ID: 1089305465

View in Genome Browser
Species Human (GRCh38)
Location 11:117523722-117523744
Sequence CATTGTGAGCATAGGGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 128}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089305465_1089305474 15 Left 1089305465 11:117523722-117523744 CCTACTGCCCTATGCTCACAATG 0: 1
1: 0
2: 1
3: 10
4: 128
Right 1089305474 11:117523760-117523782 GAGAGTTTCTTTGGTCAACCAGG 0: 1
1: 0
2: 0
3: 8
4: 135
1089305465_1089305473 6 Left 1089305465 11:117523722-117523744 CCTACTGCCCTATGCTCACAATG 0: 1
1: 0
2: 1
3: 10
4: 128
Right 1089305473 11:117523751-117523773 AGGTGGGAAGAGAGTTTCTTTGG 0: 1
1: 1
2: 4
3: 35
4: 314
1089305465_1089305477 27 Left 1089305465 11:117523722-117523744 CCTACTGCCCTATGCTCACAATG 0: 1
1: 0
2: 1
3: 10
4: 128
Right 1089305477 11:117523772-117523794 GGTCAACCAGGATGAGAGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 143
1089305465_1089305476 26 Left 1089305465 11:117523722-117523744 CCTACTGCCCTATGCTCACAATG 0: 1
1: 0
2: 1
3: 10
4: 128
Right 1089305476 11:117523771-117523793 TGGTCAACCAGGATGAGAGGTGG 0: 1
1: 0
2: 0
3: 14
4: 149
1089305465_1089305472 -10 Left 1089305465 11:117523722-117523744 CCTACTGCCCTATGCTCACAATG 0: 1
1: 0
2: 1
3: 10
4: 128
Right 1089305472 11:117523735-117523757 GCTCACAATGAATGGGAGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 167
1089305465_1089305475 23 Left 1089305465 11:117523722-117523744 CCTACTGCCCTATGCTCACAATG 0: 1
1: 0
2: 1
3: 10
4: 128
Right 1089305475 11:117523768-117523790 CTTTGGTCAACCAGGATGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089305465 Original CRISPR CATTGTGAGCATAGGGCAGT AGG (reversed) Intronic
900760465 1:4467010-4467032 CACTGTGTACATGGGGCAGTGGG - Intergenic
902989015 1:20173063-20173085 CTTTGTGAGGATAAGGCAGGAGG + Intronic
903409196 1:23126372-23126394 CATTGGGAGGATAAGGCAGGAGG + Intronic
903789104 1:25880721-25880743 CAGTGTGAGCACGGTGCAGTGGG + Intergenic
907491780 1:54813212-54813234 CATGGTGTGGAGAGGGCAGTGGG - Intronic
914845211 1:151280134-151280156 CATTGCGACCATAGGGCAAGTGG + Exonic
916514420 1:165502297-165502319 CATTGTGAGCATGGAGCACTGGG - Intergenic
917629816 1:176880445-176880467 CATTGTGATGATGGGGCAGTAGG + Intronic
917854344 1:179089000-179089022 CTTTGTGAGGATGGGGAAGTTGG + Intronic
917929101 1:179811717-179811739 CTTTGTGAGCACAGTGCAGTTGG + Intronic
918770510 1:188552138-188552160 CTTTGTGAGAATAGAGCACTAGG - Intergenic
920280389 1:204839187-204839209 CTTTGTTAGCATGGAGCAGTGGG + Intronic
921768238 1:218999885-218999907 CATTGTGAAGATAGGACAGAGGG + Intergenic
922169103 1:223140205-223140227 CATTTTGAGCATAGGAGAGTAGG + Intronic
922221490 1:223611743-223611765 CTTTGTGAGCCAAGGGCAGGTGG + Intronic
923498547 1:234545449-234545471 CAGTGTGAGCCTGGGGGAGTGGG - Intergenic
924423830 1:243932964-243932986 GATTGTGAGCTATGGGCAGTAGG + Intergenic
