ID: 1089316422

View in Genome Browser
Species Human (GRCh38)
Location 11:117594233-117594255
Sequence TCTCCTGTTGTTTCTCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 354}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089316417_1089316422 22 Left 1089316417 11:117594188-117594210 CCTGGATCAGGCTCCATTTCAGA 0: 1
1: 0
2: 0
3: 14
4: 159
Right 1089316422 11:117594233-117594255 TCTCCTGTTGTTTCTCAGTGGGG 0: 1
1: 0
2: 1
3: 25
4: 354
1089316418_1089316422 9 Left 1089316418 11:117594201-117594223 CCATTTCAGAGAGAGTTTATCCT 0: 1
1: 0
2: 1
3: 21
4: 202
Right 1089316422 11:117594233-117594255 TCTCCTGTTGTTTCTCAGTGGGG 0: 1
1: 0
2: 1
3: 25
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089316422 Original CRISPR TCTCCTGTTGTTTCTCAGTG GGG Intronic
901515646 1:9744195-9744217 TTAGCTGTTGTTGCTCAGTGGGG - Intronic
902102223 1:14000622-14000644 TCTTGTGTTGGTTTTCAGTGGGG - Intergenic
902398404 1:16144619-16144641 CCTCCTGTGGTTTCCCACTGGGG - Intronic
904732103 1:32601565-32601587 TCTCATGTATTTTCTCAGTGAGG + Exonic
904859568 1:33525195-33525217 TCTCGTCTTGTGTCTCAGAGTGG + Intronic
905503434 1:38457115-38457137 TCTTCTGGTGCTTCTCAGTTTGG + Intergenic
905807664 1:40888538-40888560 TCTCCTTATGTTTCTCAGGCTGG - Intergenic
906656022 1:47548904-47548926 TCTCCTGTGATTTCTCAGAAAGG + Intergenic
906741218 1:48187269-48187291 GCTCCAGATGATTCTCAGTGAGG - Intergenic
906762637 1:48389921-48389943 TCTCTTATTGTTTGTCATTGTGG - Intronic
907030505 1:51166417-51166439 TCTTCTGATGTTCCTCATTGAGG + Intergenic
907993575 1:59607076-59607098 TCTACTGTTGTTTGTCACTAAGG - Intronic
909238766 1:73184595-73184617 TCTCCTTTTGTTGCTCAAGGGGG + Intergenic
909937020 1:81563622-81563644 TCTTTTTTTGTTTTTCAGTGAGG + Intronic
910382477 1:86643543-86643565 TCTCCTGTTGTTGGACAGTTGGG + Intergenic
912271628 1:108216413-108216435 TCTCATGTAGTTGCTTAGTGGGG - Intergenic
912509401 1:110178229-110178251 TCTGGTGTTGTTCCTGAGTGTGG + Intronic
912995719 1:114530794-114530816 TTTCATGTGGTTTCTCAGCGCGG + Intergenic
914444116 1:147735054-147735076 TCTCTTATTGTTTGTCACTGTGG + Intergenic
914455167 1:147829653-147829675 TCCTGTTTTGTTTCTCAGTGAGG + Intergenic
915858809 1:159420408-159420430 TCTCTTGTTGTTTATTATTGTGG + Intergenic
916022513 1:160806253-160806275 TCTCTTATTGTTTGTCACTGTGG + Intronic
917933456 1:179840433-179840455 TCTCCTGCTTTTCCTCACTGAGG - Exonic
918394842 1:184103063-184103085 TCTCCTTTAGTTTCTCACCGTGG + Intergenic
918508197 1:185280879-185280901 CCCCCTGTTGCTTCTCAGTGTGG + Intronic
918780948 1:188699947-188699969 TCTTCTATTGTTTCTCATTTTGG + Intergenic
919485421 1:198140401-198140423 TCTCATTTTGTTTCTAATTGAGG + Intergenic
920749214 1:208658346-208658368 CCTCCTGTTGGTCCTCAGTCAGG - Intergenic
920789532 1:209076492-209076514 TCTACTGTAGTTTATCAGGGAGG + Intergenic
921061511 1:211589157-211589179 TTTCCTGGTGTTTCTCACAGTGG + Intergenic
921182099 1:212639256-212639278 CCTCCTGTCCTTTCTCAGAGTGG - Intergenic
923316995 1:232790224-232790246 TCTCACTTTGTTTCTCAGTCTGG + Intergenic
923446394 1:234075566-234075588 ACCTCAGTTGTTTCTCAGTGCGG - Intronic
923453122 1:234138454-234138476 TCTCTTGGTCCTTCTCAGTGAGG - Intronic
923519974 1:234727799-234727821 TCTCCAGCTGTTTCTAAGAGAGG + Intergenic
1063812712 10:9732088-9732110 TCTCCTGTTCTTTCCAATTGGGG + Intergenic
1064803741 10:19107714-19107736 TCTCTTGTTGTTTATCTTTGTGG + Intronic
1066168127 10:32810099-32810121 TCTTGTGTTGTTTATCATTGTGG - Intronic
