ID: 1089307326

View in Genome Browser
Species Human (GRCh38)
Location 11:117534867-117534889
Sequence CTGGCATCCCAGCTCTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12733
Summary {0: 1, 1: 1, 2: 120, 3: 4207, 4: 8404}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089307326 Original CRISPR CTGGCATCCCAGCTCTTTGG AGG (reversed) Intronic
Too many off-targets to display for this crispr