ID: 1089321107

View in Genome Browser
Species Human (GRCh38)
Location 11:117627360-117627382
Sequence TCGCCCTGCCCTGTTTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 237}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089321099_1089321107 22 Left 1089321099 11:117627315-117627337 CCTTCAAAAGCTCCTTCCTCACC 0: 1
1: 1
2: 2
3: 25
4: 302
Right 1089321107 11:117627360-117627382 TCGCCCTGCCCTGTTTCCCATGG 0: 1
1: 1
2: 3
3: 31
4: 237
1089321104_1089321107 6 Left 1089321104 11:117627331-117627353 CCTCACCACCATCTGAGGTGGGT 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1089321107 11:117627360-117627382 TCGCCCTGCCCTGTTTCCCATGG 0: 1
1: 1
2: 3
3: 31
4: 237
1089321101_1089321107 10 Left 1089321101 11:117627327-117627349 CCTTCCTCACCACCATCTGAGGT 0: 1
1: 0
2: 0
3: 35
4: 358
Right 1089321107 11:117627360-117627382 TCGCCCTGCCCTGTTTCCCATGG 0: 1
1: 1
2: 3
3: 31
4: 237
1089321105_1089321107 1 Left 1089321105 11:117627336-117627358 CCACCATCTGAGGTGGGTTTTCA 0: 1
1: 0
2: 2
3: 19
4: 139
Right 1089321107 11:117627360-117627382 TCGCCCTGCCCTGTTTCCCATGG 0: 1
1: 1
2: 3
3: 31
4: 237
1089321106_1089321107 -2 Left 1089321106 11:117627339-117627361 CCATCTGAGGTGGGTTTTCATTC 0: 1
1: 0
2: 0
3: 19
4: 195
Right 1089321107 11:117627360-117627382 TCGCCCTGCCCTGTTTCCCATGG 0: 1
1: 1
2: 3
3: 31
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089321107 Original CRISPR TCGCCCTGCCCTGTTTCCCA TGG Intronic
900619874 1:3581815-3581837 TCCTCCCACCCTGTTTCCCACGG + Intronic
900853806 1:5164707-5164729 TCCACCTGCCATGTGTCCCAGGG + Intergenic
900949062 1:5847421-5847443 TTGCCCAGCACTGTTTCTCAAGG - Intergenic
901218818 1:7570646-7570668 TGGCACTGCCCTGTTCACCAAGG + Intronic
901325292 1:8361662-8361684 TGGCCGTGCCCTGTCTCCTAGGG - Intronic
903219082 1:21859012-21859034 TCACCCTGCCCTGTCGTCCAGGG - Intronic
903755496 1:25657738-25657760 TTGTCATGCCCTGTTACCCATGG + Intronic
904402710 1:30267241-30267263 ACTCCCTGCCCCGCTTCCCAAGG - Intergenic
904586259 1:31582583-31582605 GCCCCTTGCCCTGCTTCCCAGGG - Intronic
904586583 1:31584195-31584217 TGGCCCTGCCCTTATTCCCCTGG + Intronic
905015675 1:34776985-34777007 TCTGCCTGATCTGTTTCCCATGG + Intronic
906128751 1:43443330-43443352 GCTCACTGCCCTGTTTCCCCAGG + Exonic
906239863 1:44236175-44236197 TCCCCCTGCCCTGGCACCCAGGG + Intronic
906318696 1:44803842-44803864 TGGCCCTGCCCTGGCTCCCAGGG - Intronic
906542988 1:46602480-46602502 TCTCCCCTCCCTGTTTCCCTTGG - Intronic
906616350 1:47235405-47235427 GCCCCCTCCCCTGTTTCCGATGG + Intergenic
910554783 1:88519418-88519440 TGGCCCTACCCAGTTTCCCTTGG + Intergenic
913326708 1:117634260-117634282 TCTCCCTGCCCTCTTTCACCAGG - Intergenic
913936844 1:125063728-125063750 TCTGCCTCCCCTGTTTCTCAGGG - Intergenic
914240828 1:145851627-145851649 GAGCCTTGCTCTGTTTCCCAGGG - Intronic
915536158 1:156537102-156537124 TCACCCTGCTCTGCTCCCCATGG + Intronic
