ID: 1089309158

View in Genome Browser
Species Human (GRCh38)
Location 11:117546536-117546558
Sequence GACTGGTCTTTTAAGTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089309145_1089309158 27 Left 1089309145 11:117546486-117546508 CCAAGTCCAGGGCTCTGCCAGCC 0: 1
1: 0
2: 7
3: 57
4: 473
Right 1089309158 11:117546536-117546558 GACTGGTCTTTTAAGTAGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 105
1089309147_1089309158 10 Left 1089309147 11:117546503-117546525 CCAGCCATTCCCACCAACTCCTA 0: 1
1: 0
2: 1
3: 31
4: 254
Right 1089309158 11:117546536-117546558 GACTGGTCTTTTAAGTAGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 105
1089309149_1089309158 1 Left 1089309149 11:117546512-117546534 CCCACCAACTCCTAACTGCCCAC 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1089309158 11:117546536-117546558 GACTGGTCTTTTAAGTAGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 105
1089309151_1089309158 -3 Left 1089309151 11:117546516-117546538 CCAACTCCTAACTGCCCACAGAC 0: 1
1: 0
2: 1
3: 67
4: 574
Right 1089309158 11:117546536-117546558 GACTGGTCTTTTAAGTAGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 105
1089309153_1089309158 -9 Left 1089309153 11:117546522-117546544 CCTAACTGCCCACAGACTGGTCT 0: 1
1: 0
2: 3
3: 41
4: 369
Right 1089309158 11:117546536-117546558 GACTGGTCTTTTAAGTAGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 105
1089309150_1089309158 0 Left 1089309150 11:117546513-117546535 CCACCAACTCCTAACTGCCCACA 0: 1
1: 0
2: 2
3: 26
4: 276
Right 1089309158 11:117546536-117546558 GACTGGTCTTTTAAGTAGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 105
1089309148_1089309158 6 Left 1089309148 11:117546507-117546529 CCATTCCCACCAACTCCTAACTG 0: 1
1: 0
2: 1
3: 25
4: 348
Right 1089309158 11:117546536-117546558 GACTGGTCTTTTAAGTAGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 105
1089309146_1089309158 21 Left 1089309146 11:117546492-117546514 CCAGGGCTCTGCCAGCCATTCCC 0: 1
1: 0
2: 6
3: 53
4: 428
Right 1089309158 11:117546536-117546558 GACTGGTCTTTTAAGTAGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089309158 Original CRISPR GACTGGTCTTTTAAGTAGGT GGG Intronic
903646413 1:24898760-24898782 GAGTGGTTTTTGAAGTCGGTGGG + Intergenic
904875784 1:33653567-33653589 GACAGGTCTCTCAAGCAGGTGGG + Intronic
908702384 1:66916139-66916161 GACTGGTTGTTTAAGAAGGAGGG + Intronic
911656593 1:100450819-100450841 GACTGCTCTCTTAAGAAGTTTGG - Intronic
912850244 1:113117813-113117835 GTCTGTTCTTTGAAGTATGTGGG + Intronic
916629759 1:166599577-166599599 AACTGGTAATTTAAATAGGTGGG + Intergenic
919986052 1:202676047-202676069 GACTGGCCTTTGAAGTGAGTTGG - Intronic
922600764 1:226850884-226850906 GACTGGTTGTTTAAGAAGGAGGG + Intergenic
923349261 1:233087668-233087690 GACTGATCTTTTCAGCAGATGGG + Intronic
1064887559 10:20127853-20127875 GACTGTTATTTTCATTAGGTTGG + Intronic
1067512410 10:46906874-46906896 GAATGGTCTTGTAAGTAGCTGGG + Intergenic
1067649834 10:48144948-48144970 GAATGGTCTTGTAAGTAGCTGGG - Intergenic
1068457047 10:57269601-57269623 CACTGATCTTTAAAGAAGGTTGG - Intergenic
1069544705 10:69319687-69319709 GACTGGTCATTTGAGTTGGGTGG + Intronic
1072417223 10:95259339-95259361 TACTTGTTTTTTATGTAGGTGGG + Intronic
1073009510 10:100348390-100348412 CACTGCTCTTTTAATAAGGTAGG + Intronic
1074801617 10:117005721-117005743 GCATGGTCATTTAAGTAGCTGGG - Intronic
