ID: 1089308020

View in Genome Browser
Species Human (GRCh38)
Location 11:117538830-117538852
Sequence GTTTGGGGGAGGATCTGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089308020 Original CRISPR GTTTGGGGGAGGATCTGAAC TGG Intronic
901464096 1:9409778-9409800 GTTTGGAGCTGGACCTGAACAGG - Intergenic
905963778 1:42070629-42070651 GTTTGGGGCCAGTTCTGAACTGG - Intergenic
913075423 1:115337689-115337711 GGTAGGGGGAGGAGCGGAACGGG - Intronic
915004269 1:152622344-152622366 GTTTTCGGAAGGATCTGAACGGG + Intergenic
915758624 1:158288171-158288193 GATTTGGGTAGGATTTGAACTGG + Intergenic
916424895 1:164670823-164670845 ATTGGGGGGAGGATCAGAAGGGG + Intronic
917329555 1:173868062-173868084 GTTAGGGGGAGGAGCCGAAGCGG - Intronic
920124243 1:203680998-203681020 GCTTGGAGGAGAAGCTGAACTGG + Intronic
1063970345 10:11377290-11377312 GTGTGGGGGAGGATGGAAACCGG + Intergenic
1064887513 10:20127447-20127469 TTTTGGGCAAGGATCTGAAAGGG + Intronic
1065401298 10:25305020-25305042 GGGTGTGGGAGTATCTGAACAGG - Intronic
1065458703 10:25934179-25934201 GTCGGCGGGAGGATCTGACCTGG - Intergenic
1068326058 10:55488449-55488471 CTTTGGCAGAGGAACTGAACTGG + Intronic
1073155323 10:101341873-101341895 GTTTGGGGGTGGATGAGAGCTGG - Intergenic
1074386472 10:113020444-113020466 GTTAGGAGGAGGGTGTGAACAGG - Intronic
1074835412 10:117287660-117287682 GTTATCAGGAGGATCTGAACAGG - Intronic
1076186198 10:128451347-128451369 GTGTGGGGGAGGGTCTGTTCTGG + Intergenic
1079798173 11:24833845-24833867 GTTTGGGGAAGGAAGTGAGCTGG - Intronic
1080051915 11:27866755-27866777 GTTTTGAGGAGAATATGAACAGG - Intergenic
1080222015 11:29916943-29916965 ATTTGGAGGAGGATATGAGCTGG + Intergenic
1080756796 11:35208159-35208181 GTTTGGTGGAAGATTTGGACAGG + Exonic
1082677578 11:56126415-56126437 GTTTGAAAGAGGATGTGAACAGG - Intergenic
1084946514 11:72641767-72641789 GTTTGGGTGGGAATCTGAGCGGG + Intronic
1085629671 11:78103766-78103788 GTTTGGGGGAGTATTTGAGGAGG - Intronic
1089308020 11:117538830-117538852 GTTTGGGGGAGGATCTGAACTGG + Intronic
1089598812 11:119600367-119600389 GTTGCGGGGAGGATGGGAACAGG + Intergenic
1090012338 11:123056400-123056422 GTTTGGGTGAGAATCTTACCTGG - Intergenic
1090518602 11:127455013-127455035 TTTTGCGGCAGGATCTGAAGGGG + Intergenic
1092794714 12:12098809-12098831 GTTTGGGGGAGGGTTTGGAGAGG - Intronic
1097053647 12:56237920-56237942 GGTTGGGGGAGGATGTGAGTAGG + Exonic
1097550662 12:61064106-61064128 GTTTGGGGGAGGAAATATACAGG - Intergenic
1106510082 13:30405616-30405638 GTTTGGGAGAGGCTTTGCACTGG - Intergenic
1107749480 13:43548997-43549019 GTTTGTGGGAGGATCAGAAAGGG - Intronic
