ID: 1089312229

View in Genome Browser
Species Human (GRCh38)
Location 11:117566230-117566252
Sequence CAATTTATGCAGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089312229_1089312234 0 Left 1089312229 11:117566230-117566252 CCCTCCACCCTCTGCATAAATTG 0: 1
1: 0
2: 1
3: 14
4: 177
Right 1089312234 11:117566253-117566275 TACAGACAAAACAGAAGCTCAGG 0: 1
1: 0
2: 2
3: 19
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089312229 Original CRISPR CAATTTATGCAGAGGGTGGA GGG (reversed) Intronic
900511466 1:3062968-3062990 CAAATCCTGCAGAGTGTGGAGGG - Intergenic
900731295 1:4262555-4262577 GTATATATGCAGAGGCTGGAGGG + Intergenic
904974300 1:34444026-34444048 CAATGGAAGCAGAGAGTGGAGGG - Intergenic
908412023 1:63876360-63876382 CAAGTGATGCACAGGGTGGGAGG - Intronic
908945906 1:69496607-69496629 CAATCAAGCCAGAGGGTGGATGG + Intergenic
911686119 1:100779792-100779814 CAATCTTTGCAGAAGGTGAAAGG + Intergenic
917078680 1:171234427-171234449 TAATCCATGCAGAGGGTGAAGGG - Intergenic
917904961 1:179579549-179579571 CACTTTATGGACAAGGTGGAAGG + Intergenic
918939751 1:190977399-190977421 CAATTTAGACAGAGAGTGAATGG - Intergenic
919463305 1:197903237-197903259 GAATTGATGGAGAAGGTGGAGGG + Intronic
920689813 1:208137350-208137372 AAATCTATACACAGGGTGGATGG - Intronic
921326633 1:213990548-213990570 CACTTTAGGCAGCAGGTGGAGGG + Intronic
921918510 1:220641227-220641249 GAATTTTGGCAGAGGGTGCAGGG - Intronic
923097297 1:230785588-230785610 CAATTATTGCAGAAGGTGAAGGG - Intronic
1063479937 10:6366590-6366612 CACCTTATGCAGAGGGAGAAGGG - Intergenic
1063724531 10:8622240-8622262 CAAGTTATGCAGTGAGTGGGTGG + Intergenic
1071921925 10:90360138-90360160 CAATTATTGCAGAAGGTGAATGG + Intergenic
1072299726 10:94047583-94047605 CAATTTCTGCAAAGTGTAGAAGG - Intronic
1072322938 10:94268745-94268767 CAATTAATCCAGAGTGGGGAAGG - Intronic
1073293699 10:102425652-102425674 CCCTTTGTGCAGAGGGTGGGTGG - Intronic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1074584509 10:114754270-114754292 AGATTTATGCAAAGGGTGAAGGG - Intergenic
1074643683 10:115418789-115418811 CAATATATTCAGAATGTGGAAGG + Intronic
1075698701 10:124454438-124454460 CAGTTTATGCAGAGGGAGTGGGG + Intergenic
1076162431 10:128255826-128255848 CAAATTATGAAGGTGGTGGAGGG + Intergenic
1081365537 11:42230538-42230560 TAATTTATGGAGAGAGAGGAGGG + Intergenic
1082119020 11:48357955-48357977 CCATTGATTCAGAGGGTGCAAGG - Intergenic
1082255271 11:50027192-50027214 CCATTGATTCAGAGGGTGCAAGG + Intergenic
1083055825 11:59818742-59818764 CAGTTTATGCAGCAGGTGGTAGG + Intergenic
1083910401 11:65705301-65705323 CAATCAAGGCAGAGGGTGAAGGG - Intergenic
1085370390 11:75998451-75998473 CATCTTAGGCAGAGGCTGGAAGG - Intronic
