ID: 1089312234

View in Genome Browser
Species Human (GRCh38)
Location 11:117566253-117566275
Sequence TACAGACAAAACAGAAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 304}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089312228_1089312234 21 Left 1089312228 11:117566209-117566231 CCTGTGACAGAAGTCAGGCTACC 0: 1
1: 0
2: 1
3: 9
4: 197
Right 1089312234 11:117566253-117566275 TACAGACAAAACAGAAGCTCAGG 0: 1
1: 0
2: 2
3: 19
4: 304
1089312232_1089312234 -7 Left 1089312232 11:117566237-117566259 CCCTCTGCATAAATTGTACAGAC 0: 1
1: 0
2: 0
3: 5
4: 144
Right 1089312234 11:117566253-117566275 TACAGACAAAACAGAAGCTCAGG 0: 1
1: 0
2: 2
3: 19
4: 304
1089312231_1089312234 -4 Left 1089312231 11:117566234-117566256 CCACCCTCTGCATAAATTGTACA 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1089312234 11:117566253-117566275 TACAGACAAAACAGAAGCTCAGG 0: 1
1: 0
2: 2
3: 19
4: 304
1089312233_1089312234 -8 Left 1089312233 11:117566238-117566260 CCTCTGCATAAATTGTACAGACA 0: 1
1: 0
2: 0
3: 9
4: 156
Right 1089312234 11:117566253-117566275 TACAGACAAAACAGAAGCTCAGG 0: 1
1: 0
2: 2
3: 19
4: 304
1089312230_1089312234 -1 Left 1089312230 11:117566231-117566253 CCTCCACCCTCTGCATAAATTGT 0: 1
1: 1
2: 0
3: 23
4: 250
Right 1089312234 11:117566253-117566275 TACAGACAAAACAGAAGCTCAGG 0: 1
1: 0
2: 2
3: 19
4: 304
1089312229_1089312234 0 Left 1089312229 11:117566230-117566252 CCCTCCACCCTCTGCATAAATTG 0: 1
1: 0
2: 1
3: 14
4: 177
Right 1089312234 11:117566253-117566275 TACAGACAAAACAGAAGCTCAGG 0: 1
1: 0
2: 2
3: 19
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089312234 Original CRISPR TACAGACAAAACAGAAGCTC AGG Intronic
900716078 1:4145073-4145095 TATAGACAATAAAGAAGCTGAGG + Intergenic
900903220 1:5531342-5531364 TACAGACAAAACATCAGTTGTGG + Intergenic
902595272 1:17505364-17505386 CAGAGAGAAAAGAGAAGCTCAGG + Intergenic
903406381 1:23100348-23100370 AACAGACAGCACAGAATCTCAGG + Intronic
903532543 1:24042876-24042898 TAGATACAAAACAGAAGAGCAGG + Intergenic
903994244 1:27295747-27295769 AACAAACAAAATAGAAGGTCAGG - Intronic
904398617 1:30240876-30240898 TAAAGAGAAAACTGAAGCCCAGG - Intergenic
904842487 1:33382045-33382067 TGCAGAGAAACCAGAAGCTAGGG + Intronic
905400472 1:37699005-37699027 TACAGAAAGAACTGAGGCTCAGG + Intronic
905685225 1:39902554-39902576 TACAGATGAAACTGAAGCTCAGG - Intergenic
906400262 1:45499380-45499402 TACAGAAGAAACAGATGCACAGG + Exonic
907287228 1:53389714-53389736 AAGAGACAAAACAGATCCTCAGG - Intergenic
907530627 1:55092022-55092044 TACGGACAAAGAAGAAACTCAGG - Exonic
908750793 1:67421362-67421384 TAAAAACCAAACAGAAGCTCTGG + Intronic
909761870 1:79298630-79298652 TAATGATAAAAAAGAAGCTCAGG - Intergenic
910777371 1:90890684-90890706 TACATTCAAGACAGAAGCTTAGG + Intergenic
911419543 1:97622677-97622699 TAGAGACAATACAGAATCGCTGG - Intronic
911514879 1:98855439-98855461 TACAGACATAATAGAAACTTGGG - Intergenic
912951002 1:114120308-114120330 TAAAGACAAACCAGAGGCTTAGG - Intronic
914812911 1:151042503-151042525 TAGAGTCAAAACAGAAGCCTGGG + Intronic
915408157 1:155677874-155677896 GACAGTCAAAACAAAAACTCTGG - Intronic
