ID: 1089318664

View in Genome Browser
Species Human (GRCh38)
Location 11:117610070-117610092
Sequence TGGTGCCTCCTCGAGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 246}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089318664_1089318673 29 Left 1089318664 11:117610070-117610092 CCTGCCCCCTCGAGGAGGCACCA 0: 1
1: 0
2: 0
3: 17
4: 246
Right 1089318673 11:117610122-117610144 TTCTCAACCAAAGGCTTGTTGGG 0: 1
1: 0
2: 1
3: 12
4: 132
1089318664_1089318669 -6 Left 1089318664 11:117610070-117610092 CCTGCCCCCTCGAGGAGGCACCA 0: 1
1: 0
2: 0
3: 17
4: 246
Right 1089318669 11:117610087-117610109 GCACCAGTACTCTCTGCATCTGG 0: 1
1: 0
2: 1
3: 3
4: 108
1089318664_1089318671 20 Left 1089318664 11:117610070-117610092 CCTGCCCCCTCGAGGAGGCACCA 0: 1
1: 0
2: 0
3: 17
4: 246
Right 1089318671 11:117610113-117610135 TTCAAGCTGTTCTCAACCAAAGG 0: 1
1: 0
2: 0
3: 12
4: 165
1089318664_1089318672 28 Left 1089318664 11:117610070-117610092 CCTGCCCCCTCGAGGAGGCACCA 0: 1
1: 0
2: 0
3: 17
4: 246
Right 1089318672 11:117610121-117610143 GTTCTCAACCAAAGGCTTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 104
1089318664_1089318674 30 Left 1089318664 11:117610070-117610092 CCTGCCCCCTCGAGGAGGCACCA 0: 1
1: 0
2: 0
3: 17
4: 246
Right 1089318674 11:117610123-117610145 TCTCAACCAAAGGCTTGTTGGGG 0: 1
1: 0
2: 0
3: 12
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089318664 Original CRISPR TGGTGCCTCCTCGAGGGGGC AGG (reversed) Intronic
900130528 1:1085350-1085372 TGGTGCCTTCAGGCGGGGGCGGG - Intronic
900296672 1:1955374-1955396 CGGTGCCCCCTGGAGGGGCCGGG - Intronic
903738583 1:25545033-25545055 TGGTGCCTGCTGGTGGGGGGTGG + Intronic
904617982 1:31760307-31760329 AGGCCCCTCCTCTAGGGGGCTGG + Intronic
904713271 1:32447777-32447799 TGGTGCCTCCCCTAGGGGAAGGG - Intergenic
904921295 1:34010294-34010316 TGGTGCCACCTCCAGGAAGCAGG + Intronic
905013690 1:34763040-34763062 TGGGGCATCTTCAAGGGGGCAGG - Exonic
905877979 1:41445565-41445587 TGGTGCCATCTAGAGGGGTCAGG - Intergenic
906757827 1:48336617-48336639 TGGGGCCTCCTCGAGGGAGGAGG + Intronic
907241896 1:53085546-53085568 TGGTGCCGGGTGGAGGGGGCAGG + Intergenic
908123925 1:61011906-61011928 TGGTGCCTACTCCTGGGCGCTGG - Intronic
910433161 1:87178650-87178672 TGGTGCCTGCTCCTGGGGGAAGG - Intergenic
910592245 1:88938538-88938560 TGGGGCCTCCTTGAGGGTGGAGG - Intronic
912714225 1:111970931-111970953 AGATGTCTCCTAGAGGGGGCAGG + Intronic
913199456 1:116484207-116484229 TGGAGCCTCTTAGAGTGGGCAGG - Intergenic
913547668 1:119885545-119885567 TTGTTCCTCGTCGTGGGGGCTGG + Intergenic
916555323 1:165889845-165889867 TGGGGCCTGCTGGAGGTGGCGGG - Intronic
916729571 1:167553814-167553836 TGGCGCCTCGCGGAGGGGGCGGG - Intergenic
917095541 1:171395372-171395394 TGGTGCCTCCTCGAGTAGCTGGG - Intergenic
917142890 1:171855036-171855058 TGGGGCCTCCTTGAGGGTGAAGG - Intronic
