ID: 1089305480

View in Genome Browser
Species Human (GRCh38)
Location 11:117523799-117523821
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089305480_1089305482 0 Left 1089305480 11:117523799-117523821 CCTCTGGACGTTCTCTTTCCACT 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1089305482 11:117523822-117523844 GCCCACGTTGAATAACCCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089305480 Original CRISPR AGTGGAAAGAGAACGTCCAG AGG (reversed) Intronic