918016151 1:180634192-180634214 TGCAGACACAACATAATCTCAGG - Intronic
919132839 1:193472937-193472959 TACAGACGAAACTGAGGCTATGG + Intergenic
920041357 1:203099818-203099840 GACAAACAAAAGAGAAGGTCAGG - Intronic
922165343 1:223111021-223111043 AACAGATAAAACAGAAGCCCCGG + Exonic
922981605 1:229831657-229831679 TACAGACAAAAAAGAGGGTTCGG - Intergenic
923179837 1:231505908-231505930 TACAGCCAAAAAAAAAGCCCAGG - Intergenic
1063704928 10:8421378-8421400 TACAGTAACAACAGAAGGTCAGG - Intergenic
1064678232 10:17783087-17783109 GACTGGCAAAACAGAAGCTGGGG + Intronic
1065216433 10:23453327-23453349 TAACCATAAAACAGAAGCTCAGG - Intergenic
1067231535 10:44414989-44415011 TAAAGAAAAAAAAGAGGCTCCGG - Intergenic
1067337578 10:45377623-45377645 GCCAGACAAAACAGAGACTCGGG - Intronic
1067398249 10:45944515-45944537 TAAATACAAATCAGAAGGTCTGG + Intergenic
1067866568 10:49913600-49913622 TAAATACAAATCAGAAGGTCTGG + Intronic
1068398967 10:56503635-56503657 CACAGACTAAACAGGAGCCCTGG + Intergenic
1070618102 10:77984958-77984980 TACAGTCAAAATAGAAGCAATGG - Intronic
1071320179 10:84447386-84447408 TACACACAAAACATATGATCGGG - Intronic
1072157319 10:92735843-92735865 TAAAAACAAGACAGAGGCTCAGG + Intergenic
1072176989 10:92936250-92936272 CACAGGCAGAACAGAAACTCTGG - Intronic
1072533084 10:96337784-96337806 TCCAGTGAAATCAGAAGCTCAGG - Intronic
1072784471 10:98270217-98270239 TAGAGATAAATAAGAAGCTCGGG - Intergenic
1073202405 10:101746353-101746375 TACATAAAAAATAGAAACTCAGG - Intergenic
1074298261 10:112210740-112210762 TCCAGACAGAGCAGAAACTCTGG - Intronic
1074734498 10:116414874-116414896 TATAGACAGAACAGAAGTTAAGG + Intergenic
1075024835 10:118976950-118976972 TACAAATAAATGAGAAGCTCTGG - Intergenic
1075611087 10:123855368-123855390 AACAAACAAAACAGAAAATCGGG + Intronic
1076756059 10:132572358-132572380 TCCCTGCAAAACAGAAGCTCAGG - Intronic
1078788737 11:14522488-14522510 TACAGAGAAAACTGACTCTCAGG - Intronic
1081033871 11:38117332-38117354 TACAAGCAAAACAAAATCTCTGG - Intergenic
1081736641 11:45408991-45409013 GACATACAAATCAGAAGGTCTGG - Intergenic
1084459864 11:69290700-69290722 TTCAAACAAAACAGAAGCCTGGG - Intergenic
1086263263 11:84966871-84966893 TAGAGATAAAAGAGAAGCTAAGG + Intronic
1086345818 11:85894966-85894988 TACAGACAGAAATGAAGCACAGG - Intronic
1087273758 11:96139743-96139765 TAAAGACAGTGCAGAAGCTCAGG + Intronic
1088001624 11:104888785-104888807 TACAGACAAAAAAGGAGCTTAGG - Intergenic
1089312234 11:117566253-117566275 TACAGACAAAACAGAAGCTCAGG + Intronic
1089899046 11:121962306-121962328 TAAAGTCAAAGCAGAAGCTGTGG - Intergenic
1089998032 11:122927623-122927645 TACAGACACAGCAGGAGCTGAGG - Intronic
1090759517 11:129823930-129823952 AACAGATCAAAGAGAAGCTCTGG - Intronic
1090872393 11:130760056-130760078 TACAGATAAAATGGAAGCCCAGG + Intergenic
1091602459 12:1926072-1926094 TACAGACAATGCGCAAGCTCAGG + Intergenic
1092009998 12:5101776-5101798 AAGAGGCAAAACAGAAGGTCAGG - Intergenic
1092376152 12:7957002-7957024 TACAGATAAAAAAGATGTTCAGG + Intergenic
1093773670 12:23047584-23047606 TACAGAGGACACAGAGGCTCAGG + Intergenic