920675897 1:208038569-208038591 TGGTACCAGCTTGAGGGGGCCGG - Intronic
922466019 1:225845964-225845986 TGGTGCCCCCTGGAGGCAGCAGG + Exonic
922798507 1:228353284-228353306 TGCTGCCTCCAGCAGGGGGCTGG - Intronic
924465977 1:244299628-244299650 TGGTGCCACCTGGAGGCGGCCGG + Intergenic
924702320 1:246466513-246466535 TGGGGCCTCCTTGAGGGTGGAGG + Intronic
1063041126 10:2338347-2338369 TGCTGCATCCTCCAGGGGGAAGG + Intergenic
1063671937 10:8105956-8105978 TGGGGCCTCCTCGAGGGTGGAGG - Intergenic
1065845564 10:29739859-29739881 TGGTGACTCCTGGAGGAGGCTGG - Intergenic
1067722588 10:48740446-48740468 TGGGGCCTCCAGGATGGGGCAGG + Intronic
1069771577 10:70903749-70903771 AGTTGCCTCCTCTAGGGAGCTGG - Intergenic
1069964373 10:72101973-72101995 TGGGGCCTCCTTGAGGGTGGAGG + Intronic
1070812699 10:79306298-79306320 TGGTGCCCCCTGGGGGAGGCGGG - Exonic
1070815018 10:79317443-79317465 TGGGGCCTCTCCGAGGTGGCTGG + Intergenic
1073528863 10:104212476-104212498 TTGTCCCTCCTCAAGGTGGCAGG + Intronic
1076734785 10:132453714-132453736 TGGTGCCTCGGAGAGGGGCCAGG - Intergenic
1077142071 11:1029143-1029165 TGGGGGCTCTGCGAGGGGGCGGG + Exonic
1077160032 11:1108445-1108467 TGGGGCCTCCTCCAGGTGGGGGG + Intergenic
1077253106 11:1569288-1569310 TGGTGCCTCCTGGAAGGTGTGGG - Intronic
1078604700 11:12764856-12764878 TGGCTCTTCCTCAAGGGGGCTGG - Intronic
1080304933 11:30825986-30826008 TGGAGCCTCCTCCAGGTGCCAGG - Intergenic
1084209445 11:67614329-67614351 TTGTGGCTCCACCAGGGGGCGGG + Intergenic
1087556602 11:99729452-99729474 TGGGGCCTACTTGAGGGTGCAGG - Intronic
1088158321 11:106837150-106837172 TGGGGCCTCCTTGAGTGTGCAGG - Intronic
1088705039 11:112454393-112454415 TGGTGCCACCTGGAGGGAGATGG + Intergenic
1089069104 11:115685374-115685396 TGGAGCCTCCTTGAGGGTGGAGG + Intergenic
1089318664 11:117610070-117610092 TGGTGCCTCCTCGAGGGGGCAGG - Intronic
1090261093 11:125320786-125320808 TGCTGCCTCCTGGAGGGAGGTGG + Intronic
1093344285 12:18021977-18021999 TGGGGCCTACTTGAGGGTGCAGG + Intergenic
1093356505 12:18173836-18173858 TGGTCCCTCCTCTAGGGGAAGGG + Intronic
1093871025 12:24290800-24290822 TGGTGGCTCCTGGAGAAGGCTGG - Intergenic
1096250960 12:50032501-50032523 TGCTGCCTTCTCGCTGGGGCGGG - Intronic
1096584189 12:52608900-52608922 TGGTGCCTCCTCAATGGGAGTGG - Intronic
1097480499 12:60118269-60118291 TGGGGCCTACTTGAGGGTGCAGG + Intergenic
1097950396 12:65420631-65420653 TGGGGCCTACTTGAGGGAGCAGG - Intronic
1098844982 12:75523746-75523768 TGGGGCCTACTCGAGGGTGGAGG - Intergenic
1102281833 12:111624620-111624642 TGGTGTCTTCTCGGGGGTGCAGG + Intergenic
1102671888 12:114626736-114626758 TGGTGCCTACTTGAGGGGGGAGG + Intergenic
1104844849 12:131841559-131841581 TGGTCCCTCCCCGCGGGGACAGG + Intronic
1104915366 12:132261701-132261723 TCCTGCCTCCACGAGGGGTCAGG + Intronic
1105343431 13:19549988-19550010 TGGGGCCTATTCGAGGGGGGAGG + Intergenic
