ID: 1089312690

View in Genome Browser
Species Human (GRCh38)
Location 11:117570336-117570358
Sequence CTGTCTAAGGAGAAGCAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 320}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089312690_1089312692 23 Left 1089312690 11:117570336-117570358 CCGTTCTGCTTCTCCTTAGACAG 0: 1
1: 0
2: 2
3: 30
4: 320
Right 1089312692 11:117570382-117570404 GTCCCCCTCTGTCCCTTTACTGG 0: 1
1: 0
2: 1
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089312690 Original CRISPR CTGTCTAAGGAGAAGCAGAA CGG (reversed) Intronic
904392073 1:30192546-30192568 GTGGCTGTGGAGAAGCAGAAAGG - Intergenic
904536269 1:31201714-31201736 TTGCCTAAGGGGACGCAGAACGG + Intronic
905503479 1:38457619-38457641 CTTTCTAACGAGTGGCAGAATGG - Intergenic
905847697 1:41246499-41246521 CTTTATAAGGAGCAGCTGAAAGG + Intergenic
905969161 1:42128031-42128053 CTGGCTAAGGACAACAAGAAAGG - Intergenic
906266987 1:44439658-44439680 CTTTCTAAGGATAAGCCAAAAGG - Intronic
906732780 1:48097595-48097617 CTCACTGAGGAGAAGCAGATTGG - Intergenic
906948616 1:50316593-50316615 CTTTCTGAGGAGGGGCAGAAAGG + Intergenic
908074191 1:60496179-60496201 CCTTCTAAGGAGAAACAGGAAGG - Intergenic
908862608 1:68506691-68506713 ATGACCAAAGAGAAGCAGAAAGG + Intergenic
909499449 1:76317811-76317833 CTGTCTAAAGAAAAGTGGAATGG + Intronic
910553249 1:88500427-88500449 CTGCCAAAGGAGAGGTAGAAGGG + Intergenic
911045963 1:93628564-93628586 ATGTCTAAGGGGAAGAAGAAGGG - Intronic
911175043 1:94810282-94810304 GTGTCCAAGGAGAAGCATTATGG + Intergenic
912553972 1:110502795-110502817 CTGTCTCAGGAGAGCCAGGATGG - Intergenic
915909982 1:159908917-159908939 CTGTCTAAGAACAACGAGAAAGG + Intergenic
918428321 1:184433244-184433266 CACTCTGAGGAGAAGAAGAAAGG - Intronic
919324558 1:196090290-196090312 CTGTCTGAGGTGAAGCAGAAAGG + Intergenic
919522880 1:198611084-198611106 CTGGTGAAGGACAAGCAGAAGGG - Intergenic
919538339 1:198816245-198816267 TAGGCTAAGGAGAAGTAGAAAGG - Intergenic
920180533 1:204129503-204129525 CTGTCTCATGAGAGGCAGGATGG + Intergenic
920240959 1:204550077-204550099 CTGTCTGAAGAGGGGCAGAAGGG - Exonic
920831059 1:209466169-209466191 CTTTCAAAGGAGAAACAGAATGG + Intergenic
921218958 1:212959884-212959906 CCACTTAAGGAGAAGCAGAAAGG - Intronic
921698708 1:218243291-218243313 ATGGCTATGGAGATGCAGAAAGG + Intergenic
922135733 1:222824421-222824443 GTGTATAAGCAAAAGCAGAAGGG - Intergenic
924883403 1:248187751-248187773 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883415 1:248187816-248187838 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883427 1:248187881-248187903 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883439 1:248187946-248187968 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883491 1:248188207-248188229 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883503 1:248188272-248188294 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883515 1:248188337-248188359 CTCTCTGAGCAGAAGCAGGAGGG + Intergenic
