ID: 1089306235

View in Genome Browser
Species Human (GRCh38)
Location 11:117528048-117528070
Sequence CAACCAGTAGTATAGGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089306227_1089306235 28 Left 1089306227 11:117527997-117528019 CCCTGGTGGAGGTGATAACATTG 0: 1
1: 0
2: 3
3: 11
4: 159
Right 1089306235 11:117528048-117528070 CAACCAGTAGTATAGGTGTGTGG 0: 1
1: 0
2: 0
3: 7
4: 73
1089306228_1089306235 27 Left 1089306228 11:117527998-117528020 CCTGGTGGAGGTGATAACATTGC 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1089306235 11:117528048-117528070 CAACCAGTAGTATAGGTGTGTGG 0: 1
1: 0
2: 0
3: 7
4: 73
1089306230_1089306235 5 Left 1089306230 11:117528020-117528042 CCTCCAGACTTCACAAGGCCGTT 0: 1
1: 0
2: 0
3: 5
4: 125
Right 1089306235 11:117528048-117528070 CAACCAGTAGTATAGGTGTGTGG 0: 1
1: 0
2: 0
3: 7
4: 73
1089306231_1089306235 2 Left 1089306231 11:117528023-117528045 CCAGACTTCACAAGGCCGTTGCA 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1089306235 11:117528048-117528070 CAACCAGTAGTATAGGTGTGTGG 0: 1
1: 0
2: 0
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089306235 Original CRISPR CAACCAGTAGTATAGGTGTG TGG Intronic
903726108 1:25446346-25446368 CAAACAGATGTATAGGGGTGGGG + Intronic
905823303 1:41010982-41011004 GAACCAGGGGTATGGGTGTGTGG + Intronic
916061553 1:161102244-161102266 CAAACAGTAGGACAGTTGTGTGG - Intronic
917821407 1:178767839-178767861 CTACCAGTAGCAGAGGTGGGTGG + Intronic
918522009 1:185424921-185424943 CAAAGGGTAGCATAGGTGTGAGG + Intergenic
1068532844 10:58209008-58209030 GAAACACTAGTATAGGAGTGAGG - Intronic
1075685523 10:124362737-124362759 CATCCAGGAGCATAGGTGAGAGG + Intergenic
1085875043 11:80396731-80396753 CATCCATTACTCTAGGTGTGGGG - Intergenic
1086088049 11:82976435-82976457 GAAACACTAGTTTAGGTGTGAGG - Exonic
1089204092 11:116744503-116744525 TAATCAGTAGAATAGGTTTGTGG - Intergenic
1089306235 11:117528048-117528070 CAACCAGTAGTATAGGTGTGTGG + Intronic
1092923334 12:13251822-13251844 GAACCAACAGGATAGGTGTGGGG - Intergenic
1095509144 12:42930269-42930291 CAACCAGGAGCACAGGTGGGAGG + Intergenic
1098918402 12:76280396-76280418 CAAACAGTTGTAGAGGTGTAGGG - Intergenic
1098964904 12:76777633-76777655 CAATCAGCAGTATATGAGTGAGG + Intronic
1099745204 12:86693022-86693044 CAATCAGTAGTATAGAGGTTTGG - Intronic
1102246839 12:111361618-111361640 CCACCAGGAGTATGGGGGTGGGG + Exonic
1104641579 12:130470514-130470536 CAACCAGTACTACAGGTGCCAGG - Intronic
1105909100 13:24844196-24844218 TAACCAGTATTATAAGTGTTAGG + Intronic
1107829814 13:44364558-44364580 CTCCCAGTAGTAGTGGTGTGGGG + Intergenic
1112730355 13:102353686-102353708 CAATCAGTAGTCTAAGTGGGAGG - Intronic
1116156118 14:41208442-41208464 CAATCAGTAGTATATGGGCGGGG - Intergenic
1116318669 14:43431543-43431565 CAATCAGTTGTACAGGAGTGTGG + Intergenic
1125625240 15:41103282-41103304 GAAGCAGTAGTCTAGGTGTGAGG - Intronic
1127597464 15:60500518-60500540 CAACCAGTAGTGCATGTTTGGGG - Intronic
1128293856 15:66500241-66500263 CAACCAATAGTATAGGGTTGGGG + Intronic
1130877720 15:88028775-88028797 CAACCAAGAGTATGGGTGTGGGG + Intronic
1140451959 16:75078053-75078075 CAACCAGTTGTATAAAGGTGTGG - Intronic
1140672307 16:77291449-77291471 CAACCTGTGGTTTGGGTGTGAGG - Exonic
1148618390 17:49016565-49016587 CAACAAGTAGTATAGGAAGGAGG + Intronic
1160377038 18:78421311-78421333 GGACCAGTAGCACAGGTGTGGGG - Intergenic
1165428949 19:35761015-35761037 CAACCCGTAGTTGAGGTGTCAGG + Intronic