924434048 1:244023029-244023051 GATTGTGTACATAGGACAGTGGG + Intergenic
1063555137 10:7071671-7071693 CATTTTGAGAATAGGGTGGTTGG - Intergenic
1064970539 10:21061990-21062012 CATTGTGCGTGTTGGGCAGTAGG - Intronic
1065892117 10:30130345-30130367 CCTTGTCAGAACAGGGCAGTTGG - Intergenic
1070060865 10:72981606-72981628 GATTGTGAGAATAGGGCCTTTGG + Intergenic
1070159697 10:73858709-73858731 CATTCTGAGCCGAGGGCAGATGG + Intronic
1071425247 10:85542979-85543001 CATTGTGAGCAGAGCCCAGGAGG + Intergenic
1072652722 10:97308111-97308133 CATTAAGGGCATCGGGCAGTAGG + Intergenic
1073249490 10:102113176-102113198 CATTGTGAGGACAGGGCTCTGGG - Intronic
1074689331 10:115990301-115990323 CTTTCTGAGCAGAGGGCAGAGGG + Intergenic
1077804712 11:5579012-5579034 CATTGTGAGAATAGTTCAATAGG + Intronic
1078360181 11:10661885-10661907 CCCTGGGAGGATAGGGCAGTAGG - Intronic
1079604649 11:22349666-22349688 CAGTGGTAGCATATGGCAGTAGG - Intronic
1080428651 11:32178738-32178760 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1082265128 11:50109825-50109847 CATTGGGAGCCTAAGGCAGGAGG + Intergenic
1084045094 11:66563792-66563814 CAGGGTGAGCAGAGGGCACTGGG - Exonic
1086879630 11:92138209-92138231 GCTTGTGGACATAGGGCAGTTGG - Intergenic
1089305465 11:117523722-117523744 CATTGTGAGCATAGGGCAGTAGG - Intronic
1102996283 12:117353348-117353370 CATTGTGAAGATAGGTAAGTAGG - Intronic
1108074793 13:46668616-46668638 CATTGTCAGGAGAGGGCAGTTGG + Intronic
1108215017 13:48175456-48175478 TAGTGGGAGCATAGAGCAGTGGG - Intergenic
1108766342 13:53634780-53634802 CATTGTGAACATAGTGCATTGGG + Intergenic
1115546554 14:34469616-34469638 TATTGTGGGCACAAGGCAGTGGG - Intergenic
1117311158 14:54524634-54524656 CTTTGTGAGCCTGGGGCAGAAGG - Intronic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1119792911 14:77369158-77369180 GATTGTTAACATAGAGCAGTGGG - Intronic
1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG + Intergenic
1122215613 14:100201951-100201973 CAATGTGAGCCCAGGGAAGTGGG + Intergenic
1125137947 15:36366334-36366356 CATTGTGTGCTTGGGGCAGTGGG - Intergenic
1125390278 15:39185113-39185135 CACAGTGAGCATGGAGCAGTGGG + Intergenic
1128984309 15:72208012-72208034 CTTTGTGAGCATTGGGGAGGGGG + Intronic
1129175386 15:73836210-73836232 CTTTGTCAGCATGGGGCAGAAGG + Intergenic
1129535794 15:76312705-76312727 CAGTGAGAGAAGAGGGCAGTGGG - Intergenic
1130127250 15:81104361-81104383 GACAGTGAGCATGGGGCAGTAGG + Intronic
1131903275 15:97112513-97112535 CATTGGGAGAACAAGGCAGTTGG + Intergenic
1132568727 16:634941-634963 CATTGATGGCATAGGGCTGTGGG + Intronic
1135985518 16:27181013-27181035 GATTGAGACCAGAGGGCAGTGGG + Intergenic
1137888387 16:52131316-52131338 CATTGTGAGCTAAAGGCAGTGGG - Intergenic
1139823156 16:69736612-69736634 CATTGGGAGGCTAAGGCAGTTGG + Intergenic
1143003888 17:3814264-3814286 CAGTGAGAGCAGAGGACAGTGGG - Intronic
1143384926 17:6523521-6523543 CAGTGAGAGCTAAGGGCAGTCGG - Intronic