1086506995 11:87515521-87515543 GAATTTATGCATTGGGTGGGGGG + Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091055975 11:132419550-132419572 AAATCTCTGCAGATGGTGGAAGG + Exonic
1091462675 12:656974-656996 TAATTCTTGTAGAGGGTGGAAGG - Intronic
1092292112 12:7166602-7166624 CAATTTTTCCAGAGACTGGAGGG - Intergenic
1093140615 12:15506564-15506586 CACCTTATTCAGAGGGTGGCAGG + Intronic
1093176208 12:15916135-15916157 CAATTTATCCTGAGGGAGAATGG + Intronic
1101318019 12:103647222-103647244 CAATCCAGGCAGAGGGTGGTAGG + Intronic
1107483595 13:40805433-40805455 CTTTTTATGCAGTGGGTGGTGGG - Intronic
1108495177 13:51017967-51017989 AAATGTATGGAGTGGGTGGAAGG - Intergenic
1109569011 13:64161780-64161802 CTATTTATGTAGAAGGTGAAGGG - Intergenic
1117549573 14:56820618-56820640 CAAATTATTCAGAAGGTTGAGGG + Intergenic
1118676114 14:68186187-68186209 CAATTTTTGCATATGGTGAAAGG - Intronic
1119157775 14:72427496-72427518 CAATTTGGGCAGAGGTTGGTCGG - Intronic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1121152864 14:91653547-91653569 CAATCATGGCAGAGGGTGGAAGG + Intronic
1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG + Intergenic
1122218930 14:100222881-100222903 TGATTTATACAGTGGGTGGATGG + Intergenic
1122484661 14:102070719-102070741 CAAAATAAGCAGGGGGTGGAGGG + Intergenic
1122869786 14:104633027-104633049 CAAGTTATGCACAGGGTGTGTGG - Intergenic
1124574304 15:30894557-30894579 CAATTCATGCTGAGCTTGGACGG - Intergenic
1126136375 15:45396409-45396431 CAATTTAGGGAGAGATTGGAGGG + Intronic
1127647963 15:60976321-60976343 CATATTATGCAGATGGGGGATGG - Intronic
1130170682 15:81509818-81509840 CAAGTTAGACAGAGGGTGGGAGG - Intergenic
1134607187 16:15580482-15580504 AAGTTCATCCAGAGGGTGGAAGG + Intronic
1134828471 16:17304056-17304078 CAATTTATGCTAACGTTGGAAGG + Intronic
1136162790 16:28431662-28431684 CAATTTATGGAGGAGGAGGAAGG - Intergenic
1136200176 16:28683326-28683348 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1136216524 16:28797519-28797541 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1137356617 16:47772321-47772343 CATTTAAGGCAGAGGGTAGAGGG - Intergenic
1137473413 16:48783559-48783581 TAATTTATGTAAAGGGTGTATGG + Intergenic
1141910419 16:87054797-87054819 AAACGGATGCAGAGGGTGGAGGG + Intergenic
1142158524 16:88545081-88545103 CAATGTCTGCAGTGGCTGGAGGG + Intergenic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1148394458 17:47296930-47296952 CTATTTAAGCGAAGGGTGGATGG - Intronic
1148580189 17:48738344-48738366 CAGGTTATTGAGAGGGTGGAGGG - Intergenic
1150168990 17:62971902-62971924 CAATTTTTCCAGAGGGTAGGGGG - Intergenic
1150664945 17:67125636-67125658 CAATTTAATCAGAGTGTGGCAGG + Intronic
1150676982 17:67252665-67252687 AAATTTATACAGAGAGTAGAAGG + Intergenic
1152003921 17:77665312-77665334 CAATTATGGCAGAAGGTGGAAGG - Intergenic
1153328851 18:3851236-3851258 AAATTTACGCAGCAGGTGGAGGG + Intronic
