic
1005851909 6:29828645-29828667 GGAGCGCAGGTCCTCGTTCAGGG - Exonic
1005859285 6:29888569-29888591 GGAGCGCAGGTCCTCGTTCAGGG - Intergenic
1005875504 6:30007420-30007442 GGAGCGCAGGTCCTCGTTCAGGG - Intergenic
1005905741 6:30260435-30260457 GGAGTGCAGGTCCTCGTTCAGGG - Intergenic
1005931871 6:30490342-30490364 GGAGCGCAGGTCCTCATTCAGGG - Exonic
1006043084 6:31271224-31271246 GGAGCGCAGGTCCTCGTTCAGGG + Exonic
1006052677 6:31356318-31356340 GGAGCGCAGGTCCTCGTTCAGGG + Exonic
1006285915 6:33094061-33094083 GGAGGGGAAATCCTCACTTAGGG - Intergenic
1008914953 6:56777414-56777436 GGAGGGTAAGTCTTCAATTATGG - Intronic
1010049675 6:71487933-71487955 TGAGGGCAGGGCCTCATTAATGG + Intergenic
1010327564 6:74582317-74582339 GGATGTGAAGTTCTCATTTAGGG + Intergenic
1010621833 6:78085958-78085980 GGAATGCATGTTCTCATTTAGGG + Intergenic
1011497442 6:87950478-87950500 GGAGGGCACGGGCTCATTCATGG - Intergenic
1012112893 6:95259642-95259664 GGATGTGAAGTTCTCATTTAGGG + Intergenic
1013302631 6:108818607-108818629 GCAAGGCAAGGACTCATTTAAGG - Intergenic
1014459744 6:121682228-121682250 GGAAGGAAAGTCCTCATAAAAGG - Intergenic
1014812460 6:125902125-125902147 GGATGTGAAGTTCTCATTTAGGG + Intronic
1016974288 6:149791717-149791739 AGAGGTTAAGTCCTCATTAATGG + Intronic
1019249559 6:170734447-170734469 GGAGGGAAGGTCCTGATTAATGG + Intergenic
1020131065 7:5558896-5558918 GGAGGGAAGGGCCTCATTTCTGG + Intronic
1021167666 7:17360405-17360427 GGATGTGAAGTTCTCATTTAGGG + Intergenic
1024098061 7:46000775-46000797 GGAGGGCAGGGCATCAGTTATGG - Intergenic
1028859964 7:95638073-95638095 AGAGGGCAAGTCTTCATCAATGG - Intergenic
1028885499 7:95928251-95928273 GGAGGCCAAGTCCTCATTTCTGG + Intronic
1031712686 7:125068515-125068537 GGAGTGCATGTTCTCATTTATGG + Intergenic
1034199897 7:149277792-149277814 AGAGGACAAGTGCTCATTTCGGG + Intronic
1035360985 7:158314289-158314311 AGAGGGAAAAGCCTCATTTAAGG - Intronic
1035498537 8:73209-73231 GGAGGGAAGGTCCTGATTAATGG - Intronic
1035515146 8:226457-226479 AGAAGGAAAGTCCTCATTTCAGG - Intergenic
1036661303 8:10710851-10710873 GGAGGAAAAGTGCCCATTTATGG + Intronic
1039290489 8:36089155-36089177 GGAATGCATGTTCTCATTTAGGG + Intergenic
1039502498 8:38029267-38029289 GGAGGGCAAGGCCTGAGATAGGG - Intergenic
1040835080 8:51722859-51722881 GGAGTGCCTGTTCTCATTTAGGG + Intronic
1042984860 8:74572115-74572137 AGAGGACAAGTCCTCTTTTCAGG - Intergenic
1043590110 8:81821476-81821498 GTAGTACAAGTCCTCTTTTATGG + Intronic
1045481245 8:102593868-102593890 GGAATGCCTGTCCTCATTTAGGG - Intergenic
1046396793 8:113650893-113650915 GGAGTGCCTGTTCTCATTTAGGG - Intergenic
1047403735 8:124567855-124567877 GCAGTGCAAGTTCTCAATTACGG + Intronic
1047536048 8:125720347-125720369 GGAGGTGAATTCCTGATTTATGG - Intergenic
1047554771 8:125917246-125917268 GCAGCACAAGTCCTCATTGAGGG - Intergenic
1048809115 8:138269217-138269239 TGAGGGAATGTCATCATTTAAGG - Intronic
1050118832 9:2287880-2287902 GGAATGCCTGTCCTCATTTAGGG - Intergenic
1055449239 9:76416041-76416063 GGATGTGAAGTTCTCATTTAGGG - Intergenic
1057092920 9:92276408-92276430 GGAGGGCACGTCCTAATTGCTGG + Intronic
1057624080 9:96661981-96662003 GGAAGGCAAATCCTTATGTAGGG + Intergenic
1058256869 9:102777681-102777703 GGAATGCCTGTCCTCATTTAGGG - Intergenic
1058601985 9:106680142-106680164 GGAGGGCCAGTCTTCAGTGAAGG + Intergenic
1203610459 Un_KI270748v1:91385-91407 GGAGGGAAGGTCCTGATTAATGG + Intergenic
1186036521 X:5429134-5429156 GGATGCGAAGTTCTCATTTAGGG + Intergenic
1187275742 X:17815419-17815441 GGAGGGAGAATCCTGATTTAAGG - Intronic
1192742264 X:73904854-73904876 GGGGGTGGAGTCCTCATTTATGG - Intergenic
1194802742 X:98292141-98292163 GGATGTGAAGTTCTCATTTAGGG + Intergenic
1194979209 X:100423228-100423250 GGATGTGAAGTTCTCATTTAGGG + Intergenic
1195034298 X:100957430-100957452 GGAGCGAGAGGCCTCATTTATGG - Intergenic
1196432915 X:115646468-115646490 GGAGGGCAAGACCTGAATGATGG + Exonic
1197784799 X:130188853-130188875 GGAGGCCAAGGCCTCACTTGAGG - Intergenic
1199432480 X:147776822-147776844 GGATGTAAAGTTCTCATTTAGGG + Intergenic
1201731590 Y:17210576-17210598 GGATGTGAAGTTCTCATTTAGGG - Intergenic