1144575820 17:16428741-16428763 CTTGGTCAGCATAGGCCAGTGGG + Intronic
1144790479 17:17855686-17855708 CCTTGTGGGCATGGGGCTGTGGG - Intronic
1145727270 17:27142155-27142177 CTTTGGGAGGATAAGGCAGTTGG + Intergenic
1146981366 17:37164898-37164920 CATTGTGACCATGTGGCACTGGG + Intronic
1147182480 17:38695275-38695297 CTTTGAGAGCACAGGGCAGGAGG - Intergenic
1147376770 17:40027205-40027227 CAATGTGAACATAGGGCTGAAGG + Intronic
1148204215 17:45769392-45769414 CATTGTGAGCAAAGGCCGGGAGG - Intergenic
1152381984 17:79946893-79946915 CATTGTGAGCAGAGGACGCTGGG - Intronic
1154014621 18:10605239-10605261 CCTTGTGAGCACAGGGCTATCGG + Intergenic
1156011722 18:32504369-32504391 CATTGTGTCAGTAGGGCAGTAGG - Intergenic
1164881007 19:31732849-31732871 CTCTGTGAGCATGGGGCAGCTGG + Intergenic
1166142145 19:40810951-40810973 CAATGTGTGGATAGGGCACTTGG - Intronic
1166185376 19:41135843-41135865 CAATGTGTGGATAGGGCACTTGG + Intergenic
1166323274 19:42032985-42033007 CATTGTATGCATAGGCCAGCAGG - Intronic
926753069 2:16214598-16214620 CTTTGTGAGCTTAGGGCCCTGGG - Intergenic
927432229 2:23036473-23036495 CTTTGTGACCATCGGGGAGTGGG - Intergenic
927745617 2:25617404-25617426 CATCCTGAGAATGGGGCAGTGGG + Intronic
930186900 2:48420019-48420041 CTCGGTGAGCACAGGGCAGTGGG + Intergenic
936284717 2:111173245-111173267 CAGAGTGAGGATGGGGCAGTGGG - Intergenic
947373704 2:229474273-229474295 CACTGTAAGGATAGGCCAGTGGG + Intronic
948859300 2:240745174-240745196 CATAGTGAGCATAGAGCCGATGG - Intronic
1169036155 20:2454057-2454079 TATTGTGCGCACAGAGCAGTGGG + Intergenic
1170027575 20:11906795-11906817 GCTTGTGTGTATAGGGCAGTAGG - Intronic
1170135768 20:13072119-13072141 TATTTTGAGCAAAGGTCAGTAGG - Intronic
1170225881 20:13991747-13991769 CTTTGGGAGCCTAAGGCAGTTGG + Intronic
1175192341 20:57219800-57219822 CTTTAGGAGCATCGGGCAGTGGG - Intronic
1175697694 20:61114882-61114904 CACTGTGGGCAGTGGGCAGTGGG + Intergenic
1180918477 22:19505981-19506003 CCTTGTGAGCCAAGGGCAGCGGG + Intronic
1182921613 22:34085301-34085323 CATTCTGAGCCTTGGACAGTGGG + Intergenic
1183051588 22:35266213-35266235 CACTGTCTGCTTAGGGCAGTTGG + Intronic
952059325 3:29488580-29488602 CATTGTGATCATTGTGCAGCTGG - Intronic
952674019 3:36004903-36004925 CATCATGAGCATAAGGTAGTAGG - Intergenic
955145367 3:56312943-56312965 CATTGTGTGGATATAGCAGTAGG - Intronic
955963974 3:64369096-64369118 CATTGTTGGCACAGGGCAGAGGG - Intronic
960155677 3:114295223-114295245 CTCTGGAAGCATAGGGCAGTGGG + Intronic
960173522 3:114490874-114490896 TATTGTGAGGACAGGGCAGAGGG + Intronic
961244131 3:125436743-125436765 CAGTGTGAGGACAGGGCACTGGG + Intergenic
961865658 3:129951847-129951869 CACTGTAAGCATGGGGAAGTAGG - Intergenic
963062907 3:141239741-141239763 GAGTGTGAGCATTGGGCAGTGGG - Intronic
966933564 3:184691313-184691335 CATTCTGAGCATAGGGCAGGCGG - Intergenic
969940193 4:10724362-10724384 AATTCTGAGCATAGGGAAGACGG - Intergenic