1094646829 12:32333000-32333022 TACAAACAAAACTGAGGCTTTGG + Intronic
1098894887 12:76047257-76047279 TACACAGTAAACAGAAGCACGGG + Exonic
1099136361 12:78908445-78908467 TTCAAAGAAACCAGAAGCTCAGG + Intronic
1099863847 12:88253843-88253865 AACAGTCAAAAAAGCAGCTCTGG + Intergenic
1099960085 12:89388511-89388533 TAAAGACAAAAAAGAACCTAAGG - Intergenic
1100890340 12:99118867-99118889 AACATACATAAGAGAAGCTCAGG - Intronic
1101710691 12:107262349-107262371 TAATGACAAATGAGAAGCTCTGG + Intergenic
1101810315 12:108102216-108102238 TACAGCCAAGAAAGAGGCTCGGG + Intergenic
1102230891 12:111261455-111261477 TACAAACAAAACAAATGCACAGG - Intronic
1102922304 12:116800870-116800892 AACAGATAAAACAGAGGCTCAGG + Intronic
1103174553 12:118851284-118851306 TTCAGACACTTCAGAAGCTCAGG - Intergenic
1103627726 12:122233138-122233160 TTCAGTCAAAATTGAAGCTCTGG - Intronic
1104570543 12:129921301-129921323 CACAGACAAAACAGACAATCTGG - Intergenic
1106420423 13:29581286-29581308 TGCAGAAAATACAGAAGCTTGGG + Intronic
1107037190 13:35913790-35913812 TCTAGACAAAACAGAAGTTACGG + Intronic
1107439724 13:40415190-40415212 TACAGGCAAGGCAGAGGCTCAGG - Intergenic
1109848439 13:68028954-68028976 TACAGATAAATCTGAGGCTCAGG - Intergenic
1110056770 13:70984215-70984237 AATAATCAAAACAGAAGCTCAGG - Intergenic
1111101586 13:83595421-83595443 TACACACAAAACAAAACTTCAGG - Intergenic
1111393290 13:87627241-87627263 TAAAAAACAAACAGAAGCTCAGG + Intergenic
1113187113 13:107701000-107701022 TACAGAGAAAAGAGAACCCCAGG + Intronic
1113229492 13:108196123-108196145 CACAGACAAAACCCAAGCACAGG + Intergenic
1113232457 13:108228850-108228872 TAATGAGAAAACAGAAGCTCAGG - Intronic
1115872800 14:37824193-37824215 TGCAGACATAAAGGAAGCTCAGG - Intronic
1116041539 14:39692220-39692242 TGCAGACAAAATAGAAGCCAGGG + Intergenic
1117378933 14:55140684-55140706 TATAGACAAAACTGAGGTTCAGG + Intronic
1120199941 14:81526391-81526413 AGCATACAAAACAGAAACTCAGG - Intronic
1120765082 14:88321587-88321609 TAGAGACAAAATAGAAGGTTTGG + Intronic
1121148786 14:91610900-91610922 TATAGACAACACAGAAACTGAGG + Intronic
1121176216 14:91892527-91892549 TAGAGACAAAACAGAATCACAGG - Intronic
1121270930 14:92637925-92637947 TACAGAGGACACAGAGGCTCAGG - Intronic
1121809686 14:96872698-96872720 CACAGAAAAAACTGAAGCTAGGG - Intronic
1122050817 14:99058499-99058521 CACAGGCAAACCAGAAGCGCAGG + Intergenic
1123809675 15:23910557-23910579 TACAGACAAAATGGATGCTGAGG + Intergenic
1126437659 15:48652535-48652557 TCCACCCAAAACAAAAGCTCTGG + Intergenic
1126866568 15:52943540-52943562 TACAGAGAAAACACAGGTTCTGG - Intergenic
1127546442 15:59997676-59997698 AACAAACAAAGCAGAAGCGCAGG + Intergenic
1127965812 15:63922062-63922084 TACAGATGAAACAGAAACCCAGG - Intronic
1128870751 15:71153570-71153592 TACATACAAAACAGGAGCTGGGG + Intronic
1131292532 15:91119015-91119037 TACAGGCCAGACAGAAGCTGAGG - Intronic
1131681326 15:94726635-94726657 TGATGAGAAAACAGAAGCTCAGG - Intergenic
1132849292 16:2017303-2017325 AACAAACAAAACAGAAGGTCTGG - Intronic
1133087592 16:3377052-3377074 GACTGACAAATCAGAATCTCTGG + Intronic