924883527 1:248188402-248188424 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883539 1:248188467-248188489 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883551 1:248188532-248188554 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883563 1:248188597-248188619 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883575 1:248188662-248188684 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883599 1:248188792-248188814 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
1062987374 10:1781435-1781457 CTGCATATGGAGCAGCAGAAGGG - Intergenic
1064602214 10:17005522-17005544 TTTTCTAAGTAGAAGCAGCAAGG - Intronic
1064963769 10:20994902-20994924 CTGTCTCAGGAGTGGCAGAGAGG + Intronic
1065159341 10:22903020-22903042 CAGTCTCAGCAGCAGCAGAATGG + Intergenic
1066005130 10:31140035-31140057 CTGTCTCATGAGAAGCAGCAAGG - Intergenic
1067659406 10:48223291-48223313 GTGTGGAAGGAGAAGCAGTAGGG + Intronic
1069664345 10:70145034-70145056 CTTTCAGAGGAGAAGCAGCAGGG + Intronic
1070678335 10:78431072-78431094 CTGTGGAAAGAGAAGCAGAGAGG - Intergenic
1071324692 10:84501428-84501450 CTAGCTGAGGAGAAGGAGAAAGG - Intronic
1073474398 10:103743365-103743387 TGGTCCAAGGAGAAGCAGACTGG + Intronic
1073779220 10:106818826-106818848 TTGTCAAAGGAGAAGGGGAAAGG - Intronic
1074204907 10:111274698-111274720 TTGTCTAAGGGGGAGCAGCAGGG + Intergenic
1074271150 10:111955112-111955134 CTGCCTAATGACAGGCAGAATGG + Intergenic
1074774724 10:116758979-116759001 CTGTCTGGGGTGCAGCAGAAGGG - Intergenic
1074944892 10:118271761-118271783 CTGCCTCAGCAGAAGCAGCAGGG - Intergenic
1075120108 10:119658658-119658680 CTGTGACAGGAGTAGCAGAAAGG + Intronic
1076507042 10:130985009-130985031 TTGTCTCCGGAGAAGCAGAAGGG - Intergenic
1077793238 11:5463789-5463811 CTGTCTAAAGAGATACAGGAGGG + Intronic
1080001704 11:27358120-27358142 CTGTCTAAGGATTGGCAAAAGGG - Intronic
1081026166 11:38018041-38018063 CTCTCTAAGGCAAACCAGAATGG + Intergenic
1081068922 11:38584946-38584968 GGGTCTAGGGAGAAGCATAAAGG - Intergenic
1081156089 11:39692888-39692910 CTGTCTCAGGAGTAGCAGAAGGG - Intergenic
1083229902 11:61310176-61310198 CTGTCCTAGGAGGAGCAGAAAGG - Intronic
1084089786 11:66871905-66871927 AGGTCCTAGGAGAAGCAGAAAGG + Intronic
1084553224 11:69861392-69861414 TTGTCAAAGTAAAAGCAGAAAGG - Intergenic
1085324527 11:75596442-75596464 CTCTCTAAGGAGATGCAGTTGGG - Intronic
1085944968 11:81258399-81258421 ATGTCTATTGAGGAGCAGAAAGG + Intergenic
1087805743 11:102553253-102553275 CTGTCTCAGGAGAGGCTTAATGG + Intergenic
1089073094 11:115716366-115716388 CTTTCTAAGGGGAAGGAGAGAGG + Intergenic
1089312690 11:117570336-117570358 CTGTCTAAGGAGAAGCAGAACGG - Intronic
1091028329 11:132161283-132161305 CTGTCTATGGAAAGGAAGAAGGG - Intronic
1091523379 12:1270864-1270886 AATTCTAAGGAGAAGTAGAATGG + Intronic
1092045252 12:5427696-5427718 CTGTGTAAGGACTAGCAGATCGG + Intergenic
1093115782 12:15209145-15209167 TTGTCTTTGGAGAAGCAGCATGG - Intronic
1093216315 12:16366048-16366070 TTCTCTGAGTAGAAGCAGAATGG + Intronic
1096100136 12:48965860-48965882 GTGTCTAAGGAGCAGAAGAGGGG + Exonic
1096594817 12:52688204-52688226 CTGTCTGAAGGGAAGCAGAGAGG - Intergenic
1096618021 12:52845366-52845388 CTGTCTGAGGAAATGCAGGAAGG - Intronic
1097397883 12:59098200-59098222 CTTTTTGAAGAGAAGCAGAATGG + Intergenic
1097776855 12:63657332-63657354 CTTTCTAGGGAGCAGCACAAAGG - Intronic
