ID: 1089306230

View in Genome Browser
Species Human (GRCh38)
Location 11:117528020-117528042
Sequence AACGGCCTTGTGAAGTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089306230_1089306235 5 Left 1089306230 11:117528020-117528042 CCTCCAGACTTCACAAGGCCGTT 0: 1
1: 0
2: 0
3: 5
4: 125
Right 1089306235 11:117528048-117528070 CAACCAGTAGTATAGGTGTGTGG 0: 1
1: 0
2: 0
3: 7
4: 73
1089306230_1089306234 -2 Left 1089306230 11:117528020-117528042 CCTCCAGACTTCACAAGGCCGTT 0: 1
1: 0
2: 0
3: 5
4: 125
Right 1089306234 11:117528041-117528063 TTGCAGGCAACCAGTAGTATAGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089306230 Original CRISPR AACGGCCTTGTGAAGTCTGG AGG (reversed) Intronic
905621822 1:39454947-39454969 AACGGCCTTGTCAGAACTGGTGG + Exonic
912020363 1:105101640-105101662 AACTGCCTTGTCATCTCTGGTGG + Intergenic
914990838 1:152498358-152498380 AATGGCCTTACTAAGTCTGGTGG - Intergenic
922291368 1:224211504-224211526 AAGGGCATTTTGAAGTCTGGAGG - Intergenic
924037881 1:239954772-239954794 AAAGGCCCTCTGAAGTCTGCTGG - Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064839271 10:19572685-19572707 AACGGCATTTTGAAGTACGGTGG + Intronic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1066488577 10:35872528-35872550 AAAGGCCAAGTGAAGTCTGAGGG + Intergenic
1067062455 10:43084830-43084852 AACCGCCCTGTGAAGGATGGAGG + Intronic
1070380754 10:75878488-75878510 AAAGGCCTTGTGGTGTCTGCTGG + Intronic
1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG + Intronic
1071160272 10:82737668-82737690 AACAGCCTTGTTAAGTGGGGAGG - Intronic
1071699571 10:87915692-87915714 TATGTCTTTGTGAAGTCTGGCGG - Intronic
1071976948 10:90964769-90964791 AACTGCCTTGTAAACTATGGTGG - Intergenic
1074285635 10:112095260-112095282 ACCCGCCTTGGGAAGTCAGGGGG - Intergenic
1077279271 11:1734750-1734772 CAGGGCCTGGAGAAGTCTGGAGG - Exonic
1077472416 11:2770239-2770261 GACCGCCCTGTGAAGTCTGGAGG - Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1083899327 11:65636167-65636189 ACAGCCCTTGTGAAGCCTGGGGG - Exonic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1088541784 11:110920805-110920827 AACTGGCTTCTCAAGTCTGGAGG + Intergenic
1089067224 11:115670954-115670976 AAGGACCCTGTGAAGTCTGCAGG - Intergenic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1091097638 11:132839233-132839255 AACGGCCTTGGGAAATCAGGTGG + Intronic
1091302137 11:134514599-134514621 AGGGGCCTTGTGTAGACTGGTGG - Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092446808 12:8565550-8565572 AACGGATTTGTCAAGTGTGGTGG - Intergenic
1092632366 12:10395735-10395757 AAAGGCAGTGTGTAGTCTGGAGG + Intronic
1096509006 12:52116856-52116878 AACGGCCTATGGAACTCTGGGGG - Intergenic
1097717168 12:62979344-62979366 AAAGACCTTGTGAAGACAGGAGG - Intergenic
1098385129 12:69910385-69910407 AACGGCATTGGGCAGTCGGGAGG + Intronic
1104292911 12:127485584-127485606 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1104342387 12:127962920-127962942 AAAGTCCTTGTGGAGGCTGGTGG - Intergenic
1106953272 13:34907928-34907950 AAAGGGCTTGTGTAGTCTAGAGG - Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1116328446 14:43565111-43565133 TATGGACTTGTGAAGTCTGCAGG + Intergenic
1119662755 14:76463328-76463350 AAAGGCAGTGTAAAGTCTGGTGG + Intronic
1121204978 14:92156771-92156793 AAGAGACTTGTGAAGTATGGTGG + Intronic
1128213590 15:65918671-65918693 GAGGGCCTTGTGAACTCAGGAGG - Intronic
1128771861 15:70288972-70288994 AAAGGGGTTCTGAAGTCTGGAGG - Intergenic
1129935028 15:79440217-79440239 AACAGCCTTGTAAAATATGGGGG - Intronic
1138319629 16:56101071-56101093 AAAAGTTTTGTGAAGTCTGGAGG - Intergenic
1143769077 17:9156434-9156456 CTGGGCCATGTGAAGTCTGGGGG + Intronic
1147338848 17:39742201-39742223 AACCGCCGTGTGAGGTCAGGAGG + Intronic
1156370867 18:36470164-36470186 CATACCCTTGTGAAGTCTGGAGG + Intronic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1167649427 19:50721324-50721346 AAAGGCCTTGTAAAGTGTGCAGG - Intergenic
927261611 2:21097237-21097259 AGTGGACTTGTGGAGTCTGGGGG + Intergenic
929714442 2:44296132-44296154 AATGGGCTAGAGAAGTCTGGTGG - Intronic