1137075842 16:35959418-35959440 TAAAAACAAGACAGAAGCTTTGG + Intergenic
1137595773 16:49722613-49722635 GATAGAAAAAACAGAAGTTCTGG - Intronic
1138368816 16:56507665-56507687 TACACACAAAACAGACTCCCGGG + Intronic
1140628313 16:76821489-76821511 TACAGATAAAACATTAGCCCTGG - Intergenic
1143323843 17:6085712-6085734 AACAGCCAAAGCATAAGCTCAGG - Intronic
1144663179 17:17084713-17084735 AACAGACAAACCAGAGGGTCAGG - Intronic
1150169425 17:62977206-62977228 TACAGAAATAACTGAAGCTTAGG - Intergenic
1151157599 17:72137319-72137341 TTCAGGCCAAAGAGAAGCTCGGG + Intergenic
1151428537 17:74047291-74047313 TATAGACAAACCACAAGCTATGG + Intergenic
1155384371 18:25261184-25261206 TACTAACAAAACAGAGACTCTGG + Intronic
1155550343 18:26958247-26958269 TAAAGACAAAACAAAAGCCAGGG - Intronic
1155989176 18:32261401-32261423 TACATATAAAATGGAAGCTCTGG - Intronic
1159037350 18:63290327-63290349 TACAGACGATACGGAAGCTGTGG + Intronic
1159055217 18:63456562-63456584 TACAGACCACACAGAACATCAGG - Intergenic
1159180703 18:64899849-64899871 GAAAGACAAAAGAGAAGCCCTGG - Intergenic
1163739027 19:18999406-18999428 TACAGACAAATCCGTGGCTCAGG + Intronic
1163910160 19:20182423-20182445 TGCAGAACAAACAGAAGCTGTGG - Intronic
1164283498 19:23789977-23789999 TACATACAAAAAAGAAGCTGGGG - Intronic
1165187351 19:34033504-34033526 TACAGTCATAAAAGTAGCTCAGG - Intergenic
925848880 2:8060839-8060861 TAAAGATGAAACAGAAGGTCAGG + Intergenic
926162872 2:10500964-10500986 CACAGACACAACAGAAGAGCTGG - Intergenic
926539200 2:14153763-14153785 TACAGTCAATAAAGAGGCTCAGG + Intergenic
926736079 2:16074190-16074212 TAGAGACAGGAGAGAAGCTCAGG + Intergenic
926981502 2:18576449-18576471 TAGAGAGAAAACATAAGGTCTGG - Intronic
928922628 2:36541429-36541451 TACAGAAGAAACTGAGGCTCAGG + Intronic
929382641 2:41370388-41370410 TACAAACCAAAAAGAAGCTTAGG + Intergenic
931060512 2:58523635-58523657 AACAAACAAAACAGAAGCTCCGG + Intergenic
931068090 2:58610496-58610518 TACAGAGAAAACAGAACTTCAGG - Intergenic
931243004 2:60469004-60469026 TGAAAACAAAACAGAAACTCTGG - Intronic
931293953 2:60903829-60903851 TACAAAAAATACAGAAACTCTGG - Intronic
932134085 2:69213464-69213486 TACAGAAAAAATAGAAGCTCTGG - Intronic
932153927 2:69398287-69398309 TAAAGCAAAAACAGAAGCTTTGG + Intronic
933682616 2:85115723-85115745 TACAGACAAATCAGCTGCTAAGG - Intergenic
935500817 2:103836173-103836195 TACAGTCTAAACAATAGCTCAGG - Intergenic
936433113 2:112481714-112481736 CACAAACAAAACCGACGCTCCGG + Intergenic
936658298 2:114513652-114513674 AACAGACAAAATAAAAGCTTTGG + Intronic
937944342 2:127318840-127318862 GAGAGACAGAACAGAAGCACTGG + Intronic
938790140 2:134669227-134669249 TCCAGGGGAAACAGAAGCTCAGG - Intronic
940448122 2:153802830-153802852 TCCTGTCAAAATAGAAGCTCAGG + Intergenic
940833423 2:158493731-158493753 CACTCACAAAACAGAAGCCCAGG - Intronic
943006509 2:182392920-182392942 CACAGACACAACACTAGCTCAGG - Intronic
943113384 2:183636235-183636257 TACAGGCAACACATAACCTCAGG - Intergenic
943365827 2:186966840-186966862 TACAGAATAAACTGAGGCTCAGG - Intergenic
943694621 2:190912305-190912327 TAAAAACAAAACAAAAACTCAGG - Intronic