1099586381 12:84522038-84522060 CTGTCTGAGGAAAAGTAGACAGG - Intergenic
1101494344 12:105239397-105239419 CTCTTTGAGGAGGAGCAGAAAGG + Intronic
1102485648 12:113253785-113253807 CTGTGTGTGGAGAAGCAGCAAGG + Intronic
1102730691 12:115106296-115106318 CAGTCTAAGAAGAAACATAAAGG - Intergenic
1103669700 12:122603301-122603323 ATCTTTAAGGAGAAGCAGGATGG + Intronic
1104372065 12:128232239-128232261 CTGGCTAAAGAGGAGAAGAAAGG + Intergenic
1104570920 12:129924907-129924929 CTGTCTGAGGAGCTGCAGACAGG + Intergenic
1105409809 13:20161686-20161708 GTGTCTGAAGAGAAGCAGGATGG - Intergenic
1106489078 13:30200434-30200456 CTTTCTAATGATAAGCAGAAAGG - Intergenic
1107425742 13:40291086-40291108 ATCTCTCAGGAGAAGCAGGAGGG + Intergenic
1107495302 13:40920461-40920483 CTGTGTATGGAGCAGCAAAAAGG - Intergenic
1109117968 13:58413824-58413846 CTGTTTATGGAAAAGAAGAATGG + Intergenic
1111067614 13:83117137-83117159 TTGTCTCAGGAGAAGGACAAAGG - Intergenic
1111452159 13:88433691-88433713 CAGACTAAGGAGAATCTGAATGG - Intergenic
1112605680 13:100903788-100903810 CTGTTTGAGGAGAAGCACATAGG - Intergenic
1114058042 14:18992022-18992044 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
1114104506 14:19409732-19409754 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
1114441129 14:22748902-22748924 CTGTCAAAGGAGAAGGGGCACGG + Intergenic
1114785134 14:25588168-25588190 CTTTCTAAGGCCAAGCACAATGG + Intergenic
1116693395 14:48140609-48140631 CTGTCCTATGAAAAGCAGAAAGG - Intergenic
1118130573 14:62958402-62958424 GTGTCTGAGGAGAAGTAGAAAGG - Intronic
1119536771 14:75409213-75409235 AGGTTTCAGGAGAAGCAGAAAGG - Intergenic
1120002655 14:79320492-79320514 CTGTCTAACCAGTAGCATAATGG + Intronic
1121328121 14:93033665-93033687 GTGTCTAAGGAAAGGCAGAGAGG + Intronic
1125088070 15:35754681-35754703 TTGTCTAGGGAGAATCAGAGAGG - Intergenic
1126438849 15:48665207-48665229 CTGTCTATCCAGAAACAGAAAGG + Intergenic
1127208491 15:56745801-56745823 CTATCTATAAAGAAGCAGAAGGG - Intronic
1127524336 15:59777297-59777319 CTGCCTAAGTGGAAGGAGAATGG - Intergenic
1127823930 15:62686632-62686654 CTGTTTCAGGAGAAGATGAAAGG + Exonic
1128545298 15:68562329-68562351 CAGTCTCAGGAGAAGAGGAAGGG - Intergenic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1129529447 15:76251622-76251644 CTGTCTCAGGAAAATGAGAAAGG + Intronic
1129910801 15:79224553-79224575 CTGCCAAAGGGGAAGCAGAATGG - Intergenic
1131768267 15:95705114-95705136 CTCTCTAAGGAGAAGTACATAGG - Intergenic
1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG + Intergenic
1133401884 16:5494084-5494106 GTGAGTAAGGACAAGCAGAAAGG - Intergenic
1135246254 16:20859858-20859880 CTGTCCCAGGAGCAGCAGCAAGG - Exonic
1136276771 16:29183444-29183466 GGGTGTCAGGAGAAGCAGAAAGG - Intergenic
1136401816 16:30023413-30023435 CTGTCTTGGGAGCAGCAGGAAGG + Intronic
1137054790 16:35739425-35739447 CTGTGTAAGAATAAGAAGAAAGG + Intergenic
1137782124 16:51106360-51106382 ATGACTTAGGAGCAGCAGAATGG - Intergenic
1139256238 16:65545565-65545587 TGGTCTCAGGAGAAGTAGAAAGG - Intergenic
1139717151 16:68822746-68822768 TTGGCCAAGGAGAAGCACAAGGG + Intronic
1139803602 16:69544609-69544631 GTTTCTAAGGGGAAGGAGAAAGG + Intergenic