1077344121 11:2038572-2038594 GACTGGCCTTTTGAGAAGGGAGG - Intergenic
1078564057 11:12398396-12398418 GCCTGGTCTTTTGAATAGGCTGG + Intronic
1079260773 11:18878145-18878167 GAGTGGTGTTTTAAGGAGATAGG + Intergenic
1089309158 11:117546536-117546558 GACTGGTCTTTTAAGTAGGTGGG + Intronic
1202827107 11_KI270721v1_random:93761-93783 GACTGGCCTTTTGAGAAGGGAGG - Intergenic
1095266457 12:40164273-40164295 GACTGGTTATTTAAGAAGGAGGG - Intergenic
1098247913 12:68539345-68539367 GACTGCTCTTTTATGTAACTTGG - Intergenic
1101259053 12:103010576-103010598 TACTGGTATTTTCAGGAGGTAGG + Intergenic
1102611791 12:114118838-114118860 CACTGGTCTTTTGAGTGGCTTGG - Intergenic
1102731191 12:115111762-115111784 GAATGGTCTATAAAGTGGGTAGG + Intergenic
1110121086 13:71882625-71882647 GACAGGGCTTTTAAAGAGGTAGG - Intergenic
1112229026 13:97569127-97569149 GCCTGGTGTTTTAAGCAGGAAGG - Intergenic
1112447618 13:99479377-99479399 GACTGGTTGTTTAAGAAGGAGGG + Intergenic
1112819604 13:103316145-103316167 GTCTGAACTTTTGAGTAGGTTGG + Intergenic
1115339520 14:32277769-32277791 GACTGTGATTTTAAATAGGTTGG - Intergenic
1115992104 14:39160735-39160757 GGTTGGTCTCCTAAGTAGGTTGG - Intronic
1116261000 14:42626373-42626395 GACAGGATTTTTAAGTAGTTGGG + Intergenic
1117106860 14:52406264-52406286 GACTGGTCCTCAAAATAGGTAGG - Intergenic
1117187677 14:53257826-53257848 GACTGGTTGTTTAAGAAGGAGGG - Intergenic
1117485008 14:56187438-56187460 GGCTTGACTTTTAAGTAGTTTGG + Intronic
1118631710 14:67710491-67710513 GACTGGTTATTTAAGAAGGAGGG - Intronic
1119829902 14:77692732-77692754 GAATGGTCACTTAAGTAGCTAGG - Intronic
1120667830 14:87328103-87328125 GACTTGGCTTTTAAGAAGTTTGG + Intergenic
1127342243 15:58059574-58059596 TTCTGGTATTTTAAGTAGTTAGG - Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131336399 15:91553463-91553485 AGCTGTTCTTTTGAGTAGGTGGG + Intergenic
1140711630 16:77683792-77683814 GAGTGGTCTTGGAAGGAGGTGGG - Intergenic
1143298550 17:5890754-5890776 GACTGTCCTTTTAATTAGCTTGG + Intronic
1145227095 17:21138527-21138549 GACTGGTTGTTTAAGAAGGAGGG - Intronic
1149186417 17:54002993-54003015 GGTTTGTCTTTTAAGTTGGTGGG + Intergenic
1149221391 17:54418505-54418527 GACTGGCCTTTTAAGTTGCATGG + Intergenic
1149893517 17:60410961-60410983 GGCTGGTCTCCTAAGTAGCTGGG - Intronic
1152792762 17:82290993-82291015 GAGGGGTCTTTTCAGTAGTTGGG + Intergenic
1157365110 18:47057744-47057766 GAGAGGTATTTTAAGTAGGCAGG + Intronic
1165190924 19:34062811-34062833 GCCTGGACTTCTAAGTAGCTGGG - Intergenic
927589472 2:24340888-24340910 GACTGGTCTTTTAAGAGGAGAGG + Intronic
937190598 2:120093762-120093784 GTCTGGTTTTTTATGTAGGGTGG + Intronic
941237799 2:162996613-162996635 GATAGGACTTTTAAGGAGGTAGG + Intergenic
942495012 2:176531048-176531070 GACTTGTCTCATAAGTAGGATGG - Intergenic
945474353 2:210263930-210263952 GACAGGTCTGGTAAGTGGGTTGG + Intergenic
947514855 2:230794079-230794101 GTCTGTTCTATTAAGTTGGTGGG + Intronic
1170511109 20:17077577-17077599 GAGTGTGCTTTTAAGTAGGACGG - Intergenic
1172735190 20:37121527-37121549 GACTAGTCTTGAAAGTAGGCCGG - Intronic
1174731770 20:52925085-52925107 GACTGATCTTTTGAGTACATCGG + Intergenic
1178704777 21:34864267-34864289 GCCTGGTATTTTAAGTACATGGG + Intronic
1179602377 21:42488681-42488703 AACAGGTTTTTTAAGTAGATTGG - Intronic
1183382966 22:37499670-37499692 CACTGGTCCTTTGAGGAGGTTGG - Intronic
950719779 3:14874793-14874815 TAAAGGTCTTTTAAGTAGCTGGG + Intronic