1066540940 10:36445789-36445811 TCACCTCTTTTTTCTCAGAGAGG + Intergenic
1067852549 10:49762928-49762950 TCTCCCGTTGTTTGTTAGTTTGG + Intergenic
1068930056 10:62580619-62580641 TCTCCTGTGGTTGCTCAGCTGGG + Intronic
1069356082 10:67586876-67586898 TCTCTTATTGTTTATCATTGTGG + Intronic
1070956067 10:80464468-80464490 TCTCTGGTTGTTTCCCTGTGTGG + Intronic
1071723901 10:88176598-88176620 TCTCCTATTGTTTATCTTTGTGG + Intergenic
1072237876 10:93468831-93468853 TGAGCTGTTGTTTGTCAGTGGGG + Intronic
1072745632 10:97937313-97937335 TCCCCTGTTCCTTCTCAGTGAGG + Intronic
1074431283 10:113397094-113397116 CCTCCTGTTCCTTCTCAGAGCGG + Intergenic
1078886700 11:15507434-15507456 TCTCCAGTTGTTCCCTAGTGAGG - Intergenic
1080324390 11:31053125-31053147 TCTTGTTTTGTTTCTTAGTGAGG - Intronic
1080669759 11:34365258-34365280 TCTCCTGCTGTTGCCCAGTCTGG - Intergenic
1081167493 11:39823691-39823713 TTTCCTGTTTTCTCTCTGTGAGG + Intergenic
1082220442 11:49629132-49629154 TATACTATTGTTTCTCTGTGAGG + Intergenic
1082938039 11:58674850-58674872 TTTCCTGTTGGTTTGCAGTGAGG + Intronic
1083518233 11:63281050-63281072 TCTCTTATTGTTTATCAGTGTGG + Intronic
1084056555 11:66637864-66637886 GCTCCAGTTTTTTCTCAGGGTGG + Intronic
1084137119 11:67193017-67193039 TCTCACTTTGTTTCTCAGTCTGG + Intronic
1084443110 11:69187255-69187277 CCTTCTGTTGGTTCTCACTGTGG - Intergenic
1086191591 11:84085820-84085842 AATCCTGTTGTTCCTCTGTGAGG + Intronic
1086508831 11:87533466-87533488 TTTCCTGTTCCTTCTCTGTGGGG + Intergenic
1086594776 11:88557695-88557717 GCTCCTGTTGTTTCCCAGTATGG + Intronic
1086629228 11:88996019-88996041 TATACTCTTGTTTCTCTGTGAGG - Intronic
1087227626 11:95619892-95619914 TCTCCTCTTGTCTATCACTGTGG - Intergenic
1087548104 11:99610332-99610354 TCTGGTGTTATTTCTCAGTCAGG + Intronic
1088875983 11:113936707-113936729 TTTCCTGTTCTTTCTGAGTTGGG + Intronic
1089316422 11:117594233-117594255 TCTCCTGTTGTTTCTCAGTGGGG + Intronic
1092700258 12:11220877-11220899 TCTTGTTTTGTTTCTTAGTGAGG - Intergenic
1093255077 12:16856871-16856893 TTTCCTATTGTTTCCCAGAGGGG - Intergenic
1094385433 12:29888772-29888794 TTTCCTCTTGTTTGTCTGTGAGG - Intergenic
1094630758 12:32171510-32171532 TCTTCTGTGGTTCCTCAGTTGGG + Intronic
1098047196 12:66412131-66412153 TCTCCTGTAGTATCTTATTGAGG - Intronic
1098987440 12:77027984-77028006 TCTCTTGTTTCTTCTGAGTGGGG - Exonic
1099459312 12:82903113-82903135 TCTCCTGGTTATTCTCACTGGGG + Intronic
1099879529 12:88450888-88450910 TGTCCAGCTGTTTCTGAGTGAGG - Intergenic
1101020500 12:100548488-100548510 TCTCCTCATATTTCTCAGGGTGG + Intronic
1101688165 12:107046447-107046469 TCTCTTATTGTTTATCATTGTGG - Intronic
1102637933 12:114340848-114340870 TCTCCTGTGGTCTCTCCCTGTGG + Intergenic
1103412431 12:120721906-120721928 TCACCTTCTGTTTCTCATTGTGG + Exonic
1104646479 12:130501282-130501304 ACTCCTGTTTTTTTTCTGTGCGG + Intronic
1105877932 13:24575889-24575911 TCTCTTATTGTTTATCACTGTGG + Intergenic
1106079284 13:26487270-26487292 TCTTCTGTTGTTTGTCTGTTTGG + Intergenic
1107063401 13:36186166-36186188 TCTCCTCTTGTTTGTTAATGTGG - Intronic
1107925087 13:45251713-45251735 TCTTGAGTAGTTTCTCAGTGAGG + Intronic
1109086617 13:57981053-57981075 TCTTCTTCTGTGTCTCAGTGAGG + Intergenic
1111077519 13:83257260-83257282 TCTCAAGTTCTTTCTCAGAGTGG - Intergenic
1111402565 13:87760206-87760228 TATCCTGATGTAACTCAGTGGGG - Intergenic
1111609242 13:90582034-90582056 TCTTCTGTTGTCTCTCAGAAAGG + Intergenic
1111659811 13:91194716-91194738 ACTTGTGTTTTTTCTCAGTGAGG - Intergenic