1140951249 16:79819858-79819880 ATGTCTTAAGAGAAGCAGAGTGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141417909 16:83891050-83891072 CTGAGTAAAGAGAAGCGGAATGG - Intergenic
1142081151 16:88149504-88149526 GGGTGTCAGGAGAAGCAGAAAGG - Intergenic
1146753862 17:35408788-35408810 CTGTTTAATGAGAAGCAGTGGGG - Intergenic
1148686722 17:49505244-49505266 ATGTGGAAGCAGAAGCAGAAAGG - Intronic
1149133040 17:53330702-53330724 CATTCTCAGGAGAAGCATAAAGG + Intergenic
1150830003 17:68511357-68511379 CTGTCTAAGGAGGAAGAAAAGGG - Intergenic
1152865164 17:82718000-82718022 GTGTCTCAGGAGAAAAAGAAAGG + Intronic
1152927817 17:83095646-83095668 CTGGCTGAGGAGAAGACGAAGGG - Intergenic
1153405395 18:4733054-4733076 CAGTCTTAGGGGAAGGAGAAGGG - Intergenic
1153746983 18:8189424-8189446 CTGTCCATGGAGATGCAGAGTGG - Intronic
1155530050 18:26757936-26757958 CTGACAAAGGAGAAGGAAAATGG - Intergenic
1156504506 18:37580805-37580827 CAGTGTAAGGAGAATGAGAAAGG - Intergenic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1156895698 18:42243021-42243043 CTGTGTAATGTGAAGCACAAAGG - Intergenic
1157995375 18:52548364-52548386 CAGTCTCAGGAAAAGCAGGATGG - Intronic
1158013354 18:52754735-52754757 CAGTCCAAAGAAAAGCAGAATGG - Intronic
1158172256 18:54613235-54613257 ATGTCTAAGAAAAAGCATAATGG - Intergenic
1158596416 18:58820364-58820386 CTCTCAGAGGAGAAGGAGAAAGG - Intergenic
1160900170 19:1424041-1424063 CCGTCTCAGAAGATGCAGAAAGG - Intronic
1161359455 19:3839110-3839132 CTCTCCCAGGAAAAGCAGAAGGG + Intronic
1162218674 19:9157848-9157870 CTGACTTAGGAGCAGCAAAATGG - Intronic
1164468662 19:28509987-28510009 ATGGCCAAGGAGAAGCATAAGGG + Intergenic
1164528113 19:29026667-29026689 GTGTCCACTGAGAAGCAGAAAGG - Intergenic
1164695638 19:30241579-30241601 CTGTCTAAGGAGCAGCAGTGTGG + Intronic
1164755155 19:30683808-30683830 CTGTCTAAGGTGTTACAGAATGG - Intronic
1165161107 19:33816946-33816968 CTGTCTCTGGAGAATCAGGAGGG - Intergenic
925027289 2:620133-620155 CTGTCCAAGCAGGAGCTGAAGGG - Intergenic
926715061 2:15917852-15917874 GGGTCTAAGGAGAAGTAGATGGG - Intergenic
926799588 2:16648083-16648105 CTGACTAATGAGACACAGAAAGG + Intronic
927772050 2:25871348-25871370 CTGTGGATGGGGAAGCAGAAAGG + Intronic
927796388 2:26052541-26052563 CTTTCTCTGGAGAAACAGAATGG - Intronic
927922767 2:26986214-26986236 CCTTATAAGGGGAAGCAGAAGGG - Intronic
928059304 2:28094701-28094723 CTGTCTATAGAGAACCGGAAAGG - Intronic
930250442 2:49028722-49028744 CAGTGTATGGAGAAGCACAATGG - Intronic
930505465 2:52278162-52278184 CTATCTGAGGAGAAAGAGAAGGG - Intergenic
932708544 2:74046259-74046281 CTGTCTAAAGAGAGAGAGAAGGG - Exonic
933479332 2:82835321-82835343 CTGTCTAGGAAGCAGCAAAACGG + Intergenic
934032573 2:88061580-88061602 ATCTCTTAGGAGATGCAGAATGG + Intergenic
935244478 2:101206256-101206278 CTGTCTAAAGAACTGCAGAAAGG + Intronic
936040362 2:109145178-109145200 CTGTCTCAGAAGCAGCAGAAAGG - Intronic
937482854 2:122280843-122280865 CTGCACAATGAGAAGCAGAATGG - Intergenic
938283177 2:130082204-130082226 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
938333810 2:130470770-130470792 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
938356007 2:130649897-130649919 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