945027539 2:205633343-205633365 TCTACACAAAAGAGAAGCTCAGG - Intergenic
947392610 2:229654550-229654572 GGCAGACAAAACATAACCTCTGG - Intronic
948935018 2:241158215-241158237 TATGCACAAAACATAAGCTCAGG - Intronic
1168805170 20:668474-668496 TTCAGAGAAAAGAGAATCTCAGG + Intronic
1168915413 20:1481472-1481494 TACAGACAAAAAGGAAACTCGGG - Intronic
1170041353 20:12043210-12043232 TACAGAAAGAACAGAGGCTTGGG + Intergenic
1170412867 20:16109168-16109190 TACAGAGGAAACAGAAGATGAGG - Intergenic
1172323633 20:34017432-34017454 TACAGACTGAACGGGAGCTCAGG + Intronic
1173011357 20:39185858-39185880 TATAGACAAAACAGAGCCTGGGG + Intergenic
1173167965 20:40699426-40699448 CACAGATATAACAGATGCTCTGG - Intergenic
1175416691 20:58805820-58805842 TACAGACCAGCCAGAAACTCAGG + Intergenic
1177004598 21:15656077-15656099 TACAGACAAAACTGGAGTTCAGG + Intergenic
1177195767 21:17901923-17901945 TCCAGACAAAAGAGAATCTGTGG - Intronic
1178092799 21:29182292-29182314 TACAGGCAAATAAGAAGCTGGGG - Intergenic
1178747209 21:35264593-35264615 TGAAGAGAAAACAGAAGCTCAGG - Intronic
1179299562 21:40094461-40094483 TACACACAAAGGACAAGCTCTGG + Intronic
1180671761 22:17559047-17559069 TAAGGACAAAACAGGAGTTCTGG - Intergenic
1182114842 22:27750265-27750287 AACAGACAAAACAAAATCCCAGG + Exonic
1182769434 22:32783385-32783407 TCCTGAAAAACCAGAAGCTCCGG - Intronic
1184189351 22:42884660-42884682 CAAAGAAAAAACAGGAGCTCTGG + Intronic
1184264212 22:43338224-43338246 TAGAGAGAAAAGAGCAGCTCTGG - Intronic
1184604530 22:45564583-45564605 GACAGAGAAAACAGAAGCCAGGG - Intronic
950464293 3:13144203-13144225 AGCCGACAAAACAGAGGCTCAGG + Intergenic
951448299 3:22807649-22807671 TAGAGACAAAACACATGCACTGG + Intergenic
951776053 3:26311530-26311552 TAAAGGCAAAACAAAAGCTATGG - Intergenic
952069320 3:29615030-29615052 GAAAAACAAAACTGAAGCTCAGG + Intronic
953533344 3:43757656-43757678 GGCAGAGAAAACAGCAGCTCTGG - Intergenic
955102349 3:55862654-55862676 TACAGAGAAAAGAGGATCTCTGG + Intronic
955689967 3:61581369-61581391 TCCACACACAACAGAAGCCCTGG + Intronic
959737992 3:109683063-109683085 TAAAGACAAAACAAAAGGCCAGG + Intergenic
960275430 3:115723759-115723781 TACAGACAATACACAAAGTCAGG + Intergenic
960382278 3:116978191-116978213 TAGAGACAAGACCTAAGCTCAGG - Intronic
960702874 3:120453789-120453811 TCCAAATAAAACTGAAGCTCAGG + Intergenic
961934704 3:130570985-130571007 TCCAGATAAAACAGCACCTCTGG - Exonic
962021037 3:131502374-131502396 TACAGATAAAACTGAAGGTTAGG - Intronic
962286066 3:134086422-134086444 TACAGATGAAAAAGAGGCTCAGG - Intronic
962809927 3:138951012-138951034 CACAGACCACAGAGAAGCTCAGG + Exonic
963455744 3:145544360-145544382 AACAAACAAAAAAGAAGCCCAGG - Intergenic
963524303 3:146396906-146396928 TACAGAAAAAATAAAAGCTATGG + Intronic
966280102 3:178216029-178216051 CACAGACAAATCAGAGTCTCTGG + Intergenic
966563681 3:181351958-181351980 TACAGTCATAACAGAAGATGAGG - Intergenic
967924988 3:194638984-194639006 AACAAACAAAACAGAAGCAATGG + Intergenic
969208001 4:5663404-5663426 TGCAGAGAAAACAGAGGCTCAGG - Intronic
969540679 4:7787200-7787222 TACACACAGTCCAGAAGCTCCGG - Intronic