951742573 3:25940573-25940595 GACAGTTTTATTAAGTAGGTGGG - Intergenic
953507315 3:43498774-43498796 GACTGTCCTTTTCAGCAGGTAGG + Intronic
953962250 3:47275408-47275430 GACTGGTCGTTTAAGTTGGATGG - Exonic
956115653 3:65915598-65915620 AACTTTTCTTTTAATTAGGTAGG - Intronic
961491542 3:127259748-127259770 CACTGGTCTTTAAAGTGGGGAGG + Intergenic
962500695 3:135988691-135988713 GACTGGTGTCTTCAGTGGGTGGG - Intronic
971955537 4:33413190-33413212 GACTGGTTGTTTAAGAAGGAGGG + Intergenic
975193612 4:71496255-71496277 GACTGGTAATTCAAGTAAGTCGG + Intronic
975629395 4:76385013-76385035 GCCAGGTATTTTAAGTGGGTAGG - Intronic
979373949 4:119922146-119922168 GACTGTGATTTTAAGTAGGATGG - Intergenic
979437993 4:120717453-120717475 TACTGTTCTTTTATATAGGTGGG - Intronic
980607711 4:135113766-135113788 GACTGGTCTTGTAAGTATATGGG + Intergenic
981329799 4:143495484-143495506 GAATGGTCTTTTAAGGACATAGG - Intergenic
984632120 4:182072315-182072337 GGCTGCTCTTTTCAGTAGGGTGG + Intergenic
986565415 5:9108850-9108872 GAGTGGTCTTTTAAATTGTTTGG - Intronic
987676456 5:21079449-21079471 GTCTGGTCTTTTGTGTGGGTGGG - Intergenic
987958079 5:24765867-24765889 TACTGGTATTTGAAGTAGGTTGG + Intergenic
988510727 5:31862480-31862502 GACTGGACATTTAAGTAGTATGG + Intronic
989220009 5:38947519-38947541 TACTTGTCTTTTATGAAGGTAGG - Intronic
992669558 5:79045262-79045284 GATTGGTCTCATAAGTAGGCAGG + Intronic
993592233 5:89808455-89808477 AACTTGTCTTTTCAGTGGGTAGG - Intergenic
996474831 5:123904901-123904923 GACTGACCTTTTAGGAAGGTTGG - Intergenic
996753394 5:126911768-126911790 GACTGGCCATGTAGGTAGGTAGG + Intronic
996773662 5:127110995-127111017 GATTAGACTTTTAACTAGGTTGG - Intergenic
996885986 5:128354148-128354170 GACTGTTATTTTATGTAGGATGG + Intronic
1012154174 6:95795702-95795724 GACTGTTCCTCAAAGTAGGTGGG + Intergenic
1017351376 6:153446150-153446172 GACTGGTTGTTTAAGAAGGAGGG - Intergenic
1018501898 6:164420258-164420280 GACATGTCTTTTAAGAAGCTTGG - Intergenic
1018990437 6:168669559-168669581 AACTGGGATTTGAAGTAGGTAGG + Intronic
1020836056 7:13152957-13152979 GACTGATCTTTTAAGTGGTTTGG - Intergenic
1022827747 7:34033723-34033745 GACATCTCTTTTAAGTAGATTGG + Intronic
1023270125 7:38453505-38453527 GAATGCTCTTTTAAGTACTTAGG + Intronic
1026296337 7:69055965-69055987 GTCTGATGTTTTAAGTAGGATGG - Intergenic
1028702307 7:93794022-93794044 GACTGATCTTTTTATTAGATTGG + Intronic
1041875483 8:62682660-62682682 GACTGGCCTTTTAAGTTGCATGG + Intronic
1044975925 8:97665605-97665627 GAATGGTATTTTCAGTAAGTAGG + Intronic
1055577798 9:77677622-77677644 GGCTGGTCTTGTAAGTTGCTGGG - Intergenic
1055952980 9:81747873-81747895 GACTGGTTTCTTAATTATGTAGG + Intergenic
1056486876 9:87067667-87067689 GACTGGTCTTTTAAAAATGTAGG - Intergenic
1057235915 9:93360020-93360042 GACTGGTTGTTTAAGAAGGAGGG + Intergenic
1187616321 X:20997932-20997954 GACTGGTTATTTAAGAAGGAGGG + Intergenic
1188398873 X:29719982-29720004 GACTGTGCTTTTAAGTTGTTTGG - Intronic
1193598283 X:83475789-83475811 GTCTGGTCCTTTTAGTTGGTAGG - Intergenic
1197887883 X:131237058-131237080 AACTGGTCATTTAAGTTAGTGGG - Intergenic
1199080216 X:143568417-143568439 GACTGGTGTTTTATGGAGGTAGG - Intergenic
1199467769 X:148158794-148158816 CACTGGTCAGTTAAGGAGGTTGG - Intergenic
1199702937 X:150398517-150398539 CACTGGTATTTTCAGTAGGAAGG + Intronic
1201646958 Y:16244478-16244500 GATTTGTTTTTTAAGTAGTTTGG - Intergenic
1201655853 Y:16340824-16340846 GATTTGTTTTTTAAGTAGTTTGG + Intergenic