1113568870 13:111339293-111339315 GTTTAGGGGAGGAATTGACCTGG + Intronic
1114073036 14:19130638-19130660 GGTTGGTGGAGAATTTGAACTGG + Intergenic
1114089231 14:19269356-19269378 GGTTGGTGGAGAATTTGAACTGG - Intergenic
1118964167 14:70563951-70563973 GTTTGGGGGAGGGACTGATGTGG - Intergenic
1121343619 14:93119314-93119336 GTTTGGGGGAGGCTGTAATCAGG - Intergenic
1121640087 14:95479518-95479540 GGTTGGGGGAGCATAGGAACTGG + Intergenic
1127107361 15:55630800-55630822 GTTTGTGGGTGGATATGCACAGG + Intronic
1127621151 15:60736086-60736108 GTCTAGGGGAGGGGCTGAACAGG + Intronic
1128078923 15:64844755-64844777 GTTTGGGGAGGGCTCTGAGCAGG - Intronic
1128749533 15:70139178-70139200 GTTTGGAGGAGGATTTGATCTGG - Intergenic
1128961187 15:72006532-72006554 TTTAGGGGGAGGGACTGAACAGG + Intronic
1131487357 15:92832620-92832642 TTTTTGAGGAGGATGTGAACAGG - Intergenic
1137725266 16:50652621-50652643 GTTGGGGGGATGATGTGGACAGG - Intergenic
1140045747 16:71439481-71439503 ATTTGGGGGTGGTTCTGAGCTGG + Intergenic
1144841219 17:18187197-18187219 GTTTAGGGGAGGAAATGAACTGG + Intronic
1146127384 17:30239645-30239667 GTTTGGGGGAGGAACAGATCAGG + Intergenic
1146895289 17:36536298-36536320 GGTTTGGAGAGGCTCTGAACTGG + Intronic
1147299436 17:39513066-39513088 GTTTGGGGCAGGAAATGAACAGG - Intronic
1148716957 17:49722772-49722794 GTTTGCTGGAGGACATGAACTGG - Intronic
1150717058 17:67581133-67581155 ATTTTGGGGATGATTTGAACTGG - Intronic
1152860963 17:82697136-82697158 GTTTGGGGGAGCAGCTGAGATGG - Intronic
1155976071 18:32132984-32133006 GTTTGGTGGAGGATATGGAGAGG + Intronic
1156149940 18:34228898-34228920 GTTTGGGGGAGGAACAGATTGGG + Intergenic
1159270101 18:66138130-66138152 ATTTGGGGCAGGATTTGAAGGGG - Intergenic
1160360694 18:78274336-78274358 GTTTGGGGGAGAATGTATACGGG - Intergenic
1162151240 19:8647061-8647083 GTTTGGGTGAGGATCAGAGGAGG + Intergenic
1162371588 19:10283372-10283394 GTTTGGGGGAGATACTGAAGAGG + Intronic
1163814010 19:19452804-19452826 CTCTGGGGCAGGATCTGGACAGG - Intronic
1166356188 19:42228984-42229006 GGTTGGGGGAGGGTCGTAACTGG + Intergenic
1168573406 19:57488711-57488733 GTTTGGGGAGGGATCTGGGCTGG + Intronic
927725469 2:25418976-25418998 GTCTGGAGTAGGTTCTGAACAGG + Intronic
929187458 2:39110206-39110228 GTATGTGGGAGGATGTGCACAGG - Intronic
929667951 2:43848233-43848255 GCTTGGGGGAGCCTCTGAACTGG - Intronic
932989368 2:76767088-76767110 GTTAAGGGGAGGATCTGCAAAGG - Intronic
935079974 2:99783244-99783266 GTTTGGAGGAGGATATTAAAGGG - Intronic
935797516 2:106659141-106659163 GTTTGGAGGAGGATCTGCAATGG - Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
946302123 2:218830384-218830406 GTTTGGGGGAGGAGGGGAAGAGG + Intronic