915876616 1:159617220-159617242 ACTCCCGGCCCTGTTTCCCTGGG - Intergenic
918073336 1:181150105-181150127 TGACCCTGCCCTGGTTCCCTGGG + Intergenic
922117599 1:222629458-222629480 ACTGCCTGCCCTGATTCCCAGGG - Exonic
923687137 1:236161180-236161202 TTGCTCTGCTCTGTATCCCAGGG + Intronic
924217574 1:241839851-241839873 TTCCCCAGCCCTGTTTTCCAGGG + Intergenic
1062884220 10:1004421-1004443 AGCCCCTGCCCTGTTTCCCTGGG + Intronic
1064653665 10:17535382-17535404 TCGCCCTGCACTGTTACTCAGGG - Intergenic
1068935018 10:62627107-62627129 TTGCCCTGCCTAGGTTCCCAGGG - Intronic
1069702067 10:70434192-70434214 TGGCCCTGCCCTGCTGTCCAAGG - Intronic
1070751020 10:78963988-78964010 CCACCCTGCCCTGCCTCCCAGGG + Intergenic
1071496128 10:86168797-86168819 TTGCCCTGCCCTGTCCCCCAGGG - Intronic
1073902227 10:108235721-108235743 TCTCCCTTGTCTGTTTCCCAAGG + Intergenic
1074199395 10:111221267-111221289 AAGCTCTGCCCTGTATCCCAGGG - Intergenic
1074261939 10:111862957-111862979 TTGCCCTGACCTATATCCCATGG + Intergenic
1074509420 10:114099308-114099330 TCTCCTTTCCCTGCTTCCCAGGG + Intergenic
1074732445 10:116393413-116393435 ACGCGCAGCCCTGTTTCCCGTGG - Intergenic
1075719843 10:124578202-124578224 TAGCCTTGACCTGCTTCCCAGGG + Intronic
1075810079 10:125218840-125218862 AGGCCCTGGCCTGTCTCCCATGG + Intergenic
1075966244 10:126614212-126614234 TCCCCCTGCCCACTTTCCCAAGG + Intronic
1076849557 10:133086330-133086352 GAGCCCTGCCCTGAGTCCCACGG - Intronic
1076851821 10:133096990-133097012 TCTCCCTGCCCCGCTACCCAGGG + Exonic
1077581133 11:3418029-3418051 CTGCCCTGCACTGTCTCCCATGG + Intergenic
1077822758 11:5765965-5765987 TCCCCCTGCCCTGAACCCCATGG + Intronic
1077867976 11:6238987-6239009 GCACTCTGCCCTGTCTCCCAGGG - Intronic
1077929283 11:6713375-6713397 TCTGCCTGCCCTGTCTCCCAGGG + Intergenic
1080852140 11:36078955-36078977 TCGCTCTCCGCTGTATCCCAGGG - Intronic
1080875099 11:36267618-36267640 TTCCCCTTCCCTCTTTCCCATGG + Intergenic
1084099345 11:66935408-66935430 TCTCCCTGCCATGTTGCCCAAGG - Intronic
1084106862 11:66986079-66986101 TGGCCCTTCCCTGCTGCCCATGG - Intergenic
1084238062 11:67800867-67800889 CCGCCCTGCATTGTCTCCCATGG + Intergenic
1084834349 11:71791967-71791989 CCGCCCTGCACTGTCTCCCATGG - Intronic
1088814709 11:113413068-113413090 TGCCCCTGTCCTTTTTCCCATGG + Intronic
1089321107 11:117627360-117627382 TCGCCCTGCCCTGTTTCCCATGG + Intronic
1089343899 11:117777991-117778013 TCTCCCTGCCATGGTTGCCAGGG + Intronic
1090186685 11:124743641-124743663 TCCCCTCGCCATGTTTCCCAAGG - Intronic
1091629703 12:2150381-2150403 TCCCTCTGCCCTGTTCCCCAGGG - Intronic
1091697232 12:2636089-2636111 TCTCCCTGCAGTGTCTCCCACGG - Intronic
1092155341 12:6278646-6278668 GCGCCCTGCCCTGTGTTCCCGGG + Intergenic
1092408732 12:8238497-8238519 CCACCCTGCACTGTCTCCCATGG + Intergenic
1093013314 12:14130873-14130895 TCACCCTGGCCTGGTTCACAGGG + Intergenic
1094500998 12:31020658-31020680 TAACCCTGCCCTGCTTCCCCAGG - Intergenic