938432433 2:131256696-131256718 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
940665775 2:156607518-156607540 CTGCCAAAGGTCAAGCAGAAGGG - Intronic
940670157 2:156657699-156657721 CTGTACAGGGAGAAGGAGAAGGG + Intergenic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941327417 2:164134065-164134087 CTGTCTAGGTAAAAGAAGAATGG - Intergenic
941818059 2:169817964-169817986 CTTTCTAAGGATAAGCAGCCAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942515068 2:176743470-176743492 GTGTCAAAGGAGAAGCAGATGGG + Intergenic
942917615 2:181330534-181330556 CTGTCAAAGGTTGAGCAGAAAGG + Intergenic
944186825 2:196958172-196958194 TTGGCTAAGGAGAAGAAGGAAGG - Intergenic
945562636 2:211357562-211357584 TTGTCCAAGGACAATCAGAAAGG + Intergenic
945897345 2:215498527-215498549 GTGACTCAGAAGAAGCAGAAAGG - Intergenic
946650440 2:221887477-221887499 ATGTGTAGGGAGAAGAAGAATGG + Intergenic
948116669 2:235498521-235498543 TTTTCTAAGGAGAACCAGAGGGG - Intronic
948451995 2:238081443-238081465 CCGTCTCCGTAGAAGCAGAAAGG + Intronic
949065598 2:241988371-241988393 CTCTCTAAGGCGAGGCAGGAGGG + Intergenic
1173033910 20:39390374-39390396 CTGCCTAAGCAGAAGCAGATTGG - Intergenic
1173150415 20:40562218-40562240 CTGTCTGGGGACAAGCAGACAGG - Intergenic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1173936917 20:46874562-46874584 CAGTCCAAGGAGAAGCCAAAGGG + Intergenic
1174092588 20:48061074-48061096 CTGGCTAAGGAGGAGGGGAATGG - Intergenic
1174219500 20:48942085-48942107 CTGTCAGAGGCGATGCAGAAAGG + Intronic
1176160650 20:63646166-63646188 GGGTGTAAGGAGGAGCAGAAAGG + Intronic
1177806649 21:25881716-25881738 CTGTCCAAGATGCAGCAGAACGG - Exonic
1178197609 21:30366439-30366461 CTGGCTAAGAAAAAGCAGAGTGG - Intronic
1179050951 21:37888215-37888237 GTGTCTGAGGGGAATCAGAAAGG - Intronic
1180476527 22:15714638-15714660 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
1180864379 22:19107529-19107551 CTGCCTAAGGAGAAGCCACAGGG - Intronic
1184248456 22:43247385-43247407 CTGGCTCAGGATAACCAGAAAGG + Intronic
1184644439 22:45888607-45888629 CTGTCCAGGGAGAGCCAGAATGG - Intergenic
1185216674 22:49603870-49603892 CTGTCTCAGGAGAAAAAAAAAGG + Intronic
1185341340 22:50292638-50292660 CTGGCTACGGAGCAGCAGAGCGG - Intronic
949152516 3:787277-787299 CTTTCTAAGAAGAACCACAATGG + Intergenic
950459210 3:13111255-13111277 CTCTCTAATGAGAAGCAGGAAGG - Intergenic
950528786 3:13540488-13540510 TTGGCTGAGGAGAAGCAGACAGG + Intergenic
951297447 3:20956212-20956234 CAGTCAAAGCAGAAGCAGACAGG + Intergenic
951570970 3:24062880-24062902 CTGCCTAAGCAGAAGTTGAAAGG + Intergenic
953501166 3:43435950-43435972 AGGTGTAAAGAGAAGCAGAAAGG + Intronic
955002232 3:54938121-54938143 GTGTCTGAGGGGCAGCAGAATGG + Intronic
955227674 3:57074381-57074403 ATATCTAAGAAGATGCAGAAAGG - Exonic
956589930 3:70903989-70904011 CTGTCAAATGAGAATCAAAATGG - Intergenic
959418554 3:106105809-106105831 ATATCTAAGGAGAAGGAAAAGGG - Intergenic
960682644 3:120265073-120265095 ATGACTTAGGAGAAGCAGGAGGG + Intronic
960799665 3:121525447-121525469 CTGATGAAGGAGAAACAGAAGGG + Intronic
961077820 3:123998105-123998127 CTGTGTGAGGAGAGGCAGAGGGG - Intergenic