1155062286 18:22239443-22239465 CAAGTTATGTAAAGTGTGGAGGG - Intergenic
1155583209 18:27335734-27335756 CAATTTTGGCAGAAGGTGAAGGG + Intergenic
1155859344 18:30877395-30877417 CTATTTAGGGAGAGAGTGGATGG + Intergenic
1158501583 18:58007192-58007214 AAAATTATGTAGAGGTTGGAGGG - Intergenic
1158667431 18:59445205-59445227 TAATTTTTGCAGATGGTGTAAGG + Intronic
1159846721 18:73469935-73469957 TAATTTTTGCAGAAGGTGTAAGG + Intergenic
1160235150 18:77079777-77079799 GAATTTATTCTGAGTGTGGAAGG - Intronic
1161111970 19:2475720-2475742 CAAGTTCTGCTGGGGGTGGAGGG - Intergenic
1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG + Intronic
1165112473 19:33510415-33510437 GTATATATGCAGAGGCTGGAAGG + Intronic
926415569 2:12646334-12646356 CAATTATGGCAGAGGGTGAAAGG + Intergenic
928690157 2:33791191-33791213 CAATTTATGGAGATGGAGGGGGG - Intergenic
929483744 2:42337148-42337170 GAATTTAAGCAATGGGTGGATGG - Intronic
929803953 2:45128242-45128264 GGCTTTTTGCAGAGGGTGGATGG - Intergenic
932577015 2:72968316-72968338 CAGTTTGTGTAGAGGGTGGAAGG - Intronic
935713608 2:105920000-105920022 GAAATTATGCAGAGGAGGGATGG + Intergenic
937004108 2:118495885-118495907 CAATTTAGGCAAAGGGTGAAGGG - Intergenic
937312425 2:120910330-120910352 TAATTTATGCAAATGGGGGAGGG + Intronic
937829277 2:126402195-126402217 CAAATTATGCAGAGGGTCGATGG + Intergenic
939233907 2:139466899-139466921 CATTTTAGGGAGGGGGTGGAAGG + Intergenic
939437497 2:142197537-142197559 CAATTGATTGAGAGGGTGCATGG + Intergenic
940176089 2:150878939-150878961 CCATATATGCAGAGTGGGGAGGG + Intergenic
942701792 2:178719502-178719524 CAATATTTCCAGGGGGTGGAGGG - Intronic
943820217 2:192313232-192313254 TAATTTTTGCAGAAAGTGGAAGG + Intergenic
944692222 2:202168687-202168709 CACTGAATGCAGAGGCTGGAAGG - Intronic
1169281425 20:4270435-4270457 GAATATTTGAAGAGGGTGGAGGG - Intergenic
1170973321 20:21137320-21137342 CAAATTATGCCAAGTGTGGAGGG + Intronic
1171303861 20:24088055-24088077 TAATTTTTGCAGAGGGTGTAAGG + Intergenic
1171397998 20:24851371-24851393 TAATTTTTGCATATGGTGGAAGG - Intergenic
1172101506 20:32486415-32486437 CAATGTCTTCAGAGGCTGGAGGG - Intronic
1173285000 20:41662331-41662353 AAATGTGTGGAGAGGGTGGATGG + Intergenic
1175213253 20:57375086-57375108 CACTTTATGAAGGGGGTGGCAGG + Intronic
1175451461 20:59072344-59072366 CAATGGAGGCAGAGGCTGGAGGG + Intergenic
1176340544 21:5690777-5690799 CAATTTATGTATAGGGTGTAAGG - Intergenic
1176472798 21:7122930-7122952 CAATTTATGTATAGGGTGTAAGG - Intergenic
1176504283 21:7633679-7633701 CAATTTATGTATAGGGTGTAAGG + Intergenic
1177183461 21:17768161-17768183 CAATCTCTCTAGAGGGTGGAAGG + Intergenic
1177767482 21:25474732-25474754 CAATTATGGCAGAGGGTGAAGGG - Intergenic
1178195675 21:30342286-30342308 AAATTTATGCAGTGAGTTGATGG - Intergenic