1095095140 12:38143296-38143318 TCTCCCTCCCTTGTTTCCTAGGG + Intergenic
1101329489 12:103745997-103746019 TCGCCATGCCCTGTGACCCCAGG - Intronic
1102453441 12:113057297-113057319 TCGCCCCGCCCGCTTTCCCTTGG - Intronic
1102598509 12:114011814-114011836 GCTCCCTGCCCTCTTCCCCATGG + Intergenic
1106248050 13:27965340-27965362 TCACCCTGCCCCCTTTCCCTTGG - Intronic
1111609022 13:90579200-90579222 TTGCCCTGCCTAGTTTACCAGGG - Intergenic
1111855212 13:93628403-93628425 TCTCCCTGCCCACTTTACCAAGG - Intronic
1112004180 13:95240203-95240225 TTGCCCTGCACGGATTCCCAGGG - Intronic
1112385702 13:98937937-98937959 TGGGCCTGCCCTGCTGCCCAGGG - Intronic
1113369249 13:109707614-109707636 CCTCCCTTCCCTGTTTCCCAGGG + Intergenic
1113453268 13:110428446-110428468 TCTCACTGCTCTCTTTCCCAGGG + Exonic
1113785253 13:112999076-112999098 TGGCCCTGCTCTGTGTCCCTGGG - Intronic
1114189623 14:20430432-20430454 TTGCCTGGCCCTGTTCCCCATGG - Exonic
1120876069 14:89377088-89377110 TCACCTTGCCTTGTGTCCCATGG - Intronic
1121613135 14:95294695-95294717 TCTCCCTGCCCTGTGTCCTGGGG + Intronic
1121622667 14:95361146-95361168 ACGCCCAGCCCTGGATCCCAGGG + Intergenic
1123931444 15:25173564-25173586 CCAGCCTGCCCTGTTTTCCAGGG + Intergenic
1124369586 15:29096293-29096315 TCTCCCTGCCCTGTTACTGATGG + Intronic
1126356486 15:47801725-47801747 TCAACCTGGCCTGTGTCCCAGGG - Intergenic
1126666004 15:51077120-51077142 GCTCCCTCCCCTGTTTCCCTGGG + Intronic
1127070672 15:55285871-55285893 TGGCCCTGCCCAGTTTGCCCAGG + Intronic
1127328285 15:57916226-57916248 CCGGCCTGCCCTGTTCCACAGGG + Intergenic
1129814501 15:78540233-78540255 TCTTCCTGCCCTCTTCCCCATGG + Intergenic
1131217476 15:90550862-90550884 TCTGCCTGTCCTGTTGCCCAGGG + Intronic
1131694068 15:94856394-94856416 TCGCCCTGGCCTGGCTCCCCCGG - Intergenic
1132482856 16:175241-175263 GCTCCCTGCCCTGTCTCCCCAGG - Intergenic
1132611896 16:821245-821267 TGGCCCTCCCCTGCCTCCCAGGG - Intergenic
1133051402 16:3119319-3119341 TCTCCCTGCCCTGGTTCTGAAGG - Exonic
1133349697 16:5093314-5093336 CCGCCCTGCACTGTCTCCCATGG + Intronic
1134102296 16:11460899-11460921 AGGGCCTGCCCTGTTTCCTAGGG - Intronic
1137277007 16:46941950-46941972 GCACCATGCCCTGTTTCTCAGGG + Intergenic
1138630827 16:58293151-58293173 CCGCCCTGCCCTGCCTCCCTGGG - Intronic
1140286158 16:73604796-73604818 TCTCCCTGCACTGTTTAGCATGG - Intergenic
1141118182 16:81329793-81329815 TCACCCTGCACTGTCTCCCACGG + Intronic
1141700493 16:85639962-85639984 TCGCCCCCAACTGTTTCCCAGGG - Intronic
1142801896 17:2351519-2351541 TGGCCCTGGCCTGGTTCCCTGGG + Intronic
1143118891 17:4595414-4595436 CAGCCCTGTCCTGTTCCCCAGGG + Intronic
1144970813 17:19108364-19108386 TCCTCCAGCCCTGTTTTCCATGG + Intergenic
1144991115 17:19234526-19234548 TCCTCCAGCCCTGTTTTCCATGG + Intronic
1145308211 17:21687126-21687148 TCTGCCTCCCCTGTTTCTCAGGG - Intergenic
1145966158 17:28919217-28919239 TTGCCCTCTCCTGTTTCACATGG - Exonic