1105536874 13:21274091-21274113 TGGGGCCTATTCGAGGGGGGAGG - Intergenic
1106411514 13:29514449-29514471 TGCTGCCACCTCCGGGGGGCGGG + Exonic
1109589626 13:64460949-64460971 TGGTGCCTACTTGAGGGCGGAGG - Intergenic
1109767745 13:66927373-66927395 TGGGGCCTCTTCGAGGGTGGAGG + Intronic
1111100093 13:83572221-83572243 TGGGGCCTCCTGGAGGGTGGAGG - Intergenic
1111532791 13:89561474-89561496 TGGGGCCTCCTTGAGGGTGGAGG + Intergenic
1113431745 13:110256455-110256477 ACGTGCATCCTCGAGGGAGCAGG + Intronic
1113777162 13:112954367-112954389 TGCTGCCTCCTCGAGGTTTCAGG - Intronic
1114037663 14:18645287-18645309 TGGTGCCACCTGGAGGCAGCCGG - Intergenic
1114120971 14:19669736-19669758 TGGTGCCACCTGGAGGCAGCCGG + Intergenic
1118161820 14:63298588-63298610 TGGTGCTTCCTAGAAGGGGTGGG - Intergenic
1119557116 14:75561763-75561785 TGGAGCCTACTCGAGGGTGGAGG - Intergenic
1119558170 14:75569235-75569257 TGGTGCCTCCTCAAGGTTACAGG - Intergenic
1121445361 14:93975284-93975306 TGGTGACTCCTAGGGAGGGCAGG - Intronic
1122307258 14:100773719-100773741 TGGTGCCTCCTCGCATGGGCTGG + Intergenic
1122541413 14:102499695-102499717 AGCTGCCTCCGGGAGGGGGCGGG - Exonic
1123000160 14:105289382-105289404 TGGTGTCTCCTTGTGGGGGCTGG + Intronic
1123987142 15:25656033-25656055 TGGTGCCTACTTGGGGGGGGGGG + Intergenic
1124347269 15:28931095-28931117 CTGTGCCTCATGGAGGGGGCTGG - Intronic
1125674130 15:41493696-41493718 CGGTGACTCCTCGGGGTGGCGGG - Intronic
1126729933 15:51672344-51672366 TGTTGACTCATGGAGGGGGCGGG - Intergenic
1127978776 15:64018613-64018635 TGGTGCAACCTAGAGGGGCCAGG - Intronic
1128462877 15:67884633-67884655 GGGTGCCTTCTGGCGGGGGCGGG - Intergenic
1129179831 15:73867084-73867106 TGGGACCTCCTCTAGGGGGCAGG - Intergenic
1129203700 15:74022524-74022546 TGGTGCTTCCTCGGTGGGGAAGG + Intronic
1130257880 15:82334154-82334176 TGGAGCCTCCTTGAGGTGGTTGG + Intergenic
1131531287 15:93194824-93194846 TGGGGCCTCCTGGAGGGTGGAGG - Intergenic
1132288650 15:100684153-100684175 TGGGGCCTCCTTGAGGGTGGAGG - Intergenic
1135186383 16:20319503-20319525 TGGAGGCTCCTGGAGGAGGCTGG + Intronic
1137632888 16:49959803-49959825 CGGTGCATCCTCGAGGGCACAGG + Intergenic
1137904216 16:52302771-52302793 TGGGGCCTCCTGGAGGGTGGAGG - Intergenic
1138602316 16:58063393-58063415 TGGGGCTTCCTCCATGGGGCTGG + Intergenic
1140038223 16:71387554-71387576 TTGAGGCTCCTCGAGGGGACAGG + Intronic
1141828898 16:86498638-86498660 AGGTGCCTCCCCAAGGGGGCGGG + Intergenic
1141953277 16:87353104-87353126 TGCTGCCTCCTGGAGGCTGCAGG + Intronic
1142490394 17:274657-274679 AGGTGCCTCCTGCATGGGGCAGG + Intronic
1142980177 17:3667015-3667037 TGGTGCCTTCTCTCTGGGGCAGG + Intronic
1143337324 17:6181631-6181653 TGGGGACTACTAGAGGGGGCAGG - Intergenic
1147167441 17:38601017-38601039 TGGTGCCTGCTTGAAGGGGGAGG - Intronic
1148128375 17:45248160-45248182 AGGTGCGTCCCCGACGGGGCGGG - Intergenic
1148339885 17:46867074-46867096 TGGTGTTTCCTCAAGGAGGCAGG + Intronic