969735097 4:8983061-8983083 TGCAGAGAAATCAGAATCTCAGG - Intergenic
970598352 4:17620318-17620340 TACGAAGAAATCAGAAGCTCTGG - Intronic
970696019 4:18678054-18678076 TACAGACAATAAGGAAACTCAGG - Intergenic
971047959 4:22827157-22827179 AAAAGACAAAACATAAGCGCTGG - Intergenic
972399086 4:38683554-38683576 AAAAAAAAAAACAGAAGCTCGGG - Intronic
972739410 4:41876506-41876528 AACAAACAAAACAGAAAATCAGG - Intergenic
973167467 4:47095270-47095292 GACAGACCAAGCAGAAGCACTGG + Intronic
974753508 4:66172143-66172165 CACAGACAAAATAGAAGCCATGG - Intergenic
977337923 4:95721420-95721442 TAAAGACAACACAGAGGCTTTGG - Intergenic
977978365 4:103293837-103293859 CAAAGACCAAACAAAAGCTCAGG - Intergenic
978291593 4:107148383-107148405 TACAGAGGAAAGAGAAGCACTGG - Intronic
979864588 4:125737712-125737734 AACAAACAAAAAAGAAACTCTGG + Intergenic
979867182 4:125771233-125771255 TTCAGACAAAAATGAAACTCAGG + Intergenic
981664371 4:147206411-147206433 TACATAAAAAAGATAAGCTCAGG + Intergenic
981718977 4:147779771-147779793 TACAGACAAAACAAAAGGCATGG - Intronic
982920205 4:161265131-161265153 TTCAGACTAAACTGAAGTTCAGG + Intergenic
983179721 4:164633403-164633425 GACAGAGAAACCAGAATCTCTGG + Intergenic
983371460 4:166864796-166864818 TACCAACAAAAAAAAAGCTCAGG + Intronic
984104766 4:175531649-175531671 CACAGAAACAACAGAAGCTTGGG + Intergenic
984436020 4:179711333-179711355 TACAGAAAAAACAAAAGATGTGG + Intergenic
985923678 5:2999431-2999453 TACAGACAAGACAGAAAATGTGG + Intergenic
985944043 5:3162913-3162935 TCCAGACAAACCAAAAGCTGTGG - Intergenic
986694437 5:10339406-10339428 CACAGACCAAACAGAAGGCCTGG + Intergenic
987461462 5:18216422-18216444 TGCAGACAAAACTGAGGCACAGG + Intergenic
988420620 5:31001399-31001421 TAAAGATAAATCAGAAACTCTGG + Intergenic
988932676 5:36052286-36052308 AACAGAAAGAACAGAGGCTCTGG - Intronic
989404883 5:41049379-41049401 TGCAGAATACACAGAAGCTCTGG - Exonic
990751491 5:59021638-59021660 TACAGGGAAAACAGAGGCTCAGG + Intronic
990814925 5:59773314-59773336 TAGAGTCAAAATAGAGGCTCTGG - Intronic
990954589 5:61330637-61330659 TACAGTAAAAACAGAAGGTGGGG + Intergenic
992071004 5:73149138-73149160 ACCACACAAAACAGCAGCTCTGG + Intergenic
992281908 5:75187096-75187118 CACACACAAAACAGAATCACCGG - Intronic
992408310 5:76480448-76480470 TGCAGAGAAAAGATAAGCTCTGG - Intronic
994105397 5:95942224-95942246 TATAGAGAAAACATAAGCTGAGG - Intronic
994650750 5:102524193-102524215 TGCACACAAACCAGAAGATCTGG + Intergenic
995208816 5:109513721-109513743 TAAAAAAAAAACAGAAGTTCAGG - Intergenic
995365966 5:111360760-111360782 TTCAGAGAAAAGTGAAGCTCTGG + Intronic
995447324 5:112259716-112259738 TACAGAGAAAACATATGCTGAGG + Intronic
995669594 5:114586776-114586798 TATAGACAAAAGAAAAGGTCAGG + Intergenic
995907870 5:117147568-117147590 TACAGACAAAAAGGAAACTTTGG + Intergenic
996579356 5:125013636-125013658 GACAGAGAAAACAGAAAATCTGG + Intergenic
997410711 5:133688817-133688839 TAGGGACAAAACAGAAAGTCCGG - Intergenic
997561916 5:134853488-134853510 TACAGACAAAATAGAGACTTTGG + Intronic
997937837 5:138129975-138129997 TACTGACAAAACATATGCTGAGG - Intronic