961121060 3:124370549-124370571 CTGTCAAAGCAAAAGCAGACTGG - Intronic
961306750 3:125963230-125963252 CTGTGTGAGGAGAGGCAGAGGGG + Intergenic
961379980 3:126490746-126490768 CTGACTAAAGAGAAGGAGTAGGG + Intronic
963433390 3:145237610-145237632 CTGGAGAAGGAGAGGCAGAATGG - Intergenic
964313060 3:155414620-155414642 ATGTCTAAGAACAAGCAGATTGG + Intronic
964501636 3:157354526-157354548 ATGAATAAGGAGAAGCAGCAAGG - Intronic
964851607 3:161102128-161102150 CTTTCTATGCAAAAGCAGAATGG - Intronic
966710376 3:182966495-182966517 CTCTCTGAGAAGAAGTAGAAGGG - Intronic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968079641 3:195837017-195837039 CGGTCAAAGGAGAACAAGAAGGG - Intergenic
968332702 3:197885179-197885201 ATGTCTGAGGAGCAGCAGGAGGG - Intronic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
969233503 4:5848819-5848841 CTTTATAAGGAGAAGAAGAGAGG - Intronic
969624640 4:8296197-8296219 CTGTCTCAGGAGAAAGAGAGAGG - Intronic
969824078 4:9742957-9742979 CTGTCTTAAGATAAGCAGAGAGG - Intergenic
970104688 4:12568355-12568377 CTGGCAAAGGAAAAGCATAAAGG - Intergenic
970166231 4:13241270-13241292 CATTCTAAGGAGAAGAAGCAAGG - Intergenic
970560693 4:17279352-17279374 CTCTATAAGGAGAAGGAGATGGG - Intergenic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
973537311 4:51896413-51896435 CTGTCTACGAAGAAGAAGAGCGG - Intronic
974253003 4:59413053-59413075 GTGTCCAAGGAGGAGCTGAATGG - Intergenic
975566057 4:75755590-75755612 CTGTCTGGGGAGAAGAAAAAAGG - Intronic
977449857 4:97181100-97181122 CTGATTAAGAAGAAGCTGAATGG - Intergenic
978071706 4:104480771-104480793 CTGTTTAAGGGAAATCAGAAAGG - Intronic
978615070 4:110586207-110586229 CTTTCTTGGGAGAGGCAGAATGG - Intergenic
978810989 4:112849713-112849735 CTGTATAAGGATTAGAAGAAGGG - Intronic
979124709 4:116954304-116954326 CTGTCTATGGAGAAGTAAAATGG - Intergenic
979671660 4:123366103-123366125 CTGTCCATGGAGGGGCAGAAGGG - Intergenic
979927364 4:126583669-126583691 CTGGCTGAGCAGAAGCAGAAGGG - Intergenic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
982519053 4:156390172-156390194 GTGTATAAGGAAGAGCAGAAGGG + Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
983790311 4:171789028-171789050 CAGACTAAGGAAAAGCTGAAAGG + Intergenic
984035097 4:174657407-174657429 TTGTATAAGGAGAAGGAAAAAGG + Intronic
984061752 4:174997282-174997304 CTGTCAAAGCAAAAGCAGATTGG - Intergenic
986157441 5:5190789-5190811 CTGTCTAAGGACAAGCAGCCGGG - Intronic
986292748 5:6412978-6413000 CTTTCTCAGGAAAGGCAGAATGG + Intergenic
988664458 5:33310099-33310121 CTGGCTAATGAGATGCAGAAAGG + Intergenic
988878190 5:35471435-35471457 CTGACTAAGGAGAAATTGAATGG - Intergenic
992701555 5:79346138-79346160 CTGTCTAAAAAAAACCAGAAAGG + Intergenic
992708421 5:79422584-79422606 TTGTCTCATGAGAAGTAGAATGG - Intronic
994703344 5:103166125-103166147 CAGTCAAAGCAGAAGCAGACTGG + Intronic
996249463 5:121311048-121311070 CTGTTTCAGGAGAAGTACAAAGG + Intergenic
997356944 5:133268608-133268630 CTGTCTCAGGATGAGCAGGAAGG - Intronic
998838291 5:146225865-146225887 CTGTCTAAAAAAAACCAGAAAGG - Intronic
999015036 5:148093412-148093434 CTGTCTAAGGTGAGGGTGAAAGG + Intronic
999929080 5:156410873-156410895 TTGTCCAGGGAGAAGAAGAAGGG - Intronic