936449615 2:112624357-112624379 GATCCAGTAGTATTGGGGTGGGG + Intergenic
939698574 2:145359853-145359875 CAACCTATAGTATAGTTGTTTGG + Intergenic
944073936 2:195705250-195705272 CAACCAGTATTAGAGGGCTGAGG - Intronic
944104627 2:196066501-196066523 CAATCTGTAGTATATCTGTGGGG + Intronic
944521195 2:200568953-200568975 CTACCAGTAGAATAGCTGTTGGG - Intronic
947437889 2:230088621-230088643 GAACCAGTAGGATAGCTGTGAGG - Intergenic
1181631809 22:24155637-24155659 CAGGCAGAAGTGTAGGTGTGTGG - Intronic
1183040066 22:35171342-35171364 CACTCAGTAGGAGAGGTGTGCGG - Intergenic
1183958012 22:41394015-41394037 CAACCAGGTGTCTGGGTGTGTGG + Intronic
1184676780 22:46047548-46047570 CATACAGGAGTATAGGTGTGGGG - Intergenic
949865735 3:8545662-8545684 CATCCAGTAGGTGAGGTGTGGGG - Intronic
950208986 3:11103756-11103778 CAACCATTCTTACAGGTGTGAGG + Intergenic
954771282 3:52971576-52971598 CAACCACTACTGTAGGGGTGGGG + Intronic
957830530 3:85511327-85511349 CAAGCACAAGTATAGGTCTGTGG - Intronic
959726462 3:109548326-109548348 GAATGAGTAGTATATGTGTGTGG + Intergenic
965439057 3:168690934-168690956 TAACCAGTGGTAAAGGAGTGAGG + Intergenic
966720222 3:183054940-183054962 CTACCAGCAGCCTAGGTGTGTGG + Intronic
967669457 3:192215371-192215393 CAACCAGCAGTAGTGGTGTGAGG - Intronic
975084967 4:70327850-70327872 CTTCCACTAGTATAGCTGTGAGG - Intergenic
984899946 4:184577327-184577349 CACCGAGCATTATAGGTGTGTGG + Intergenic
992808372 5:80361042-80361064 CTACAAATATTATAGGTGTGAGG + Intergenic
997870932 5:137504616-137504638 CTACCAGTAGCACAGGTTTGAGG - Intronic
998008258 5:138672021-138672043 TAGCCAGTAGCATAGATGTGAGG - Intronic
1005200023 6:23334317-23334339 CAAGCACTCTTATAGGTGTGGGG - Intergenic
1008938067 6:57013855-57013877 CAACCACTACGCTAGGTGTGAGG - Intronic
1014670250 6:124294830-124294852 CAAACAGAAGTTTAGCTGTGGGG - Intronic
1016387341 6:143541506-143541528 AAAAAAGCAGTATAGGTGTGTGG + Intronic
1018007558 6:159637359-159637381 TAGGCAGTAGTTTAGGTGTGTGG + Intergenic
1020476805 7:8605287-8605309 CAACCATTATTATAGGTTTTAGG - Intronic
1021209769 7:17834209-17834231 CAACAATTAATACAGGTGTGTGG + Intronic
1023092551 7:36630542-36630564 CACCCAGGAGTCTAAGTGTGGGG + Intronic
1024386919 7:48762282-48762304 CACTCAGAAGCATAGGTGTGAGG - Intergenic
1028142964 7:87291825-87291847 CTACCAGTGGCAGAGGTGTGGGG - Intergenic
1028982220 7:96979764-96979786 CAACCAGAAGTTCAGGTGTGAGG - Intergenic
1033718332 7:144026706-144026728 GAACCAATAGGATATGTGTGAGG - Intergenic
1037279588 8:17223345-17223367 GAATCTGTAGTCTAGGTGTGTGG - Exonic
1042405156 8:68396512-68396534 TAACCAGGGGTACAGGTGTGGGG - Intronic
1043256723 8:78147994-78148016 CAATCAGCAGGATATGTGTGGGG + Intergenic
1045000166 8:97871418-97871440 CAAGCAGTAGGAGAGGTGAGTGG + Intronic
1047989288 8:130268815-130268837 CAAACAGTAGTATAATTTTGTGG - Intronic
1057273463 9:93663969-93663991 CCACCTGTAGTGTGGGTGTGAGG + Intronic
1059413502 9:114149112-114149134 CTCCCTGTTGTATAGGTGTGTGG + Intergenic
1059705183 9:116816289-116816311 GAACCAGTCTTATAGGTGAGAGG - Intronic
1059959130 9:119547864-119547886 CAGCCAGTTGTATAACTGTGGGG - Intergenic
1061489466 9:130937278-130937300 GAAGCAGTGGGATAGGTGTGTGG + Intronic
1062037085 9:134387154-134387176 CCACCAGCAGGATGGGTGTGGGG - Intronic
1194616219 X:96106855-96106877 CTACCATTAGTATAGATGTAGGG + Intergenic
1194984154 X:100471907-100471929 CAACAATTACTATAGGTGTTGGG - Intergenic
1196687514 X:118524687-118524709 CAACCATCAGAACAGGTGTGAGG - Intronic