1112033420 13:95476760-95476782 TGTCCTGTTATTTCATAGTGAGG - Intronic
1112670530 13:101631493-101631515 TCTTCTGCAGTTTCTCTGTGTGG - Intronic
1113904976 13:113814949-113814971 TCTCCTGTGCTGTCCCAGTGAGG - Exonic
1114207367 14:20585114-20585136 TCTGCTGTTGTGTCTAACTGAGG + Intronic
1114726301 14:24941361-24941383 TCTCATGTTCTTTCTCACAGAGG - Intronic
1114761338 14:25318757-25318779 TCTCCTTTTTTTTCTTAGTCTGG + Intergenic
1117200186 14:53382332-53382354 TCTCCAGTAGTTCCTCACTGTGG + Intergenic
1119407365 14:74407157-74407179 CCTCCTGCTCTTTCTCTGTGGGG + Exonic
1119580642 14:75776708-75776730 TATCTTGTTGTTTTTCTGTGGGG + Intronic
1120179636 14:81330071-81330093 TATCCTGTTGTATCTCAGGGAGG + Intronic
1120344588 14:83269644-83269666 CTTTCTGTTGTTTCTCACTGGGG + Intergenic
1120422248 14:84302921-84302943 TCTGCTGCTTTTTTTCAGTGGGG - Intergenic
1120703593 14:87725046-87725068 TCTCCTGTTGTTTAGAAGCGTGG - Intergenic
1121221468 14:92288564-92288586 CCTCCTGGTGTTTCCCAGTAGGG - Intergenic
1121909388 14:97775549-97775571 TGTCCTGTTGCATCTCACTGGGG - Intergenic
1122755424 14:103974965-103974987 TCTCATGTTGTTGCTCAGGCTGG + Intronic
1123100431 14:105794062-105794084 TCTCTTATTGTTTATCATTGTGG - Intergenic
1123210081 14:106751038-106751060 TCTAATGTAGTTTCACAGTGAGG - Intergenic
1126431528 15:48590218-48590240 TCTCCTGGTGTTTTTCAGGAAGG - Intronic
1126488291 15:49207700-49207722 TCCTCTTTTGTTTCTTAGTGAGG + Intronic
1126851504 15:52799664-52799686 TTTCCTGATGTTTCTCAGTTAGG + Intergenic
1127221308 15:56884317-56884339 TCTCCTTATGTTTCTCAGGCTGG - Intronic
1127410358 15:58699429-58699451 TCTCTTATTGTTTATCATTGTGG - Intronic
1127823446 15:62681948-62681970 TCTCCTTATGTTGCTCAGTCTGG + Intronic
1128212758 15:65913857-65913879 GCTCCTGTTATTCCTCATTGTGG - Exonic
1128625955 15:69203853-69203875 GATACTGTTGTTTCTCAGTTGGG - Intronic
1129835205 15:78700474-78700496 TATCCTTTTGTTTCTGATTGAGG + Intronic
1131101977 15:89699055-89699077 TCTCCTTTTGTTGCTCAGGATGG + Intronic
1131115711 15:89794015-89794037 TCTCCTGTTCTTTGTTATTGGGG - Intronic
1131220509 15:90579991-90580013 TCTTCTGATGTTCCTGAGTGGGG - Intronic
1131443569 15:92476965-92476987 TCTCCTGGTGTTTCTGGGGGAGG + Intronic
1131764430 15:95659863-95659885 TCTCCTGGTGTTTCCCACAGCGG - Intergenic
1132425036 15:101709056-101709078 ACTACTCTTGTGTCTCAGTGAGG + Intronic
1133192332 16:4143375-4143397 TCTCCTGCTATTTCTCAGGCTGG + Intergenic
1133414849 16:5598350-5598372 GGTCCGGATGTTTCTCAGTGTGG - Intergenic
1133563311 16:6969537-6969559 TCTCATTTTGTTGCCCAGTGTGG - Intronic
1133956593 16:10449271-10449293 TCTTTTGTTGTGTCTCTGTGAGG + Intronic
1134305891 16:13031843-13031865 TTGCCTATTGTTTCTCACTGAGG - Intronic
1137967978 16:52955652-52955674 TCTTCTCTTGTTAGTCAGTGAGG + Intergenic
1138841811 16:60518093-60518115 TCTCTTATTGTTTATCATTGTGG - Intergenic
1138885107 16:61067259-61067281 TTTTCTCTTGTTTCTCAGCGAGG + Intergenic
1139174659 16:64672287-64672309 TCTCCTGTTCTTTCACACTGTGG - Intergenic
1141058951 16:80846387-80846409 TCTACTGTTTGTTCTAAGTGGGG - Intergenic
1142184430 16:88687703-88687725 TCTCATGTTGTTTTTCAGGCTGG - Intergenic
1143973111 17:10810132-10810154 ACTCCTCCTTTTTCTCAGTGTGG + Intergenic
1144705625 17:17365920-17365942 CCTCCTGATGTTTATCTGTGTGG - Intergenic
1145739895 17:27264608-27264630 TCTCTTGTTATTGCTCAGTTTGG + Intergenic
1146685094 17:34836207-34836229 TCTCCAGCTGCTTCTCAGGGGGG + Intergenic