1148736892 17:49870010-49870032 AGGTCCCTCCTGGAGGGGGAGGG + Intergenic
1149366972 17:55954413-55954435 TGGAGCCTCCTTGAGGGAGGAGG - Intergenic
1149996626 17:61409290-61409312 TGGTGGCTCCTCCAGGGCTCTGG - Exonic
1151604776 17:75129509-75129531 TGGTGCCCCCTCCAGGGCTCTGG + Exonic
1151746545 17:76014653-76014675 GGGAGCCTCCTCCTGGGGGCAGG + Intronic
1152906722 17:82974482-82974504 TGGTGCCTCCCCAAGGGGTCAGG + Intronic
1153988434 18:10373912-10373934 TGCTGCCTCCTCCAGGGACCTGG + Intergenic
1154198837 18:12285338-12285360 AGGTGCCTCCTCGGGCGTGCTGG + Intergenic
1156095938 18:33531677-33531699 TGGTGCCTGTCAGAGGGGGCTGG + Intergenic
1158633830 18:59139453-59139475 TGGTGCCTCTACGCTGGGGCGGG - Intergenic
1159031219 18:63234243-63234265 TGGGGCCTATTGGAGGGGGCAGG - Intronic
1160218849 18:76957665-76957687 TGGGGCCTCCTTGAGGGAGGAGG - Intronic
1160708034 19:538959-538981 TGGTGCCTCAGGGAGGTGGCCGG - Intronic
1160838461 19:1135770-1135792 GGGCTCCTCCTGGAGGGGGCTGG + Intronic
1161107730 19:2453014-2453036 TGGGTCATCCTCGTGGGGGCTGG + Intronic
1161107737 19:2453034-2453056 TGGGTCATCCTCGTGGGGGCTGG + Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1163458061 19:17420317-17420339 GGGTGCCCCCTCGACGGTGCAGG - Exonic
1165756407 19:38295792-38295814 GGGTGCAGCCTCCAGGGGGCAGG + Intronic
1165774456 19:38396392-38396414 TGGAGCCTCCTCGTGGGGTGTGG - Intergenic
1165837767 19:38770093-38770115 GGGTGCCTCGCCGAGGGTGCGGG + Intergenic
1165844391 19:38808977-38808999 TGGTGCCACCTCCCGGGGCCTGG + Intronic
1165968092 19:39601679-39601701 TGGGGCCTCCTTGAGGGTGGAGG + Intergenic
1166566198 19:43767071-43767093 TGGTTCCTCCTCGTGGGTCCTGG + Exonic
1166835649 19:45666222-45666244 TGGGGACTCCTAGAGGGGGCAGG + Intergenic
1168075806 19:53980479-53980501 TGGTGGATCCAAGAGGGGGCTGG + Intronic
925041582 2:735320-735342 TGGGGCCCCCCCGAAGGGGCTGG + Intergenic
925741751 2:7010843-7010865 TGGGGCCACTTCAAGGGGGCAGG - Intronic
925843613 2:8015984-8016006 TTGTGCATCCTCCAGGTGGCAGG - Intergenic
926059251 2:9794907-9794929 TGGGGCCTTCTCGAGGGTGGAGG - Intergenic
927883043 2:26702113-26702135 TGGGGCCTACTCGAGGGTGGAGG - Intronic
929996525 2:46829475-46829497 TGGTGCTTCCTGGCGGGGGTGGG + Intronic
931677028 2:64707631-64707653 TGGGGCCTACTTGAGGGAGCAGG + Intronic
932299635 2:70657138-70657160 TGATGCATACTCAAGGGGGCCGG + Exonic
936042725 2:109161922-109161944 TGGTGCCTCCTGGGGAGGGGAGG + Intronic
942850743 2:180482461-180482483 TGCTGCATCCTCGAGAGGGGAGG + Intergenic
943833650 2:192491473-192491495 TGGGGACTCCAGGAGGGGGCAGG + Intergenic
944132376 2:196360532-196360554 TGGAGCCTACTCGAGGGTGAAGG + Intronic
945748062 2:213743319-213743341 TGGTGCTTCCTATAGGGGCCAGG - Intronic
948231042 2:236349711-236349733 TGGGGCCTCCTTGAGGGTGAAGG + Intronic
1171173794 20:23036471-23036493 TGCTGCCTCCTGGAAGGTGCTGG + Exonic
