ID: 1089306234

View in Genome Browser
Species Human (GRCh38)
Location 11:117528041-117528063
Sequence TTGCAGGCAACCAGTAGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089306223_1089306234 30 Left 1089306223 11:117527988-117528010 CCCCACCTGCCCTGGTGGAGGTG 0: 1
1: 0
2: 3
3: 38
4: 344
Right 1089306234 11:117528041-117528063 TTGCAGGCAACCAGTAGTATAGG 0: 1
1: 0
2: 0
3: 5
4: 67
1089306225_1089306234 28 Left 1089306225 11:117527990-117528012 CCACCTGCCCTGGTGGAGGTGAT 0: 1
1: 0
2: 4
3: 28
4: 335
Right 1089306234 11:117528041-117528063 TTGCAGGCAACCAGTAGTATAGG 0: 1
1: 0
2: 0
3: 5
4: 67
1089306230_1089306234 -2 Left 1089306230 11:117528020-117528042 CCTCCAGACTTCACAAGGCCGTT 0: 1
1: 0
2: 0
3: 5
4: 125
Right 1089306234 11:117528041-117528063 TTGCAGGCAACCAGTAGTATAGG 0: 1
1: 0
2: 0
3: 5
4: 67
1089306227_1089306234 21 Left 1089306227 11:117527997-117528019 CCCTGGTGGAGGTGATAACATTG 0: 1
1: 0
2: 3
3: 11
4: 159
Right 1089306234 11:117528041-117528063 TTGCAGGCAACCAGTAGTATAGG 0: 1
1: 0
2: 0
3: 5
4: 67
1089306224_1089306234 29 Left 1089306224 11:117527989-117528011 CCCACCTGCCCTGGTGGAGGTGA 0: 1
1: 0
2: 2
3: 31
4: 225
Right 1089306234 11:117528041-117528063 TTGCAGGCAACCAGTAGTATAGG 0: 1
1: 0
2: 0
3: 5
4: 67
1089306231_1089306234 -5 Left 1089306231 11:117528023-117528045 CCAGACTTCACAAGGCCGTTGCA 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1089306234 11:117528041-117528063 TTGCAGGCAACCAGTAGTATAGG 0: 1
1: 0
2: 0
3: 5
4: 67
1089306228_1089306234 20 Left 1089306228 11:117527998-117528020 CCTGGTGGAGGTGATAACATTGC 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1089306234 11:117528041-117528063 TTGCAGGCAACCAGTAGTATAGG 0: 1
1: 0
2: 0
3: 5
4: 67
1089306226_1089306234 25 Left 1089306226 11:117527993-117528015 CCTGCCCTGGTGGAGGTGATAAC 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1089306234 11:117528041-117528063 TTGCAGGCAACCAGTAGTATAGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089306234 Original CRISPR TTGCAGGCAACCAGTAGTAT AGG Intronic
905983243 1:42251409-42251431 TTGCAGGCAACAAATTCTATAGG - Intronic
915952223 1:160197169-160197191 ATGAAGGGAGCCAGTAGTATGGG - Intronic
924314900 1:242785506-242785528 TTGCAGGCACATAGTAGGATGGG - Intergenic
1066222152 10:33345486-33345508 TTCAAGGCCTCCAGTAGTATTGG - Intergenic
1067346321 10:45441442-45441464 TTCCAGGCAACAAGTAGGGTAGG - Intronic
1071135366 10:82447279-82447301 GTGCAGGCAACCAGCAGTCGGGG + Intronic
1074345438 10:112680900-112680922 TTGCAGGCAAACAGTGGTGATGG + Intronic
1079524051 11:21363183-21363205 GGGCAGGCAACCAGTGGAATTGG - Intronic
1079944437 11:26724380-26724402 TTGCATGCAACAAGTTGTAATGG + Intergenic
1083195517 11:61083551-61083573 TTGCAGGGAACTTGTAGTCTGGG - Intergenic
1085821479 11:79798411-79798433 TTGCAAGCATCCAGTAATATGGG - Intergenic
1086971587 11:93086497-93086519 TTACATGCAACCAGAAGTGTTGG + Intergenic
1089306234 11:117528041-117528063 TTGCAGGCAACCAGTAGTATAGG + Intronic
1090566843 11:128003588-128003610 TTGAAGGAAACCAGGAGTAAGGG - Intergenic
1091277868 11:134364530-134364552 TTGCAGGCACACAGTGGCATGGG - Intronic
1091721644 12:2818294-2818316 TTGCAGGCAGCCAGGAGAGTAGG + Intronic
1092950624 12:13499764-13499786 TTCCATGCCACCAGTATTATTGG - Intergenic
1100102723 12:91128451-91128473 TTGAGGGCAAGCAGTAGTATTGG + Intergenic
1107626148 13:42287227-42287249 TTGCAGGCATCCTGTAGATTTGG - Intronic
1110684699 13:78358359-78358381 GTGCAGGCAATCAGGAGCATGGG + Intergenic
1111109175 13:83685025-83685047 TTTCAGGGATCCAGTAATATGGG + Intergenic
1111324847 13:86681161-86681183 ATGTAGGCAACCAGTATCATTGG - Intergenic