1146682101 17:34815779-34815801 TCTCCCTGTCCTGGTCCCCAAGG + Intergenic
1146972342 17:37083199-37083221 TGGGCCTGCCCTGTTCCACATGG - Intergenic
1148085612 17:44992019-44992041 TCCCCCAGCCCCGCTTCCCAGGG - Intergenic
1148240974 17:45999098-45999120 ATACCCTGCCCTGTGTCCCATGG + Intronic
1148914301 17:50961508-50961530 TGCTCCTGCCCTGTTCCCCAGGG + Intergenic
1149397725 17:56261948-56261970 TCTCCCTGCCCAGGTCCCCAAGG + Intronic
1150802966 17:68296274-68296296 TCCACCTGCCCTGTTCCTCAAGG + Intronic
1154203299 18:12315707-12315729 GCACGCTGCACTGTTTCCCAGGG + Intronic
1155433575 18:25787540-25787562 TCGCTCTGCCCTGTATCACAGGG - Intergenic
1156267940 18:35505150-35505172 TCGCCCTGCCCCTGTTCCCAGGG - Intergenic
1158668255 18:59452094-59452116 TTGACCTGTCGTGTTTCCCATGG + Intronic
1160269330 18:77370037-77370059 TGCCCCTGCCCTTTCTCCCAAGG - Intergenic
1160511416 18:79455554-79455576 GGGCCCTGCCCTGGTTCGCAGGG + Intronic
1161106045 19:2444616-2444638 TGGCCCTGCTCAGATTCCCAGGG + Intronic
1161468480 19:4444961-4444983 TGGGCCTGCCCTGTGTCCCACGG + Intronic
1162335065 19:10055225-10055247 AAGCCCTGCTCTGTTTCCCCAGG + Intergenic
1164704987 19:30313450-30313472 ACACACAGCCCTGTTTCCCAGGG + Intronic
1165152914 19:33771490-33771512 CAGCCCTCCCCAGTTTCCCAAGG - Intronic
1165176485 19:33934245-33934267 TCTCCCTGTGCTGTTCCCCAGGG - Intergenic
1166633730 19:44431069-44431091 TCTCCCTGCACTGTGTCTCAGGG + Intronic
1166640662 19:44492545-44492567 TCCCCCTGCTTTGGTTCCCATGG - Intronic
1168559539 19:57371451-57371473 CAGCCCTGCCTTGTTTCCCTTGG - Intronic
925283615 2:2701907-2701929 TGGGCCTGCCCTGGTTTCCACGG - Intergenic
925386901 2:3468276-3468298 TCTCCCTTCCCTCTTCCCCAAGG + Intronic
926218031 2:10917267-10917289 GCTCCCTGCTTTGTTTCCCACGG + Intergenic
927504411 2:23603733-23603755 TCGGCCTGGCCTGCTCCCCAGGG - Intronic
927920564 2:26969401-26969423 TCCCTCAGCCCTGATTCCCATGG - Intergenic
929265928 2:39919738-39919760 GTGCACTGCCCTGTTGCCCAAGG - Intergenic
929856461 2:45642417-45642439 CCACCCAGCCCTGCTTCCCAGGG - Intergenic
930658143 2:54027367-54027389 CTGTCCTGCCCTGTATCCCAGGG + Intronic
932777544 2:74537056-74537078 TCCCCCTTCCATGTTTCCCTCGG + Intronic
934871365 2:97869404-97869426 TGGCCCTGCCCTTTCTTCCAGGG + Intronic
934913758 2:98281235-98281257 TAGCCCTGTCCTGTTCACCAAGG + Intronic
937060672 2:118978226-118978248 TCAGTCTGCCCTGCTTCCCAAGG - Intronic
938139287 2:128783153-128783175 TCTCCATGCCATCTTTCCCAGGG + Intergenic
940853128 2:158706970-158706992 TAGCCCAGCTCTGGTTCCCATGG - Intergenic
947955984 2:234192086-234192108 TCCCACTGCCCTGTCTCCCCTGG + Intergenic
948151931 2:235751384-235751406 TCCCCCTGCTCTGGTGCCCAGGG + Intronic
948273114 2:236688860-236688882 TCTCCCTGCCCTCCCTCCCATGG + Intergenic
948587473 2:239028284-239028306 TCGCCCTGCCCTGTGGCCACGGG + Intergenic
1169035958 20:2452221-2452243 GCAGCCTGCCCTGTTTCCCTAGG - Intergenic
1170512390 20:17091653-17091675 TGGCCCTGCCCTGTACTCCAGGG - Intergenic