1171381522 20:24737637-24737659 TGGTGCCTCCACAAGGAGGGTGG - Intergenic
1172875116 20:38159345-38159367 TGGGGCCTCCTTGAGGGTGGAGG + Intronic
1175374245 20:58514043-58514065 TGGTGGCTCTTCGTGGGGGTGGG - Intronic
1175783065 20:61695957-61695979 AGGAGCCTCATGGAGGGGGCTGG - Intronic
1175793517 20:61757242-61757264 TCGAGCCCCCTGGAGGGGGCTGG - Intronic
1175988660 20:62776896-62776918 TGGTGACTGCTCGAAGGGGTGGG - Intergenic
1179074056 21:38101446-38101468 TGCTGCCTCCCCGGTGGGGCCGG - Intronic
1179657020 21:42851937-42851959 TGGTGGCTCCCAGAGGGAGCTGG - Intronic
1180223094 21:46371728-46371750 TGGTGGCGCCTGGATGGGGCAGG - Intronic
1180461792 22:15572329-15572351 TGGTGCCACCTGGAGGCAGCCGG - Intergenic
1181006724 22:20016991-20017013 CGGCCCCTCCGCGAGGGGGCCGG - Intergenic
1181410240 22:22713352-22713374 TAGAGACTCCTGGAGGGGGCTGG - Intergenic
1181417794 22:22772735-22772757 TAGAGACTCCTGGAGGGGGCTGG - Intronic
1181580300 22:23824506-23824528 TGGTGCCTCCCCAGGGGGGCAGG + Intronic
1182094575 22:27617394-27617416 TGGGGCACCCTCCAGGGGGCAGG - Intergenic
1182299261 22:29328767-29328789 AGGGGCCTCCTCGATGGGGCGGG + Exonic
1183670695 22:39270692-39270714 TGCTGCCTCCTTGCTGGGGCTGG - Intergenic
1184045238 22:41969094-41969116 TGGTCTTTCCTCAAGGGGGCTGG - Intergenic
1184410679 22:44324406-44324428 TGGTCCCTACTCTAGGGGTCTGG + Intergenic
1184922633 22:47616346-47616368 TGGTTCCTCCTGGATGGGCCAGG + Intergenic
950063779 3:10094425-10094447 TGGTGACTCCTGGGTGGGGCTGG + Intronic
952569739 3:34700475-34700497 TGGTGCCTACTTGAGGGTGGAGG + Intergenic
954722691 3:52579053-52579075 TGGTGCGTCCTCGTGTGGGCAGG - Exonic
956232443 3:67031785-67031807 TGGGGCCTACTTGAGGGGGGAGG + Intergenic
956578026 3:70777433-70777455 TGGGGCCTCCTTGAGGGTGGAGG + Intergenic
956787216 3:72652600-72652622 TGTTGACTCCTCGAGGGTGGGGG - Intergenic
956845074 3:73175098-73175120 TAGTGCCTTATCAAGGGGGCTGG - Intergenic
960033817 3:113083106-113083128 TGGGGCCTCCTTGAGGGTGGAGG + Intergenic
961133094 3:124487098-124487120 TACTCTCTCCTCGAGGGGGCAGG - Intronic
961723713 3:128912203-128912225 TGGTTTCTCCTCCAGTGGGCTGG + Intronic
962280582 3:134048911-134048933 GGGTGCCTCCTGGTGGGGGCGGG - Intronic
962811400 3:138961882-138961904 GGGTGCCTCCTTGAGGGGCTTGG + Intergenic
968603075 4:1519548-1519570 TGGTGCCTCCTCCAGCGGGAAGG - Intergenic
968659874 4:1794511-1794533 TGCTGCCTCTTCGGGCGGGCAGG - Intronic
968890570 4:3366529-3366551 TGCTGCCTCCTTCACGGGGCCGG - Intronic
968978784 4:3835610-3835632 TGGTGGCTCCTGGTGGGGCCAGG - Intergenic
969517107 4:7653949-7653971 TGGTTCCTCCTGGAGGCGGTGGG + Intronic
970176462 4:13344585-13344607 TGGAGCCTACTCCAGGGGCCAGG + Intergenic
971829505 4:31672408-31672430 TGGGGCCTCCTTGAGGGTGGAGG - Intergenic
972855981 4:43107067-43107089 TGGGGCCTGCTTGAGGGTGCAGG + Intergenic
973149712 4:46872309-46872331 TGGTGCCTACTTGAGGGTGGAGG + Intronic