1001223491 5:169924135-169924157 CTGTGCAGGGAGAAGCAGACTGG - Intronic
1001426537 5:171626162-171626184 TTTTCTAAGAAGAAGAAGAAAGG - Intergenic
1001775422 5:174325940-174325962 CTGTCTCCAGAGAAGCAGAAGGG + Intergenic
1002390726 5:178909679-178909701 CTGTCCCAGGAGCAGCAGCAAGG - Intronic
1002531815 5:179851421-179851443 CAGTCTGGGGAGAAACAGAAAGG + Intronic
1004491621 6:16122629-16122651 CAGGGTAAGGAGAAGCAGACTGG + Intergenic
1004553845 6:16675938-16675960 CTGCCAAAGGAGAAGCGGACAGG + Intronic
1004878395 6:19979470-19979492 CTGTCAAAGGTGAAGTAGAAAGG - Intergenic
1005172304 6:23002045-23002067 CTGCCCAAGGAGAAGCAGATAGG + Intergenic
1005257060 6:24014558-24014580 CTGGCTAATAAGGAGCAGAATGG + Intergenic
1005331762 6:24757597-24757619 CTGTCCCAGGAGAAGTAAAAGGG - Intergenic
1005562398 6:27054113-27054135 CTTTCTAATGAGAAACACAAAGG + Intergenic
1005947754 6:30606688-30606710 CTGTCAGAGGTGAAGCAGACTGG + Intronic
1006311878 6:33266847-33266869 CTGTCTAAGAGCAAGCTGAATGG + Intronic
1006906113 6:37534870-37534892 CAGGATAAGGAGAAGCAGAAAGG - Intergenic
1008228481 6:48953258-48953280 TTGGCTAAGGAGACGCATAAAGG + Intergenic
1011221428 6:85058309-85058331 AAGTCTCAGAAGAAGCAGAAGGG + Intergenic
1011738898 6:90339752-90339774 CAGTTTAAGGAGAAGCATATAGG + Intergenic
1012238143 6:96841612-96841634 CTCCCTAAGGAAAAGCAGAAAGG + Intergenic
1012745195 6:103078107-103078129 CTGTCAAAGGAGATGGAAAATGG - Intergenic
1014002538 6:116380937-116380959 CTGGCTAAGGTGAAGAAGGAAGG - Intronic
1014612258 6:123559918-123559940 CAGTCTAAGGGAAAGCAGAGAGG - Intronic
1014905592 6:127023275-127023297 TTGTCTAAGTAGAAACAGAAGGG - Intergenic
1015300917 6:131652163-131652185 TTGTCTAAGGACAAGCAGCAAGG - Intronic
1015996487 6:138999903-138999925 ATGTAGAATGAGAAGCAGAAAGG + Intergenic
1016556976 6:145349787-145349809 CTGTCTGAAGAGAAGCAGGATGG + Intergenic
1017702549 6:157089471-157089493 CATTCTTTGGAGAAGCAGAATGG + Intronic
1019067985 6:169318509-169318531 GTGTCCAAGGAGAATCAGAATGG + Intergenic
1020398404 7:7745239-7745261 CTGTCTCAGGAGTGGCAGAGGGG + Intronic
1020603692 7:10308119-10308141 CTGTGTGAGTAAAAGCAGAAAGG - Intergenic
1021327707 7:19294840-19294862 CTGTCTCTGGAAAATCAGAAAGG - Intergenic
1021595700 7:22314233-22314255 CTGGCTGAAGAGAAGCAGGAAGG + Intronic
1021827316 7:24568369-24568391 CTGTTTGAGGTGAGGCAGAAAGG + Intergenic
1022513513 7:30959700-30959722 CTGTCAAAGCAAAAGCAGACCGG + Intronic
1022629128 7:32069194-32069216 GTTTCTAAGGAGAAGCATTAAGG - Intronic
1022699822 7:32749279-32749301 CTTTCTAGGGAGCAGCACAAAGG - Intergenic
1022935774 7:35174991-35175013 CTTTCTAGGGAGCAGCAAAAAGG - Intergenic
1023097233 7:36673530-36673552 CTGTCTCAGGAAAAGAAAAAAGG + Intronic
1024291411 7:47807337-47807359 CTGTGTAAGGAGAACCAGGCAGG - Intronic
1024944957 7:54799192-54799214 CTGTGTGAGGAGACGCAGGATGG - Intergenic
1027940103 7:84667458-84667480 CTGACACAGGAGAAGAAGAAAGG - Intergenic
1028069775 7:86436886-86436908 CTATCTAAGGATTAACAGAATGG + Intergenic
1028240965 7:88420161-88420183 CTTTCTAGGGAGAAGGGGAAAGG + Intergenic
1029831732 7:103267728-103267750 CTTTCTAGGGAGCAGCACAAAGG - Intergenic
1031226096 7:119040011-119040033 CAGTGTTAGGAGAAACAGAAAGG - Intergenic