1147462912 17:40586251-40586273 TCCTGTTTTGTTTCTCAGTGAGG + Intergenic
1147550374 17:41437623-41437645 TGTTCTGTTGTTTTGCAGTGGGG - Intronic
1148866232 17:50630187-50630209 ACTCCTGTCTCTTCTCAGTGTGG + Intergenic
1149024688 17:52013191-52013213 CCTCCTGTTGTTTCTAATTTTGG - Intronic
1149123817 17:53203613-53203635 TCTTCTTTTGTTTCACAGAGTGG - Intergenic
1149761501 17:59235047-59235069 TCTCCTGCTGCTTCTCTGTGAGG - Intronic
1149922021 17:60669049-60669071 TCTCATTTGGTTTCCCAGTGTGG + Intergenic
1149998318 17:61416574-61416596 GCTCATGGTGTTTCACAGTGGGG + Intergenic
1150328011 17:64272377-64272399 TCTTCTGTGGTTTCTCCATGTGG - Intergenic
1152452806 17:80393434-80393456 TCGCCAGCTGTGTCTCAGTGTGG + Exonic
1152933702 17:83124089-83124111 TGTGCTGTGCTTTCTCAGTGAGG - Intergenic
1156194851 18:34762863-34762885 TCTCCTGTCGTATCACTGTGTGG - Intronic
1157313090 18:46566696-46566718 TCCCCTCTTGTTTCTCACTATGG - Intronic
1159943170 18:74424700-74424722 TCTCCTGCTGGTTCTCACTCTGG - Intergenic
1160374467 18:78400907-78400929 TCTCCTGTTGCTATTCAGGGAGG - Intergenic
1160713927 19:566587-566609 GCTCCTGTTCTTTCTCAATGCGG - Intergenic
1163180323 19:15594891-15594913 TCTCCTTTTGTTTCTCAGGCTGG + Intergenic
1163560302 19:18015292-18015314 TCTCCCTTTGTTTCTCAGGTGGG + Intergenic
1163911455 19:20198144-20198166 TCTGCTGTTGTTTCCCAGGCTGG + Exonic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1166214900 19:41328453-41328475 GCTCGTGTTGTGTCCCAGTGAGG + Intronic
1166561641 19:43736546-43736568 CCTCCTGTTGGTACTCAGGGAGG - Intronic
1168163705 19:54531981-54532003 TATGCTGTTTTTTTTCAGTGTGG + Intergenic
925713345 2:6762847-6762869 TGTCGTGTTGTTTCTAATTGAGG + Intergenic
926348565 2:11973669-11973691 TCTCTTATTGTTTGTCACTGTGG + Intergenic
926359779 2:12075714-12075736 TCTTCTGTTGATGGTCAGTGGGG + Intergenic
926768007 2:16339699-16339721 TCTCATATTGTTTATCATTGTGG - Intergenic
926778906 2:16449025-16449047 TGTCCAGTTGGTTCTAAGTGTGG - Intergenic
927870430 2:26619615-26619637 TCTGCTGTTGTTTCCCTGTCAGG - Intronic
928470468 2:31570056-31570078 TTTTCTGTTGTGTCTCTGTGAGG - Intronic
928609636 2:32979080-32979102 TCTCCTCTTTTTTCTTAGTTTGG + Intronic
928757091 2:34540161-34540183 TCTCTTATTGTTTATCATTGTGG + Intergenic
928788256 2:34917093-34917115 TCTTCTGTTGTGTCTCTGTCAGG - Intergenic
929734617 2:44533791-44533813 TCTCTTATTGTTTATCATTGTGG - Intronic
931045164 2:58343082-58343104 TCTCTTGTTGTTTATCATTATGG - Intergenic
931213379 2:60218546-60218568 TCTCCTGTTGATACTCTCTGTGG - Intergenic
931483222 2:62664447-62664469 TCTCCTCCAGTTTCTCACTGAGG + Intergenic
932962360 2:76428514-76428536 TCACCAGTTGTTTATCATTGTGG - Intergenic
934984518 2:98874621-98874643 TCCCTTGTTGTTCCACAGTGTGG - Intronic
936487713 2:112940763-112940785 TCTCCTGTCCGTTTTCAGTGGGG + Intergenic
936830218 2:116635444-116635466 TCTCTTATTGTTTATCATTGTGG - Intergenic
937463621 2:122110462-122110484 TTTCCTGTTATTTCCCAGTCCGG - Intergenic
937465472 2:122129316-122129338 TCTCATATTGTTTCTCAGTGTGG + Intergenic
937522008 2:122723202-122723224 TCTCATTTTGTTTCTTAATGAGG - Intergenic
938822479 2:134973682-134973704 TCTCTTGTTATTTATCATTGTGG + Intronic
940269158 2:151872713-151872735 TCTCTTCTAGTTACTCAGTGCGG + Intronic
941158646 2:162009651-162009673 TCTCCAGATGTTTTTCAGTTTGG + Intronic
941356275 2:164496431-164496453 TCTCATGTTGTCTTTTAGTGGGG - Intronic
941467888 2:165852329-165852351 TCTTTTGTTGTTTATCATTGTGG + Intergenic
941577804 2:167256909-167256931 TCTCCTATTTTTTCTCACTTTGG + Intronic