930327121 2:49933925-49933947 AGAGGCCTTGTGAATTCAGGTGG + Intronic
930518552 2:52435521-52435543 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
932090530 2:68801997-68802019 AATGACTTTGTGAATTCTGGTGG + Intronic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
937862342 2:126720861-126720883 CACAGCCTGGGGAAGTCTGGAGG + Intergenic
937871300 2:126788161-126788183 AACAGCCTGGTGAGGGCTGGTGG + Intergenic
937972377 2:127560590-127560612 ACAGGCCTTGAGAAGCCTGGCGG + Intronic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
941908161 2:170737013-170737035 AATGGCCTTGAGAAGTTTGTTGG - Intergenic
946669173 2:222084488-222084510 AGCTGGATTGTGAAGTCTGGAGG + Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1174373833 20:50112670-50112692 AGGGGCCTTGGGATGTCTGGAGG - Intronic
1176215349 20:63945180-63945202 AGAGGCCTTGTGGAGGCTGGGGG + Intronic
1176387709 21:6147232-6147254 AATGGCCTTGTGAGGACTGGAGG + Intergenic
1178100033 21:29258154-29258176 AACGTCCTTATGAAGTATGAAGG + Intronic
1179735763 21:43391016-43391038 AATGGCCTTGTGAGGACTGGAGG - Intergenic
1181277043 22:21693881-21693903 AGCGGCTGTGTGAAGCCTGGGGG + Intronic
1185029209 22:48432766-48432788 AAGGGCCTGGTGAGGGCTGGAGG - Intergenic
949158118 3:851155-851177 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
950371404 3:12533941-12533963 AGCAGCCTTGTGAATTCAGGAGG + Intronic
950515404 3:13461736-13461758 ACCGGCGCTGGGAAGTCTGGGGG - Intergenic
950935599 3:16835780-16835802 AACAGCCGTGTGAGGCCTGGTGG - Intronic
953038985 3:39238056-39238078 GAAGTCCTTGTGAAGGCTGGTGG + Intergenic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
960090873 3:113636926-113636948 AACAGCCCTGTGAAGTATGCAGG + Intergenic
960789113 3:121407312-121407334 AACCGCCATATGAAGTTTGGAGG + Exonic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
973858019 4:55032940-55032962 AAGGGACCTGTGAAGGCTGGAGG - Intergenic
977275676 4:94975032-94975054 TTCGTCCTTGTGAAGTCTGTTGG - Intronic
981552066 4:145952049-145952071 AAGGACCTTGAGAGGTCTGGGGG + Intergenic
983851393 4:172585118-172585140 AACAGTCTAATGAAGTCTGGTGG + Intronic
984877518 4:184382627-184382649 AACGTCGTTGGGAAGGCTGGAGG - Intergenic
994195613 5:96919888-96919910 ATGGGCCTTGTGAAGAATGGGGG - Intronic
1002015041 5:176314426-176314448 AACAACCTTGTGAAATCTAGGGG + Intronic
1012611689 6:101227133-101227155 AAAGGCCTGTTGAACTCTGGGGG - Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1021663182 7:22942524-22942546 AACGGCCTGGAGTATTCTGGTGG - Exonic
1024513170 7:50218982-50219004 AAGGGCCTTGTGAGGGCTGTAGG + Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1032170776 7:129582843-129582865 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1034550494 7:151817516-151817538 GACAGCCTTGGGAAGCCTGGGGG - Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036262044 8:7248817-7248839 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036314083 8:7707356-7707378 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1036906000 8:12708907-12708929 AAAGGCCTGCTGAACTCTGGGGG - Intergenic
1036942524 8:13065270-13065292 AAGGGGTTTGTCAAGTCTGGAGG + Intergenic
1037880906 8:22572957-22572979 AGAGGCCATGTGAAGCCTGGTGG - Intronic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039920416 8:41890033-41890055 AATGGTATTGTGAAGTCTTGAGG - Intronic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1048518430 8:135131895-135131917 GAAGGCCTTGTGTAGTTTGGGGG - Intergenic
1049431690 8:142568292-142568314 GACGGCCTTGTGAGGACTCGGGG + Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1060401871 9:123354200-123354222 AAGTGTCTTGTGAGGTCTGGAGG - Intergenic
1061718252 9:132534741-132534763 AACCTCCTTGTGCAGTTTGGAGG - Intronic
1061734583 9:132645238-132645260 AACGGCCTAGTTAAGAGTGGAGG + Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1062433249 9:136535246-136535268 AGGGGCCTTGTGAACCCTGGGGG - Intronic
1189504789 X:41601587-41601609 AATGGCCCTGTGAAATCTAGTGG + Intronic
1198895326 X:141448165-141448187 AACTGCTTTGTGCAGTGTGGTGG + Intergenic