998434724 5:142097701-142097723 AACAAACAAAACAAAAACTCAGG + Intergenic
998540790 5:142979668-142979690 TACAGCCAGAACAGAAGCTGGGG - Intronic
999344664 5:150805759-150805781 TACATATAAAATAGAAGCTTAGG + Intergenic
1000428506 5:161121149-161121171 TAGAGACAGAACATCAGCTCTGG - Intergenic
1000572957 5:162937247-162937269 TACAGACAAATCAGAAAGTTAGG - Intergenic
1002034802 5:176459513-176459535 AACAAACAAAAAAGAAGCTGAGG - Intronic
1003230607 6:4249591-4249613 TACATAGATAACAGAAACTCAGG + Intergenic
1003559993 6:7172407-7172429 TACAGAAAAAAAAGAAGCCGGGG - Intronic
1006179329 6:32144906-32144928 AACAAACAAAAAAGAATCTCTGG - Intergenic
1008400829 6:51060485-51060507 TTCAGATAAAATAGCAGCTCTGG + Intergenic
1008416629 6:51248248-51248270 TACAGCCACCAAAGAAGCTCAGG + Intergenic
1009253428 6:61342047-61342069 TAAAAACTAAACAGAAGCTTTGG + Intergenic
1009258114 6:61443868-61443890 TAAAAACTAAACAGAAGCTTTGG + Intergenic
1009492981 6:64314736-64314758 CAAAGACACAACAGAATCTCTGG + Intronic
1009800358 6:68528799-68528821 ATAAGACAAAACAGAAGATCTGG + Intergenic
1010085160 6:71908610-71908632 TACAGACAAAACGGTAACCCTGG + Intronic
1010830046 6:80516174-80516196 TAGAGACAGAACAGAATGTCTGG + Intergenic
1013268181 6:108520858-108520880 TACAGAAAAGACAGAGGCTTAGG - Intronic
1013755616 6:113458201-113458223 AGAAGACAAGACAGAAGCTCAGG - Intergenic
1014429740 6:121353946-121353968 TACAGAGAGAAGAGAAGCTTTGG + Intergenic
1015409840 6:132881400-132881422 TACAAACAAAACACAATATCTGG - Intergenic
1015694344 6:135963838-135963860 TAGAGAAAAAACAGAAGCAGAGG - Intronic
1016665931 6:146640274-146640296 TACCAACCAAACAAAAGCTCGGG + Intronic
1017062410 6:150496674-150496696 AACGGACAAAACAGCAGATCTGG - Intergenic
1018001909 6:159586925-159586947 AACAAAAAAAACAGAGGCTCAGG + Intergenic
1018096863 6:160395038-160395060 TACAGAAAACACAGAAGGGCAGG + Intronic
1018456453 6:163957994-163958016 TACAGAGAAATCACAAGATCTGG - Intergenic
1018857872 6:167688431-167688453 TGCAATCAGAACAGAAGCTCTGG + Intergenic
1022292698 7:29019632-29019654 GACACACAAAACAGAAGCATGGG - Intronic
1023195525 7:37634818-37634840 CATAGAAAAAACAGAACCTCAGG - Intergenic
1024034064 7:45492091-45492113 TACCAACCAAAAAGAAGCTCAGG - Intergenic
1024551329 7:50564927-50564949 TACAGAAGAAACAGAGGCTGGGG + Intronic
1027427601 7:78077094-78077116 TACAGAAAAATGAAAAGCTCAGG + Intronic
1027866978 7:83660808-83660830 ATCAGGCAAAACACAAGCTCTGG + Intergenic
1027924052 7:84437017-84437039 CACAGACAAAACAGAATTGCAGG + Intronic
1028182739 7:87745439-87745461 TACCAACAAAAAAGAAGCTGAGG - Intronic
1028723698 7:94062680-94062702 TAGAGGTAAAACAGAAGTTCTGG + Intergenic
1028893268 7:96012569-96012591 TAAAGCCAAAACATAAACTCAGG + Intronic
1029551283 7:101238340-101238362 CACTGACAGAGCAGAAGCTCAGG - Exonic
1031377891 7:121050070-121050092 AACCAACAAAACAGAAGCTTTGG - Intronic
1033514026 7:142088303-142088325 AACAAACAAAACAGAAGCTGGGG + Intronic
1033716600 7:144009308-144009330 TACATACAAAAGAGAAGCAGAGG + Intergenic
1036197965 8:6737744-6737766 TAAAGATTAAACAGAAGATCTGG - Intronic