1169466094 20:5840587-5840609 GTTTGGAGCAACATCTGAACCGG + Intronic
1171379043 20:24719195-24719217 GATTGGTGGAGGATCTGAATGGG - Intergenic
1172148898 20:32776939-32776961 GGGTGGGGGAGGAACTGAGCTGG + Intronic
1173551180 20:43934080-43934102 GATGGGGGGAGGGTCTGCACAGG + Intronic
1174749898 20:53101285-53101307 ATTTTGGTGACGATCTGAACAGG - Intronic
1179404158 21:41111676-41111698 GTTTGGGAGATTATCAGAACAGG + Intergenic
1180037014 21:45255355-45255377 ATTTGGGGCAGGGTGTGAACGGG + Intergenic
1180491476 22:15852992-15853014 GGTTGGTGGAGAATTTGAACTGG + Intergenic
1184769511 22:46589261-46589283 GTTTGGGGGCGGCTCTGATATGG + Intronic
1184825915 22:46950727-46950749 GTGTGGAGGAGAATCTGAAGAGG + Intronic
1185229415 22:49671554-49671576 GCTTGGGGGGGCATCTGATCTGG - Intergenic
949261619 3:2108085-2108107 GCCTGGGGGAGGATAGGAACAGG - Intronic
953856403 3:46502726-46502748 GCTTGGGGCATGACCTGAACCGG + Intergenic
954587794 3:51751725-51751747 ATTTGTGTGAGGAACTGAACTGG - Intergenic
958433717 3:94072493-94072515 GTATGGTGGAGGATGTGAACCGG + Intronic
960486339 3:118257988-118258010 GTTGGGGGGAGGATGTGCAGAGG + Intergenic
961249427 3:125487811-125487833 GGTTGAGGGAGGAGATGAACAGG + Intronic
967479504 3:189957479-189957501 GTTTGGGGGAGGAGGTGAACTGG + Exonic
977178648 4:93845764-93845786 GGTTGGGGGAGGATGAGAAGGGG + Intergenic
979168723 4:117571813-117571835 GTTTGCTGCAAGATCTGAACTGG + Intergenic
987708446 5:21482844-21482866 GTTTGAGGCAGGATCTGGTCCGG + Intergenic
988751164 5:34191301-34191323 GTTTGAGGCAGGATCTGGTCCGG - Intergenic
988751510 5:34192927-34192949 GTTTGAGGCAGGATCTGGTCCGG - Intergenic
991413816 5:66370994-66371016 GGTGGTGGGAGGCTCTGAACTGG - Intergenic
991736472 5:69634032-69634054 GTTTGAGGCAGGATCTGGTCCGG - Intergenic
991736652 5:69634854-69634876 GTTTGAGGCAGGATCTGGTCCGG - Intergenic
991758239 5:69899473-69899495 GTTTGAGGCAGGATCTGGTCCGG + Intergenic
991758413 5:69900289-69900311 GTTTGAGGCAGGATCTGGTCCGG + Intergenic
991758591 5:69901111-69901133 GTTTGAGGCAGGATCTGGTCCGG + Intergenic
991758761 5:69901918-69901940 GTTTGAGGCAGGATCTGGTCCGG + Intergenic
991812973 5:70489671-70489693 GTTTGAGGCAGGATCTGGTCCGG - Intergenic
991815927 5:70510148-70510170 GTTTGAGGCAGGATCTGGTCCGG - Intergenic
991837642 5:70775355-70775377 GTTTGAGGCAGGATCTGGTCCGG + Intergenic
991837820 5:70776177-70776199 GTTTGAGGCAGGATCTGGTCCGG + Intergenic
991837990 5:70776984-70777006 GTTTGAGGCAGGATCTGGTCCGG + Intergenic
997965686 5:138353695-138353717 GGTTGGGGGAGTAGCTGAGCTGG - Intronic
999420443 5:151437186-151437208 GTTTAGGGGAGGCTCTGAGTTGG + Intronic