1183211193 22:36452460-36452482 CAATTGATTCAGAGGGTAAAGGG - Intergenic
1184026023 22:41857165-41857187 AAATTAAGGCAGAGTGTGGACGG + Intronic
1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG + Intergenic
1203239807 22_KI270733v1_random:5235-5257 CAATTTATGTATAGGGTGTAAGG - Intergenic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
956525564 3:70155788-70155810 CAGTTTCTGCTTAGGGTGGAGGG + Intergenic
956907039 3:73777231-73777253 CAGATTATGCAGAAGGTGGTTGG + Intergenic
957634872 3:82769375-82769397 CAATTTATGGAAAGGCTGTAGGG + Intergenic
962060396 3:131920867-131920889 CAATTTGCGGAGAGGGAGGAAGG - Intronic
962384828 3:134924114-134924136 TAATTTCTGCATAAGGTGGAAGG - Intronic
962911628 3:139856246-139856268 CAATCTATGCACAGGGAGGATGG + Intergenic
963527957 3:146437925-146437947 CATTTAATGCAGTGGGTAGAGGG - Intronic
965856170 3:173090302-173090324 CAATTATTGCAGAAGGTGAAAGG - Intronic
966377517 3:179312090-179312112 CAATTTAGGCTGAGCGTGGCGGG - Intergenic
967274332 3:187759106-187759128 CATTTGTTGCAGAGGTTGGAAGG - Intergenic
967579003 3:191129815-191129837 CGGTTGATGCAAAGGGTGGAAGG - Intergenic
972244030 4:37225807-37225829 GGAATTAGGCAGAGGGTGGAAGG - Intergenic
976000614 4:80370094-80370116 CAATTATGGCAGAGGGTGAAAGG + Intronic
978441319 4:108737270-108737292 CACTTTGTGAAGAGGGTGGAGGG - Intergenic
979666171 4:123313194-123313216 GAATGGATGCAGAGGGAGGAGGG - Intronic
980302773 4:131015046-131015068 CAAAATATGCAAATGGTGGAGGG + Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
985131172 4:186740234-186740256 GAATATAGGCAGAGAGTGGATGG - Intergenic
985365775 4:189231075-189231097 CAATTGTAGCAGAAGGTGGAGGG + Intergenic
985836130 5:2273184-2273206 CACCGCATGCAGAGGGTGGAGGG - Intergenic
985864568 5:2504326-2504348 CACATGATACAGAGGGTGGAAGG - Intergenic
988042989 5:25911876-25911898 CAATTTCTCCCCAGGGTGGATGG + Intergenic
993443208 5:87980589-87980611 CAATTTCTGCAAAGGAAGGATGG + Intergenic
994608477 5:102003588-102003610 CAATATATGCACAGGGTAAATGG + Intergenic
996190474 5:120534643-120534665 CAACTTATGCTGAGTGTGTAAGG - Intronic
997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG + Intergenic
1000462597 5:161541520-161541542 CAATTTATGCAGAAGATGCAAGG - Intronic
1002700235 5:181118943-181118965 CACTTTAGGCAAAAGGTGGAAGG + Intergenic
1011780816 6:90787377-90787399 AAATGTGTGCAGAGGGTAGAAGG + Intergenic
1014288538 6:119531166-119531188 CAATTTTGGCAGAAGGTGAAGGG - Intergenic
1014749525 6:125239402-125239424 CAATTATGGCAGAAGGTGGAAGG + Intronic
1015768278 6:136742477-136742499 TAATTTCTGCAGAGGGTGTAAGG - Intronic
1018668352 6:166160229-166160251 CAAGTTATGCAGAGGGAAAAAGG - Intronic
1020543233 7:9489185-9489207 CAATTTATGTATACGGTGTAAGG + Intergenic
1023228692 7:38000659-38000681 CAATCTATGCTGATGGGGGATGG + Intronic