972340159 4:38145600-38145622 AAATGTGTGTATAGGGCAGTGGG + Intergenic
975589496 4:75986225-75986247 AATTGGGAGGCTAGGGCAGTTGG - Intronic
975926903 4:79466872-79466894 AATTCTGAGAGTAGGGCAGTGGG + Intergenic
981718618 4:147776765-147776787 CATTGGGAGCTTAGTGCACTGGG + Intronic
986006452 5:3672608-3672630 ATGTGTGAGCATAGTGCAGTGGG - Intergenic
992945351 5:81803875-81803897 CATTGTGGCCATGGGGCAATGGG - Intergenic
997127500 5:131242902-131242924 CATTGTGAACAAAGGGCACAGGG + Intergenic
1001081634 5:168671777-168671799 CAGTGGGATCATAGGGCAATGGG - Intronic
1001681470 5:173560668-173560690 AATAGTGAACATAGGGCAGAAGG - Intergenic
1003333916 6:5152849-5152871 GTTTGTCAGCACAGGGCAGTGGG - Intronic
1004286225 6:14323079-14323101 CAATGTGAACACAGAGCAGTGGG + Intergenic
1005677760 6:28173197-28173219 CATTGGGAGGACAGGGCAGGAGG + Intergenic
1006174403 6:32113351-32113373 CAAAGTGGGCATAGGGCAGGAGG + Intronic
1006247132 6:32747145-32747167 CATTCTGAGCCAAGGGCAGAGGG - Exonic
1007854577 6:44841733-44841755 CATTGTAAGCATAAGGCTCTTGG + Intronic
1015510184 6:134030729-134030751 CATTGTGAGCCTGGAGCGGTAGG + Intronic
1015924716 6:138297049-138297071 CACTGTGGCCATTGGGCAGTGGG + Intronic
1016583845 6:145661416-145661438 CATTCTCAGGATAGAGCAGTGGG - Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018178234 6:161197480-161197502 CATTGGGAGCATTTGGGAGTCGG - Intronic
1027858525 7:83544749-83544771 CATTCTTAACATAGGCCAGTAGG + Intronic
1032271772 7:130415158-130415180 CATTATTAGCAAAGGGAAGTTGG + Intronic
1032329292 7:130962758-130962780 CTTTCTGTTCATAGGGCAGTTGG - Intergenic
1032547518 7:132756128-132756150 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1033984830 7:147212493-147212515 AATTGTGAACATAGGGTATTTGG - Intronic
1040060629 8:43100284-43100306 CAGTGTGTGCTTAGGGAAGTGGG + Intronic
1044021741 8:87113202-87113224 CAGTGTGAGCCATGGGCAGTAGG + Intronic
1044656248 8:94551578-94551600 CCTTGAGAGCATAGGGCAGATGG - Intronic
1045732925 8:105263136-105263158 CATTGTGAGGAGGGGGCGGTGGG + Intronic
1046792321 8:118335216-118335238 CATTGGGAGCATTGCACAGTAGG - Intronic
1052600618 9:30624922-30624944 CATTCTGTGCATAGATCAGTAGG - Intergenic
1053318764 9:37076556-37076578 CATTCTGAGCATGGGAAAGTAGG + Intergenic
1053416890 9:37952434-37952456 CACTGTGAGCAGCGGGCAGGAGG + Intronic
1056210760 9:84362763-84362785 CATTCTGAGAAGAGGGCTGTAGG - Intergenic
1056683536 9:88740980-88741002 CAGTGTGAGTGAAGGGCAGTGGG + Intergenic
1186854145 X:13609955-13609977 CATTGGGAGCATTGGCCAGATGG - Intronic
1187485886 X:19703043-19703065 CAGTGTGGGCATAGTGGAGTTGG - Intronic
1188316025 X:28674357-28674379 CATTGAGTGCATAGGGAAGGGGG - Intronic
1192349548 X:70345885-70345907 CAATGTAAGCAAAGTGCAGTGGG + Intronic
1195537349 X:106023723-106023745 CATTGTGAGGGTTGGGAAGTAGG + Intergenic
1201610375 Y:15836226-15836248 CTTTGTGCCCATAGAGCAGTGGG - Intergenic