ID: 1089305478

View in Genome Browser
Species Human (GRCh38)
Location 11:117523778-117523800
Sequence GGTGATCCCACCTCTCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089305478_1089305482 21 Left 1089305478 11:117523778-117523800 CCAGGATGAGAGGTGGGATCACC 0: 1
1: 0
2: 2
3: 18
4: 116
Right 1089305482 11:117523822-117523844 GCCCACGTTGAATAACCCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089305478 Original CRISPR GGTGATCCCACCTCTCATCC TGG (reversed) Intronic