941679185 2:168378380-168378402 TTTGCTGTTGACTCTCAGTGGGG - Intergenic
944595859 2:201260096-201260118 TCTCATCTTGGTTCTCAGGGTGG - Intronic
944708437 2:202313974-202313996 TCTCCTTCTGTTTCTCAGGCTGG + Intergenic
945663420 2:212713636-212713658 TCTCCTTTTGTTTTCCAGTGTGG - Intergenic
948871061 2:240798446-240798468 TCTCCTGCTTCTCCTCAGTGGGG - Intronic
1169903610 20:10577894-10577916 CCTCTTGTTGTTTACCAGTGTGG + Intronic
1169925096 20:10774862-10774884 TCTCCTTTTGTTGCTCAGGGTGG + Intergenic
1170146067 20:13175783-13175805 TCTTCTGTAGAATCTCAGTGGGG - Intergenic
1171287461 20:23953200-23953222 TCTCCTTGTTTTTCTCTGTGTGG - Intergenic
1171310427 20:24140789-24140811 TGTCCTGTCCTTCCTCAGTGAGG + Intergenic
1171512833 20:25700671-25700693 TCTTCTGTTTTTTCTTAGTCTGG + Intergenic
1173021908 20:39274149-39274171 TCTCCTGTGGTGGCTCAGGGTGG - Intergenic
1173507411 20:43598929-43598951 TCTCCTGCTGTTACTCTGGGTGG + Intronic
1173772830 20:45678559-45678581 CCTACTATTGTTTCTCAGTGTGG + Intergenic
1175722151 20:61293989-61294011 TTTCCTTCTGTTTCACAGTGTGG + Intronic
1176271679 20:64238646-64238668 CCTCCTGGTGTCTCTGAGTGTGG + Intronic
1176359230 21:5980704-5980726 TCTCTTGTTGTTTATTATTGTGG + Intergenic
1177105450 21:16949825-16949847 TCTCTTTTTTTTTCTTAGTGTGG - Intergenic
1177846417 21:26293294-26293316 ACTGCTGTTGGTTTTCAGTGTGG + Intergenic
1177953918 21:27573025-27573047 TCTCCTTTACTTTCTCATTGTGG - Intergenic
1178551260 21:33541939-33541961 TTTCCTGTTGTTTGTAAATGCGG - Intronic
1179366272 21:40760884-40760906 GATCGTGTTGATTCTCAGTGAGG - Intronic
1179764288 21:43557846-43557868 TCTCTTGTTGTTTATTATTGTGG - Intronic
1181100717 22:20537099-20537121 TCTCCTTTTGTGTTTCAGCGAGG + Exonic
1184514480 22:44953572-44953594 TCTGCTAATGTGTCTCAGTGGGG + Intronic
1185195753 22:49468336-49468358 TCTCCTCGTGCTTCTCCGTGGGG + Intronic
949510330 3:4761553-4761575 TCACCTGATGTTTCCCAGTCTGG + Intronic
950087957 3:10274128-10274150 ACTCCTGTTGTTTTTCAGCTGGG + Intronic
950676162 3:14555584-14555606 TCTCCTGCTGTCTCTCTGTCTGG - Intergenic
951009219 3:17657004-17657026 TCTCCAGTTTTTAGTCAGTGTGG - Intronic
952562787 3:34614815-34614837 TCTCCTTTTTTTTCTCAGAAGGG - Intergenic
952732741 3:36656253-36656275 TCTCATTTTGTTTCTAATTGAGG - Intergenic
953194783 3:40722155-40722177 CCTCCTCTTGCTTCCCAGTGAGG + Intergenic
953466481 3:43125768-43125790 TCTCCTGTTGTTGGACAGTTGGG - Intergenic
954735943 3:52706451-52706473 TCTCCTGTCCATTCTCCGTGAGG + Intronic
955686758 3:61557065-61557087 TCTTCTGTTGGTTCTGTGTGAGG - Intergenic
956297615 3:67731135-67731157 TTTCCTTTTGTTTCCCAGTGAGG + Intergenic
956661641 3:71603913-71603935 TCTGCTTTTGTTTGTCAGTCTGG - Intergenic
957447683 3:80336630-80336652 ACTCCTGTTGTTTATGATTGTGG + Intergenic
957570680 3:81944581-81944603 TCTCCCTTTGTTTCCCAGGGTGG + Intergenic
958069104 3:88586235-88586257 TCTCTTGGTGTTTCTCACTGTGG - Intergenic
958509778 3:95033000-95033022 TCTCAATTTGATTCTCAGTGTGG + Intergenic
959203512 3:103278058-103278080 TCTCTTGTTGTGTCTCTGTCAGG + Intergenic
959291331 3:104478155-104478177 TTTCTTGTTGTTTCTCTGTCAGG - Intergenic
959503588 3:107133962-107133984 TCTCATTTTGTTCCTCAGGGTGG - Intergenic
960334891 3:116404776-116404798 TCTCCTGTAAATTCTGAGTGTGG - Intronic
962547912 3:136455907-136455929 ACTTCTGTTCTTTCTCAGTCTGG - Intronic
963548399 3:146690685-146690707 TCTCCTGTTGTTTACCTTTGTGG + Intergenic
964510410 3:157444129-157444151 TCTCCTGTAGATTCTATGTGAGG + Intronic