1023388952 7:39688901-39688923 CAATTGTGGCAGAGGGTGAAGGG + Intronic
1027760959 7:82278202-82278224 CAATTTATTCAAAAGATGGAAGG + Intronic
1031513629 7:122677015-122677037 GAATGTACGCAGAGTGTGGAGGG - Intronic
1033319755 7:140328680-140328702 CAATTTAAGGAGAGGCTGCATGG + Intronic
1035731196 8:1854515-1854537 CAGTGTTTGCAGAGGATGGAGGG + Intronic
1040048579 8:42989119-42989141 CAATATTAGAAGAGGGTGGAGGG + Intronic
1040917251 8:52575117-52575139 CAATATATGCATAGTGTGAATGG + Intergenic
1042952850 8:74219555-74219577 TAATATATGCACAGGGTGTAAGG + Intergenic
1043131048 8:76461787-76461809 CAGTTTATGGTGGGGGTGGAAGG + Intergenic
1043406744 8:79943720-79943742 GAATGTATGCAGAGAGGGGAGGG - Intronic
1049021900 8:139962845-139962867 AAACTTATGCAGAGGCTGGAGGG + Intronic
1050402604 9:5271791-5271813 CAATTATGGCAGAGGGTGAAAGG - Intergenic
1052475237 9:28951215-28951237 TAATTTTTGCAGAAGGTGTAAGG - Intergenic
1055821318 9:80267870-80267892 GAATTTATGAAGAGGATGGATGG - Intergenic
1055984042 9:82037392-82037414 CCATTTATGCAGAAGTGGGAAGG - Intergenic
1056237490 9:84609652-84609674 CTATGTATGCAGCTGGTGGATGG + Intergenic
1056480213 9:86995774-86995796 TTATTTATACAGAGGGAGGAGGG - Intergenic
1056734531 9:89196732-89196754 CAATTTTGGCAGAAGGTGAAGGG + Intergenic
1059947122 9:119420823-119420845 TAATTGATGCAGAGGAAGGAAGG + Intergenic
1203422523 Un_GL000195v1:7216-7238 CAATTTATGTATAGGGTGTAAGG + Intergenic
1187244371 X:17540650-17540672 CAAGTTCTTCAGAGGGTTGACGG - Intronic
1187332983 X:18357359-18357381 CAATTGATGACAAGGGTGGAAGG - Intergenic
1189623655 X:42871564-42871586 AAATTTATGCCGAGGGAGGGAGG - Intergenic
1190191298 X:48279528-48279550 AAATGTAAGCAGAGGTTGGAGGG - Intergenic
1190200557 X:48357229-48357251 AAATGTAAGCAGAGGTTGGAGGG - Intergenic
1191870395 X:65740526-65740548 CAATTTCTCCCCAGGGTGGATGG + Exonic
1192047296 X:67689320-67689342 CAGATTATTCAGAGAGTGGAGGG + Intronic
1192941244 X:75913714-75913736 CAATTATTGCAGAAGGTGAAGGG + Intergenic
1193338865 X:80322419-80322441 CATTTTAAGCAGTGGGTAGAGGG + Intergenic
1193551077 X:82893413-82893435 TAATTTATGCAAAGGAAGGATGG - Intergenic
1194297563 X:92144765-92144787 AAATTGATGCAGAGGGATGAAGG + Intronic
1194503938 X:94709554-94709576 CAATGAAGGCAGAGGGTGAAAGG + Intergenic
1194624982 X:96216575-96216597 CAGTTTCTTCAGAGTGTGGATGG - Intergenic
1194922552 X:99784468-99784490 TATTTTATTCAGAGGGTAGAGGG + Intergenic
1195603478 X:106774883-106774905 CAATTTATTTAGGGGGCGGAAGG + Intronic
1198063067 X:133066697-133066719 TAATTTTTGCATAAGGTGGAAGG - Intronic
1200615137 Y:5369666-5369688 AAATTGATGCAGAGGGATGAAGG + Intronic
1201848603 Y:18451427-18451449 CATTTTAGGCACAGGGTGCATGG + Intergenic
1201884714 Y:18868948-18868970 CATTTTAGGCACAGGGTGCATGG - Intergenic