1032476220 7:132213229-132213251 ATGTCTAAGGGGAGGCAGGATGG + Intronic
1032584946 7:133137744-133137766 CTGGCAAAGGAGGGGCAGAAAGG + Intergenic
1033518338 7:142131908-142131930 CTGTCAAAAGAAAAACAGAAGGG - Intronic
1035438350 7:158876144-158876166 CAGTCTTAGGAGAAGGTGAAGGG + Intronic
1035892764 8:3363423-3363445 CTGCCTAGGGAAAAGAAGAAAGG + Intronic
1036223299 8:6938899-6938921 CTATCTAAGGCCAAGCAAAAAGG - Intergenic
1039179088 8:34843814-34843836 TTGTGTAAGGAGAATGAGAAGGG + Intergenic
1039777355 8:40750335-40750357 GTTACTAAAGAGAAGCAGAATGG + Intronic
1040683697 8:49844357-49844379 CTCTCTGGAGAGAAGCAGAATGG - Intergenic
1040993413 8:53376263-53376285 CAGTCTAAGGAGAGTCAGGAGGG + Intergenic
1042181395 8:66091281-66091303 CTGCCAAAGGAGAAGCACAGGGG + Intronic
1042191808 8:66194635-66194657 CTGGCCAACGAGCAGCAGAACGG + Intergenic
1043507604 8:80917924-80917946 TTGTCTAATGAGAAAAAGAATGG - Intergenic
1043814231 8:84782126-84782148 CTGCCTTGGGAGAAGCAGAAAGG - Intronic
1044861162 8:96525317-96525339 CTGTTAAAAGAGGAGCAGAAAGG - Intronic
1045883688 8:107070737-107070759 ATGTTTAAGGAAAAACAGAATGG - Intergenic
1046065098 8:109186883-109186905 ATGGCTCAGGAGAGGCAGAATGG - Intergenic
1046382268 8:113466914-113466936 CTCACATAGGAGAAGCAGAAGGG - Intergenic
1046762905 8:118040050-118040072 ATCTCAAATGAGAAGCAGAAAGG + Intronic
1047253264 8:123196742-123196764 CTGGCTAAGTAAAGGCAGAAGGG + Intronic
1048080545 8:131121875-131121897 CTCTCTCAGCAGAGGCAGAAGGG + Intergenic
1048563036 8:135563273-135563295 CTATTTAAGGAGCAACAGAAAGG - Intronic
1048720687 8:137320856-137320878 CTGACTAAGCACAAGAAGAAAGG - Intergenic
1051088763 9:13381842-13381864 ATGTCTAAGGAGACCCAGGAGGG + Intergenic
1052194541 9:25695497-25695519 CTGTCTAGGGATAAGAAAAAGGG + Intergenic
1052660564 9:31423880-31423902 CCGACTAAGTAGAAGTAGAATGG + Intergenic
1053242382 9:36506626-36506648 TTGTCTTAAGAGAAGAAGAAAGG - Intergenic
1053524359 9:38813596-38813618 CTTTGTAAGGTGAGGCAGAAAGG - Intergenic
1054196593 9:62038005-62038027 CTTTGTAAGGTGAGGCAGAAAGG - Intergenic
1054641812 9:67550680-67550702 CTTTGTAAGGTGAGGCAGAAAGG + Intergenic
1055364501 9:75528142-75528164 CTGTCCAAGAAGGAGCAGAGAGG + Intergenic
1057686543 9:97239678-97239700 CTGTGTATGGAGCAGCAAAAAGG + Intergenic
1059626563 9:116073384-116073406 CTGTGGATGGGGAAGCAGAAAGG + Intergenic
1059992516 9:119878615-119878637 CTGTCTCAGGAGAGGCCCAAAGG - Intergenic
1060041749 9:120306473-120306495 CTATCCAAAGAGAAGGAGAAGGG - Intergenic
1186249116 X:7646987-7647009 CTGTCTGGGAAGAAGAAGAAGGG - Intergenic
1186463477 X:9766084-9766106 AAGTGGAAGGAGAAGCAGAAAGG + Intronic
1187383267 X:18824485-18824507 CAGTCTTAGGAAAAGCCGAAGGG + Intronic
1189551797 X:42101205-42101227 TTGTCTAAGGAGAACCAGTTGGG + Intergenic
1189766628 X:44378713-44378735 CTTTCTAAGGATAAGCAGTTAGG + Intergenic
1191184765 X:57597828-57597850 ATGCCTGAGGAGAAGCAGAAAGG - Intergenic
1195086057 X:101415752-101415774 CTGGCTAAGAAGACTCAGAAGGG + Intergenic
1198099004 X:133407581-133407603 CTATCTAGGGAGAAGCAATATGG - Intronic
1199165346 X:144666837-144666859 GTATCTAAGGAGAGGAAGAATGG + Intergenic
1200915306 Y:8566155-8566177 CTGTAGGATGAGAAGCAGAAAGG + Intergenic