1036235889 8:7039221-7039243 TACAGACTAGACAGAAGGACAGG - Intergenic
1036475465 8:9089173-9089195 TACAGGCAACAAAGAAGCACAGG - Intronic
1036511161 8:9401690-9401712 TACAAACAAAATAGAAGCAGCGG + Intergenic
1036819390 8:11927899-11927921 TGCAGAGAAATCAGAATCTCAGG + Intergenic
1037379191 8:18266146-18266168 TACTGAAAAAGCAGAAACTCTGG + Intergenic
1037869537 8:22480111-22480133 TAGAGACAAAACAGTAACTGTGG + Intronic
1038471846 8:27830321-27830343 AAAAGACAAAATAGAAGCTTAGG + Intronic
1039697600 8:39929236-39929258 TACAGACATAACTTGAGCTCAGG - Intergenic
1041029014 8:53717254-53717276 GACAGAAAAGACAGAAGCACTGG + Intronic
1042504509 8:69545509-69545531 TAAAGAGAGAAAAGAAGCTCAGG - Intronic
1043032083 8:75148969-75148991 GACACACAAAACAAAATCTCAGG + Intergenic
1043109763 8:76166158-76166180 TACAGAAAAAAAAAAAACTCAGG - Intergenic
1043721592 8:83551418-83551440 AACAAACAAAACAGAATTTCTGG + Intergenic
1043944398 8:86232987-86233009 TAGAGACAAAATAGAAGCATGGG + Intronic
1044614423 8:94125125-94125147 TACACCCAAAACAGGAGCACCGG - Intergenic
1044788080 8:95817605-95817627 TTCAGACAAAACAAATGCTGAGG - Intergenic
1045950752 8:107849157-107849179 GACAGACAAAACCAAAACTCAGG + Intergenic
1047711033 8:127552692-127552714 TTAAGACAAAACAGAGCCTCAGG - Intergenic
1048019043 8:130521399-130521421 TGCAGCCAACACAAAAGCTCCGG + Intergenic
1049823127 8:144648243-144648265 TACAGTCAAGACAGGAGCTATGG - Intergenic
1050235933 9:3580236-3580258 TAAAAACTAAACATAAGCTCAGG + Intergenic
1050466001 9:5924688-5924710 TATAGACTCAACAGAACCTCTGG - Exonic
1051115322 9:13687498-13687520 TAAAAACAAAATAGCAGCTCAGG + Intergenic
1052061223 9:23963328-23963350 TACCAACAAAAAAGAAGCCCAGG - Intergenic
1052897131 9:33758136-33758158 AACAGATCAAAGAGAAGCTCTGG - Intronic
1060127362 9:121061215-121061237 CACACACAAAAAAGTAGCTCTGG + Intergenic
1060555850 9:124506882-124506904 CAGAGACAACACAGAAACTCAGG + Intronic
1060691802 9:125668291-125668313 TACAGATAAGACAAAGGCTCAGG - Intronic
1061797520 9:133096453-133096475 TAAAAACCAACCAGAAGCTCCGG - Intergenic
1188350007 X:29117477-29117499 TACAGATAAAGCACAAGCTTTGG + Intronic
1190130780 X:47747090-47747112 AACAAACAAAACAAAAACTCTGG - Intergenic
1192163706 X:68809384-68809406 CACAGATCAAACAGAAGCTCAGG + Intergenic
1193609152 X:83607427-83607449 CACACACAAAACAGAACATCTGG + Intergenic
1195479867 X:105332130-105332152 GACATATAAAACAGAATCTCAGG + Intronic
1195673053 X:107485039-107485061 TACAGAACAAACAGAATCTGGGG - Intergenic
1196270435 X:113704360-113704382 TACAGCCAGAAGAGAGGCTCAGG + Intergenic
1196622244 X:117837070-117837092 AACAGAGAAAGCAGAAACTCAGG + Intergenic
1197516283 X:127433878-127433900 TACCGACCAAAAAGAAGCCCAGG - Intergenic
1199788651 X:151128939-151128961 TGCAGACAATGCAGAAGTTCAGG - Intergenic
1201778506 Y:17692712-17692734 TACCAACAAAAAAGAAGCCCAGG - Intergenic
1201823050 Y:18213280-18213302 TACCAACAAAAAAGAAGCCCAGG + Intergenic
1202065224 Y:20932326-20932348 GACACACATAACAGAATCTCTGG + Intergenic
1202187900 Y:22207230-22207252 GACAGGCAAATCAGAAGGTCAGG - Intergenic
1202203460 Y:22379166-22379188 GACAGGCAAATCAGAAGGTCAGG + Intronic