973792053 4:54386952-54386974 TGGTTTCTCCTAGAGGGGTCTGG - Intergenic
974780276 4:66544940-66544962 TGGGGCCTACTGGAGGGTGCAGG + Intergenic
974914613 4:68164147-68164169 TGGGGCCTACTTGAGGGTGCAGG + Intergenic
976793380 4:88905559-88905581 TGGGACCTCCTCGAGGGTGGAGG - Intronic
976842034 4:89443184-89443206 TGGTGCCTCCTGGAGGCTCCAGG - Intergenic
977101459 4:92821682-92821704 TGGTGCCTTATTGAGGGGGTGGG - Intronic
978949489 4:114540454-114540476 TGGGGCCTCCTTGAGGGTGGAGG - Intergenic
980573558 4:134656424-134656446 TGGGGCCTATTCGAGGGTGCAGG - Intergenic
980730085 4:136812668-136812690 GGGGGCCAACTCGAGGGGGCCGG - Intergenic
981079033 4:140619948-140619970 TGGGGCCTCCTTGAGGGTGGAGG - Intergenic
984760848 4:183361397-183361419 TGCTGCCTCCTCCAGAGGGGAGG - Intergenic
985239183 4:187911850-187911872 TGGGGCCTCCTTGAGGGTGGAGG - Intergenic
986123519 5:4865514-4865536 TGGGGCTTCCTCGAGGGTGGCGG + Intergenic
987086464 5:14474202-14474224 TGTAGCCTCCTGGAGGGAGCTGG + Intronic
991499265 5:67259901-67259923 TGGTGCCTCCACCAGGGTGGTGG + Intergenic
992857997 5:80883609-80883631 TGGGGCCTCCTTGAGGGTGGAGG - Intergenic
994759555 5:103835809-103835831 TGCTGCATCCTCCAGAGGGCAGG - Intergenic
995415545 5:111908433-111908455 TGGTGACTCCTAGAGTGGGGAGG - Intronic
998395393 5:141814754-141814776 AGGTGCCTCCTGGGGGAGGCGGG - Intergenic
999526945 5:152417061-152417083 TGGTGCCTTCTCAAGGTGGAGGG + Intronic
1001559518 5:172659987-172660009 TGGTCTCAGCTCGAGGGGGCGGG + Intronic
1001849030 5:174947091-174947113 TGGGGCCTCCTTGAGGGTGAAGG + Intergenic
1003993053 6:11506853-11506875 TGGGGCCTCCTTGAGGGTGGAGG + Intergenic
1005270009 6:24153558-24153580 TGGTGCCTCCTGGAGGTGTGCGG - Intronic
1006073603 6:31515308-31515330 TGGGGCCTCCTTGAGGGTGGAGG + Intergenic
1007817002 6:44531691-44531713 GGCTGCCTCCTCGAGAGGCCTGG + Intergenic
1007872867 6:45061431-45061453 TGGGGCCTTTTAGAGGGGGCAGG + Intronic
1008141827 6:47840579-47840601 TGTTGCATCCTCGAGAGGGAAGG - Intergenic
1009889351 6:69661582-69661604 TGGTGTCTACTTGAGGGGGGAGG + Intergenic
1010839563 6:80632743-80632765 TGGTGCCTACTTGAGGGTGGAGG + Intergenic
1013366195 6:109440361-109440383 CCGCGCCTCCTCGAGGCGGCGGG - Intronic
1016075288 6:139788524-139788546 TGGTGGCTACAGGAGGGGGCAGG + Intergenic
1017517921 6:155174286-155174308 TGGTGCCTTCCTGAGAGGGCTGG + Intronic
1017605925 6:156133028-156133050 TGGGGCCTCCTTGAGGGTGGTGG + Intergenic
1019339688 7:503191-503213 TGGTGTGTGCTCCAGGGGGCAGG - Intronic
1020023723 7:4883906-4883928 GGATGCAGCCTCGAGGGGGCGGG + Intergenic
1020077971 7:5271030-5271052 TCGAGGCTCCTTGAGGGGGCTGG - Intergenic
1023325264 7:39048365-39048387 TGGGGCCTACTTGAGGGTGCAGG - Intronic
1023806735 7:43877815-43877837 TGATCCCTCCTCGGGGGTGCAGG - Exonic
1024030434 7:45455875-45455897 TGGCCCATCCTCTAGGGGGCTGG - Intergenic
1025061117 7:55809248-55809270 TGGGGCCTCCTTGAGGGTGGAGG + Intronic