999860746 5:155643057-155643079 GTTTAGGGGAGGAGCTACACTGG + Intergenic
1003136570 6:3439061-3439083 ATTTGGGGCCGGATCTGACCGGG + Intronic
1003965872 6:11251625-11251647 GTGAGGGGGAGGAACTGGACTGG - Intronic
1007096130 6:39214398-39214420 GCTTGGGGGAGAATCTGGCCCGG + Intronic
1022326834 7:29340344-29340366 TTTTGGGGGAAGATCTCATCAGG + Intronic
1026366554 7:69654365-69654387 GTCTGGGGCAGGATATGAAAGGG - Intronic
1027051770 7:75025365-75025387 TTGTGGGGGAGGGTCTGGACAGG - Intergenic
1030293550 7:107896294-107896316 GTTTGGAGGTGGATCTGAGAAGG + Intronic
1032257929 7:130311791-130311813 GTTTGGGGGAGGAGATGAGGAGG - Intronic
1037804444 8:22051169-22051191 ATTTAGGGGAGGATGTGACCAGG + Intronic
1038159042 8:25019309-25019331 GATTGGGGGAGAACCTGAAACGG + Intergenic
1038257037 8:25959593-25959615 GTTTGGGGGAGGTTTTGATTTGG + Intronic
1038689654 8:29749719-29749741 GTTGGGGAGATGATCAGAACAGG + Intergenic
1041044847 8:53879924-53879946 GTTTGGGGGAGGCTCGGAGTAGG - Intronic
1041522426 8:58771028-58771050 CTCTGGGGGAGGATCTGCAGAGG + Intergenic
1041522440 8:58771079-58771101 TTCTGGGGGAGGATCTGCAGAGG + Intergenic
1041522515 8:58771385-58771407 CTCTGGGGGAGGATCTGCAGAGG + Intergenic
1042334889 8:67619833-67619855 GGTTGGGTTAGGGTCTGAACAGG - Intronic
1044525863 8:93250610-93250632 ATTTGGGGGATGATCTGACATGG - Intergenic
1047842346 8:128766848-128766870 GTCTGGGGGAAGGTCTGAGCAGG + Intergenic
1049675190 8:143886080-143886102 GGTGGGGGGAGGGTCTGCACTGG - Intergenic
1052688887 9:31789803-31789825 GTTTGGGACAAGGTCTGAACAGG + Intergenic
1053466210 9:38310630-38310652 GTATAGGGGAGGATGTGTACAGG + Intergenic
1055048636 9:71957196-71957218 ATTTGGGGCAGGATGTGAAGGGG - Intronic
1055784827 9:79861740-79861762 GCTTGGGGGTGGGTCTGAACTGG + Intergenic
1057195411 9:93113609-93113631 GCTTGGGGGAGGAGCTGACAAGG - Intergenic
1059080174 9:111240867-111240889 GGTTGGGGGATCACCTGAACTGG - Intergenic
1059930930 9:119259979-119260001 ATTTGGGGGAGGCTCTGAGATGG - Intronic
1186265217 X:7825164-7825186 GCTTGGGTGAGAATCGGAACAGG + Intergenic
1188128836 X:26405183-26405205 GTTTGAGGGAGGATCGAAAGTGG - Intergenic
1188742375 X:33801137-33801159 GCTTGGGGCAAGATCTGAGCAGG - Intergenic
1195321050 X:103722344-103722366 GGTAGGGGTAGGATCAGAACAGG + Intronic
1195528080 X:105917410-105917432 GTTTGGGGGAGAATGGAAACTGG + Intronic
1197438913 X:126465869-126465891 GTTGGGGGGAGGATCATTACTGG + Intergenic
1199411920 X:147534211-147534233 GTTTGGGAGGGGATATGGACAGG - Intergenic
1200036857 X:153336540-153336562 TTTTGGGGGATGTACTGAACTGG - Intronic
1200391540 X:155951105-155951127 GTTGGGGGCAGGATTTGAATTGG + Intergenic