965385662 3:168043133-168043155 TATTCTCTTGTATCTCAGTGGGG - Intronic
965478047 3:169182434-169182456 TCTACTGTTTTTTCAAAGTGTGG - Intronic
965960120 3:174418920-174418942 TCTCCTGTTCTTTGTCATTATGG - Intergenic
966439676 3:179929870-179929892 TCTCTTGTTGTTTATCAGACCGG + Intronic
966638118 3:182158090-182158112 TGGCCAGTTGTTTCTCTGTGGGG - Intergenic
967491387 3:190095510-190095532 TCTCTTATTGTTGCTCACTGTGG - Intronic
968231866 3:197009119-197009141 TCTCCTGGAGGATCTCAGTGCGG + Intronic
970550227 4:17173225-17173247 TCTCCTGTGGTTTCTCACTCTGG - Intergenic
970869742 4:20801739-20801761 TCTCTTGTTGTCTATCATTGTGG - Intronic
971061390 4:22975667-22975689 TCTCTTATTGTTTGTCATTGTGG + Intergenic
971703531 4:30011028-30011050 TCTCTTATTGTTTATCATTGTGG + Intergenic
972258641 4:37385618-37385640 GCTCCTGATGTTTCTATGTGAGG - Intronic
972407490 4:38760934-38760956 TCTGCTGTTGTTTCTAATTAGGG + Intergenic
974117953 4:57603788-57603810 TCTCCCTCTGTTTCTCAGGGTGG - Intergenic
975560645 4:75705325-75705347 CCACCTCTTGTTTCTCTGTGTGG - Intronic
976668452 4:87625696-87625718 AATCCTGTGGATTCTCAGTGAGG + Intergenic
977432297 4:96945151-96945173 TCTGCTGGTGTTTCCCAGTCTGG - Intergenic
979690443 4:123553518-123553540 TCATTTGGTGTTTCTCAGTGGGG + Intergenic
979892505 4:126116730-126116752 TCTCTTGTTTTTTCTTAGTCTGG + Intergenic
980805093 4:137802380-137802402 TCACATGTTGTGTCTCAGTGAGG - Intergenic
980981141 4:139655485-139655507 TTTCCTGTTCTTTCTCAGCCTGG + Intergenic
984138891 4:175976795-175976817 TCTGCTGTCATTTCTCTGTGTGG - Intronic
984353639 4:178628326-178628348 TCTCCTGTTGTTTCTCTCTTGGG + Intergenic
985327948 4:188794485-188794507 TCTCCCATTATTTCTCAGTATGG - Intergenic
986049385 5:4074307-4074329 TCTCTTGCTGTTTTTCACTGTGG + Intergenic
987120053 5:14758976-14758998 TCTCCTATTGCTACACAGTGAGG + Intronic
987439172 5:17934514-17934536 TCTCTTATTGTTTATCATTGTGG - Intergenic
987827543 5:23052764-23052786 TCTGCTTTTGTTTATCAGTTTGG + Intergenic
988236718 5:28555532-28555554 TGTCCTTTTATTTCTCATTGAGG + Intergenic
988439441 5:31215580-31215602 TCTCTTTTTTTTTCTCATTGTGG + Intronic
989663836 5:43828437-43828459 TCTCTTATTGTTTGTCATTGTGG + Intergenic
991387316 5:66104455-66104477 TCCTGTTTTGTTTCTCAGTGAGG - Intergenic
992844118 5:80727861-80727883 TCAAGTGCTGTTTCTCAGTGAGG - Intronic
993069319 5:83139552-83139574 TCACATGTTGTTTAACAGTGGGG + Intronic
993308909 5:86303590-86303612 TCTCATGTAGTTGCTTAGTGGGG + Intergenic
994195527 5:96918581-96918603 TTTCCTTTTGTATCTCTGTGAGG - Exonic
994688288 5:102984147-102984169 TTTCCTATTGTTTATCATTGTGG - Intronic
994699772 5:103119777-103119799 TTTCCTGCTGATTCTGAGTGTGG - Intronic
995293492 5:110488202-110488224 TCCTGTTTTGTTTCTCAGTGAGG + Intronic
997664471 5:135618500-135618522 TCTCTTATTGTTTATCATTGTGG + Intergenic
997866157 5:137464659-137464681 TTTCCTCTTGCTTCTCATTGTGG - Intronic
997985705 5:138499870-138499892 TCTCCTTATGTTGCTCAGGGTGG - Intergenic
998394164 5:141807541-141807563 TCTCCTGTTGGTGCTTAGAGAGG - Intergenic
1000332254 5:160215144-160215166 TCTCCTTTTGTTGGACAGTGAGG - Intronic
1000801681 5:165735525-165735547 TCTCTTGTTGTTTATCTTTGTGG + Intergenic
1002551843 5:179999937-179999959 TCTCCTATTGTTTATCATTAAGG + Intronic
1003301910 6:4891862-4891884 TCTCCTTCTGCTTCTCCGTGTGG - Exonic
1003423452 6:5978834-5978856 TTTCCTGTTTTTTCAGAGTGGGG + Intergenic
1003608416 6:7586370-7586392 TCTCCTTTAGTTTCAGAGTGTGG + Exonic