1028346280 7:89787923-89787945 TGGTGCCTACTTGAGGGTGGAGG - Intergenic
1029054429 7:97726365-97726387 TGGTGTCTGCTTGAGGGGGGAGG - Intergenic
1030493493 7:110267824-110267846 TTTTGCCTCCTCAAAGGGGCTGG + Intergenic
1030807925 7:113938735-113938757 TGGTGCCTGCTTGAGGGTGGAGG - Intronic
1032483911 7:132268692-132268714 TGGTGCCTCCAGGAGGAGGAAGG + Intronic
1035181155 7:157090543-157090565 TGGGGCAGCCTCGAGGCGGCTGG + Intergenic
1035241328 7:157531642-157531664 TGGGGCCTACTTGAGGGTGCAGG - Intergenic
1035788137 8:2278637-2278659 TGGTGGCTCCTAGATGGGCCTGG + Intergenic
1035804670 8:2443068-2443090 TGGTGGCTCCTAGATGGGCCTGG - Intergenic
1038343625 8:26711337-26711359 TGGAGCCTACTAGAGGGGGGTGG - Intergenic
1041172395 8:55157677-55157699 TGGGGCCTACTTGAGGGTGCAGG - Intronic
1041914040 8:63121695-63121717 TGGGGCCTCCTTGAGGGAGGAGG - Intergenic
1043028361 8:75100161-75100183 TGGTGTCTACTTGAGGGTGCAGG + Intergenic
1045322628 8:101093437-101093459 GGGTTCCTCCTCCAGGGGGTGGG - Intergenic
1046485778 8:114886215-114886237 TGGAGCCTACTCGAGGGAGAAGG + Intergenic
1048557913 8:135499053-135499075 TGGTGCCTATTCTAGTGGGCAGG + Intronic
1049376186 8:142290216-142290238 TGGGGCCTGCTCGAGGGGCTGGG + Intronic
1049697989 8:143993048-143993070 TGGTGCCCCTTGGCGGGGGCGGG - Exonic
1051891992 9:21951886-21951908 TGGTGCCTACTTGAGGGCGGAGG + Intronic
1053409323 9:37905270-37905292 TGGTTCTCCCTCGAGGGGGGAGG - Intronic
1053428728 9:38027891-38027913 GGGTGCCTCCTGGAGAGGGATGG + Intronic
1055966444 9:81869481-81869503 TGGTGCCTACTTGAGGGTGGGGG - Intergenic
1056127396 9:83549107-83549129 TGGGGTCTTCTTGAGGGGGCAGG - Intergenic
1056659429 9:88534044-88534066 TGATGCCTCTTCCAGGGTGCTGG + Intergenic
1057209000 9:93189480-93189502 TGGTGCCACCCAGAGGGGGCAGG + Intronic
1057980351 9:99654889-99654911 TGGGGCCTACTAGAGGGTGCAGG + Intergenic
1058510520 9:105712837-105712859 TGGGGTCTCCACGATGGGGCTGG + Intronic
1058968894 9:110062246-110062268 TGGGGCCTCTTGGAGGGGGTGGG - Intronic
1062343748 9:136105301-136105323 TGGTGCTTCCTCCTGGGGACAGG - Intergenic
1187653665 X:21442985-21443007 TGGGGCCTACTCGAGGGTGAAGG + Intronic
1188818873 X:34748883-34748905 TGTTGCCTCCCTAAGGGGGCAGG - Intergenic
1189205044 X:39230569-39230591 TGGTGATTCCTTGAGGAGGCTGG + Intergenic
1189272271 X:39759891-39759913 GGGTGACTCCCCGAGGTGGCTGG - Intergenic
1192139104 X:68632461-68632483 TGGTGCCTCATGTAGGGAGCTGG - Intergenic
1192767181 X:74152662-74152684 AGGTGCCTCCTTGAGGGTGGAGG + Intergenic
1194202032 X:90964019-90964041 TGGAGCCTACTCGAGGGTGGAGG + Intergenic
1195173558 X:102293140-102293162 TGTGGACTACTCGAGGGGGCAGG - Intergenic
1195185307 X:102393956-102393978 TGTGGACTACTCGAGGGGGCAGG + Intronic
1198608078 X:138366547-138366569 TGGTGCCTACTTGAGGGTGTAGG + Intergenic
1200547870 Y:4539470-4539492 TGGAGCCTACTCGAGGGTGGAGG + Intergenic