1112316411 13:98366418-98366440 TGGCAGGCAACGACTAGTGTTGG + Intronic
1113233966 13:108248486-108248508 TTGAAGGACACCAGTACTATGGG + Intergenic
1116802809 14:49460773-49460795 TTGCAGGCAATCTGTAGTTCAGG - Intergenic
1118743778 14:68759631-68759653 TTCCAGGCAACTAGTGGTTTGGG - Intergenic
1119334413 14:73820624-73820646 TTCCAGGCAACCTATAGAATTGG + Intergenic
1121057477 14:90871175-90871197 TTGTATGCAACAAGTAGAATGGG - Exonic
1125030114 15:35067683-35067705 TTGCAGGCAGTCTGTAGTCTAGG - Intergenic
1129444209 15:75605197-75605219 TTGAATGCATCCAGTAGAATCGG + Exonic
1130749277 15:86692632-86692654 TTGGAGGGAACAGGTAGTATTGG + Intronic
1140822263 16:78673581-78673603 TGGCAGGCACCCATTAGTGTTGG + Intronic
1143636749 17:8168621-8168643 GTGCAGGCAACCGGGAGTATTGG - Intergenic
1146337955 17:31991405-31991427 TTGCAAGTAAACTGTAGTATGGG + Intronic
1155182948 18:23363779-23363801 AGGCAGACAACCAGCAGTATGGG + Intronic
1155461452 18:26089630-26089652 TTGCAGGCAACAAGGGGTAGAGG + Intronic
1167108038 19:47442231-47442253 TAGCAGGCAACTAGTAATCTAGG - Intronic
936646345 2:114376784-114376806 TTCTAGGGATCCAGTAGTATGGG - Intergenic
942815932 2:180054174-180054196 TTACAGGCAACCTATAGAATGGG + Intergenic
945271715 2:207947310-207947332 TTGTAGGCAACCAGTAATCTTGG - Intronic
1173124627 20:40325308-40325330 TTGGTGGCAAGCAGTTGTATTGG - Intergenic
1175313879 20:58032091-58032113 GTCCAGACAACCAGTAGGATAGG + Intergenic
1175694361 20:61090299-61090321 ATGGAGCCAACTAGTAGTATTGG - Intergenic
950422472 3:12907035-12907057 TTACTGGCAACCAGTAGTAGAGG + Intronic
959105723 3:102062913-102062935 TGGCAGGCAAGCAGCATTATGGG - Intergenic
961958508 3:130829233-130829255 TACCAGGCAACTAGTAATATAGG + Intergenic
962459171 3:135592757-135592779 GAGCAGGCAACCAATAGAATGGG + Intergenic
973858445 4:55036584-55036606 TTGCAGCCAACCACTAATACAGG - Intergenic
975018539 4:69457291-69457313 TTGCAGACAAAAAATAGTATAGG + Intergenic
975473650 4:74797090-74797112 TTTAAGGCATTCAGTAGTATAGG + Intergenic
983606229 4:169588680-169588702 TTTCAGGTGACAAGTAGTATGGG + Exonic
984253088 4:177358170-177358192 CTGCAGGCAATCAGGAGTAGGGG + Intronic
984531801 4:180924857-180924879 TTGCATGCCATCAGTACTATAGG - Intergenic
984728982 4:183048059-183048081 TTGAAGGCAAAAAGTATTATTGG - Intergenic
998918956 5:147046635-147046657 TTACAGGCAAACAGTAGTCAAGG + Intronic
1000088978 5:157913269-157913291 TGGCAGGCAAACAGTAAAATAGG + Intergenic
1001177085 5:169480575-169480597 GTGCAGACAACCCGTAGTACTGG - Intergenic
1004868333 6:19876468-19876490 TTGCAGCCCCCAAGTAGTATGGG - Intergenic
1007612178 6:43157249-43157271 TTGGAGGCAGCCAGTCATATGGG + Intronic
1007678833 6:43620679-43620701 TTGCAGGGAACCAGGAGGAAAGG - Exonic
1029153979 7:98501976-98501998 TTGCAGGCAATAAATAGTAGAGG + Intergenic
1032735181 7:134686250-134686272 TTGCAGTTAACCAATAGTAATGG + Intergenic
1035063245 7:156085183-156085205 TTAAAGGCAACCTGTAGAATAGG - Intergenic
1050132411 9:2426498-2426520 TTTCAGGCATCCAGTAGCAGAGG - Intergenic
1052474114 9:28936998-28937020 TTGTAGGACACCAGCAGTATTGG + Intergenic
1060238171 9:121880956-121880978 ATGCTGGCAACCAGAAGTAGAGG - Intronic
1195771865 X:108360035-108360057 TTGGAGGCAACCAGATGTTTTGG + Intronic
1198147768 X:133874829-133874851 TGGCAGAGAACCAGAAGTATAGG - Intronic
1198560820 X:137848261-137848283 TTGCAGGCAAGCTGGAATATGGG + Intergenic
1200074905 X:153546082-153546104 TTGTAGGCAAGCAGCAGGATGGG + Exonic
1200953624 Y:8924262-8924284 GTGCAGGAAAGCAGTAGGATTGG + Intergenic
1201058115 Y:10016059-10016081 ATGCAGGAAAGCAGTAGGATTGG - Intergenic
1201482881 Y:14459346-14459368 TGGCAGGCATCCATTAGTGTAGG + Intergenic