1003656366 6:8014092-8014114 TCTCTTGTGTTATCTCAGTGTGG - Exonic
1003811611 6:9789034-9789056 CTACCTGTTGTCTCTCAGTGGGG - Intronic
1004088361 6:12473890-12473912 TGTCCTGTTCTTTGTCACTGAGG - Intergenic
1004212561 6:13665428-13665450 TATGCAGTTGTATCTCAGTGTGG - Intronic
1005954542 6:30654804-30654826 TCTGCTGCTGTTTCACTGTGCGG + Exonic
1006078232 6:31548071-31548093 TCCCCTGTTGTTTCTCCCTTTGG - Intronic
1006829610 6:36960951-36960973 GTTCTGGTTGTTTCTCAGTGTGG - Intronic
1008599587 6:53077926-53077948 TCTACTGGTGTATCTCTGTGGGG + Intronic
1008667999 6:53736013-53736035 TCTGCTCTGGTTTCTCACTGGGG - Intergenic
1009673818 6:66790237-66790259 TTTCCTATTGTTTATCACTGTGG - Intergenic
1009673821 6:66790296-66790318 TTTCCTATTGTTTATCACTGTGG - Intergenic
1011681995 6:89792400-89792422 CCTGCTGTTGTTTAGCAGTGGGG - Intronic
1012485566 6:99718246-99718268 TCTCTTGTTTTTTCTCAGTCTGG + Intergenic
1012600412 6:101090303-101090325 TCTCTTATTGTTTGTCATTGTGG + Intergenic
1012654213 6:101794519-101794541 TCTCTTATTGTTTATCATTGCGG + Intronic
1013144414 6:107373786-107373808 TCTCCTGCTTTTTCTCACTCTGG + Intronic
1014060077 6:117061807-117061829 TCTCTTATTGTTTATCATTGTGG + Intergenic
1014343002 6:120231940-120231962 TCTCATATTGTTTATCATTGTGG - Intergenic
1017306225 6:152921754-152921776 TCTCCTGTTGGTTTTTAGGGAGG + Intergenic
1017384186 6:153863412-153863434 TCTCTTATTGTTTATCATTGTGG - Intergenic
1018598543 6:165512104-165512126 TCTCTTATTGTTTGTCATTGTGG + Intronic
1020197986 7:6057095-6057117 TCTCCTTTTGTTGCCCAGTCTGG - Intronic
1020276196 7:6626053-6626075 TCTCCTGTTTTTGTTCAGGGCGG + Intergenic
1021278816 7:18690887-18690909 TATGCTTTTGTTTCTGAGTGAGG - Intronic
1021598420 7:22340954-22340976 TCACCTCGTGTTACTCAGTGTGG - Intronic
1022985900 7:35652986-35653008 TCTCATGTTGTTTTTCATTGTGG - Intronic
1023494101 7:40776196-40776218 TCTGCTGTTGATTCACACTGGGG + Intronic
1023553641 7:41396900-41396922 TCTCCTCTTTTTTTTCAGTCTGG + Intergenic
1024165952 7:46730366-46730388 TCTCCTTCTGTTTCCCAGTTTGG - Intronic
1026209117 7:68287616-68287638 TCTCCAGCTGGTTCCCAGTGGGG - Intergenic
1027543739 7:79500445-79500467 TCTCCTGTCTTTTGCCAGTGGGG + Intergenic
1028304467 7:89246211-89246233 TCTCCTCTTGTCCCACAGTGGGG - Intronic
1028597877 7:92566201-92566223 ACTCCTGTTATATCTCAATGAGG + Intronic
1031985373 7:128161151-128161173 TCTCCTTTTCTTTCTCCATGTGG + Intergenic
1032138404 7:129303537-129303559 TCTCATGTTTTTTCTTAGTCTGG + Intronic
1032322426 7:130897461-130897483 TCTCCAGTTGGTTCTCGTTGGGG - Intergenic
1032560546 7:132887615-132887637 TCTTTTGTTGTTTTTCGGTGGGG - Intronic
1033102962 7:138492068-138492090 TCTCCCTTTGTTGCTCAGTCTGG - Intronic
1033222231 7:139535827-139535849 TCTCCTGCTGCTTCTCTATGCGG - Intronic
1034268208 7:149791284-149791306 TCTCCTCTTCTTTCCCAGGGGGG + Intergenic
1034600548 7:152249921-152249943 TCTTCTGTTGCTCTTCAGTGTGG + Exonic
1034741781 7:153480834-153480856 TCTCTTATTGTTTATCACTGTGG - Intergenic
1037245744 8:16832667-16832689 TCTCCCTATGTTGCTCAGTGTGG - Intergenic
1038029048 8:23621060-23621082 TGTCCTGTTATATCACAGTGAGG - Intergenic
1039752819 8:40493854-40493876 TCTCCTGTTATTTTTCTGTAGGG + Intergenic
1039825467 8:41170126-41170148 TCTCTTTTTATTTCTCAGAGTGG - Intergenic
1042240964 8:66664339-66664361 TATCTTCTTGTTTCACAGTGTGG + Exonic
1043744191 8:83852972-83852994 TCTCCTTTTTTTTCTGATTGTGG + Intergenic
1046501628 8:115085172-115085194 TCTCCTGGAGTCTCTGAGTGGGG - Intergenic
1049284656 8:141767977-141767999 TCTCCAGTTGTTTTTCTGTTTGG + Intergenic
1052695033 9:31867474-31867496 TCTCTTATTGTTTATCATTGTGG + Intergenic
1053167831 9:35856972-35856994 TCTCCTGACTTGTCTCAGTGGGG + Intergenic
1053350830 9:37412287-37412309 ACTCCTGCTGTTTCTCAGCTTGG + Intergenic
1055300892 9:74880828-74880850 TCTCTTATTGTTTATCATTGTGG - Intronic
1055915553 9:81396690-81396712 TCTCCTGTTCCTTCTGAATGCGG - Intergenic
1055950257 9:81723812-81723834 TCTCCTCTTCTTTCTGAATGAGG + Intergenic
1057025921 9:91733680-91733702 GCTTCTGATGTTTCTAAGTGAGG - Intronic
1057951805 9:99375134-99375156 TCACCTGTTGGTTCTCTATGAGG + Intergenic
1057977741 9:99624173-99624195 TCTCCTGTTGTTGTCCAATGTGG - Intergenic
1058183591 9:101827384-101827406 TGTTCAGTTGTTTCCCAGTGAGG - Intergenic
1058241606 9:102569213-102569235 TCTGCTGTTGCTTCTCATTCTGG - Intergenic
1059503039 9:114772101-114772123 TGTGCTGTGGTTTCTCATTGTGG + Intergenic
1059607875 9:115855752-115855774 TATCCTGTATTATCTCAGTGGGG + Intergenic
1060155038 9:121313715-121313737 TCTCCTGGAGTTTCTGAGTCAGG + Intronic
1060448896 9:123718574-123718596 CCTCCTGTAGATTCACAGTGAGG + Intronic
1061956989 9:133968886-133968908 CCTCGTGGTGGTTCTCAGTGAGG - Intronic
1185833719 X:3324818-3324840 GCTCCTGTTCTGTCTCAGAGGGG + Exonic
1185963588 X:4574481-4574503 TCTCCTGTTGTTTATTTGTAAGG - Intergenic
1186543394 X:10424013-10424035 TCTCCTTTTGGGTCTCAGAGTGG + Intergenic
1187728364 X:22227344-22227366 TGTCCTGTTGCTTACCAGTGAGG - Intronic
1188064076 X:25635532-25635554 TCTCTTATTGTTTATCATTGTGG - Intergenic
1188700356 X:33252317-33252339 TCTCCTTTTGTCTTTTAGTGGGG + Intronic
1189897991 X:45675623-45675645 TATTCTGTTATTTCACAGTGGGG - Intergenic
1189932027 X:46022681-46022703 TCTCCTGTTTCTTCTTAGTGAGG - Intergenic
1191639951 X:63419910-63419932 TCTCCTGTTGTTTATGATTTTGG + Intergenic
1191778196 X:64841466-64841488 TCCTGTTTTGTTTCTCAGTGAGG + Intergenic
1191994343 X:67075093-67075115 TCCTTTTTTGTTTCTCAGTGAGG - Intergenic
1192785627 X:74332006-74332028 TCTCCTGTTGTTGCCCAGGCTGG - Intergenic
1192978531 X:76313843-76313865 TCTTGTTTTGTTTCTTAGTGAGG + Intergenic
1193509355 X:82380881-82380903 TCTCTTGTTGTTTATCATTGTGG + Intergenic
1194675665 X:96790800-96790822 TCTTCAGTTGTTTCACAGAGAGG + Intronic
1194967695 X:100307757-100307779 GTTCTTGTTGATTCTCAGTGTGG - Intronic
1195999516 X:110766488-110766510 TCCTGTTTTGTTTCTCAGTGAGG - Intronic
1196414171 X:115453699-115453721 TCTCCCTTTGTTGCTCAGTCTGG - Intergenic
1196457337 X:115899782-115899804 TCTCCTGCTCTGTCTCTGTGTGG + Intergenic
1196758940 X:119182229-119182251 TCTCCCTTTGTTTCTCAGGCTGG - Intergenic
1197516783 X:127442083-127442105 TCTCCTGCTGTTTCTTTTTGGGG - Intergenic
1197643320 X:128990941-128990963 TCTCTTATTGTTTATCATTGTGG + Intergenic
1197677872 X:129349758-129349780 CTTCCTGTCTTTTCTCAGTGAGG - Intergenic
1197711191 X:129669935-129669957 TCTCCTTTTGTTTATTAATGTGG + Intergenic
1198419929 X:136460913-136460935 TCTCCTCTTGTTGCTCAGGCTGG - Intergenic
1198836251 X:140807580-140807602 ACTCCTGTTGTTTCTCACTCTGG + Intergenic
1199320326 X:146430516-146430538 TCTCCTTTTCTTGCTCACTGCGG + Intergenic
1200345616 X:155444161-155444183 TCTCTTATTGTTTATCATTGTGG - Intergenic
1200764618 Y:7069980-7070002 TCTGTTTTTATTTCTCAGTGAGG + Intronic
1201275056 Y:12288676-12288698 TCTCTTGTGGCTTCTCAGTGTGG - Intergenic
1202116088 Y:21469810-21469832 ATTCCTGATGTTTCCCAGTGAGG - Intergenic
1202127494 Y:21581380-21581402 TCTCCTCCTCCTTCTCAGTGTGG - Intergenic