1171370542 20:24659346-24659368 TCCCCCTACCGTGTTTCCAAGGG - Intronic
1171447074 20:25212459-25212481 TCCCCCTGCCATGTTTCACCTGG + Intronic
1171523908 20:25795174-25795196 TCTGCCTCCCCTGTTTCTCAGGG - Intronic
1171533490 20:25867128-25867150 TCTGCCTCCCCTGTTTCTCAGGG - Intronic
1171552919 20:26060709-26060731 TCTGCCTCCCCTGTTTCTCAGGG + Intergenic
1171846891 20:30282864-30282886 TCTGCCTCCCCTGTTTCTCAGGG + Intergenic
1171847425 20:30285466-30285488 TCTGCCTCCCCTGTTTCTCAGGG - Intergenic
1172995049 20:39064421-39064443 TAGCCCTGCCCTGCTCCCCGGGG - Intergenic
1173084700 20:39904562-39904584 TGCTCCTGCCCTTTTTCCCAGGG - Intergenic
1173458158 20:43220442-43220464 TAGCCCTGGCCTGATCCCCAGGG + Intergenic
1174038109 20:47680531-47680553 AGGCCCTGCCCTGGTCCCCAGGG - Intronic
1174414018 20:50355404-50355426 TCACCCTGCCCCGTGGCCCATGG + Intergenic
1175538081 20:59729235-59729257 CCGCCCTGCCCTGACTCCCCCGG - Intronic
1175840213 20:62021926-62021948 TGGACCTGCCCTGCTCCCCAGGG - Intronic
1177122795 21:17158635-17158657 TTGTCCTGTGCTGTTTCCCATGG - Intergenic
1178949613 21:36975410-36975432 TGCCCGTCCCCTGTTTCCCACGG + Intronic
1179074791 21:38109925-38109947 TGGTCCTTCCCTGTTTCTCAAGG - Intronic
1179913101 21:44460558-44460580 TCCCCCTGCCTTGTCTCGCAAGG - Exonic
1180124262 21:45778466-45778488 TCGCCCATGCCAGTTTCCCAGGG - Intronic
1181349133 22:22243028-22243050 TTCTCCTGCCCTGATTCCCAAGG + Intergenic
1182066248 22:27433748-27433770 TGGCCCTGACCTCTGTCCCAGGG + Intergenic
1183066731 22:35368577-35368599 TCTCCCTGCCCTGGTCTCCAAGG + Intergenic
1183577224 22:38699885-38699907 GCTCCCTGCGCTGTTTCTCATGG + Exonic
1184921569 22:47609049-47609071 TAGCACAGCCCTGTTACCCATGG - Intergenic
1185345973 22:50310970-50310992 TCCCCCAGCCCTGTGTCCCCTGG + Exonic
952974386 3:38681653-38681675 CTGCCCTGCCCTGTTACCCAGGG - Intergenic
953441556 3:42923162-42923184 TCGCCTTTCCATTTTTCCCAAGG + Intronic
953916707 3:46925106-46925128 TCACCCTGCCCTGCTGCCCAAGG + Intronic
954794972 3:53156823-53156845 ACCCCCTACACTGTTTCCCATGG + Intronic
956310713 3:67876358-67876380 TTGCCCTGGCCTGGGTCCCATGG - Intergenic
957054000 3:75430662-75430684 CTGCCCTGCACTGTCTCCCATGG + Intergenic
959931130 3:111984235-111984257 TTGCCCTGTTCTATTTCCCAAGG + Intronic
961300837 3:125921053-125921075 CCGCCCTGCACTGTCTCCCATGG - Intergenic
961887670 3:130107039-130107061 CTGCCCTGCACTGTCTCCCATGG + Intronic
962405138 3:135094160-135094182 CTGGCCTGCCCTCTTTCCCAGGG - Intronic
962938362 3:140102450-140102472 CCGCCCTGCCCTGCTTTCCAAGG - Intronic
963069313 3:141289794-141289816 TCACCCTGACCTGTTAGCCAGGG - Intronic
964733623 3:159893701-159893723 TTTGCCTGCCCTGTTTCCGATGG - Intronic
966930875 3:184674677-184674699 TGGCCCTCCCCTGAGTCCCAAGG - Intronic
967218451 3:187229461-187229483 TCGACCTTCCCTGATTCCCAAGG + Intronic
968441773 4:627934-627956 TCGGCCTGGCCTGTTCCCCAGGG + Intronic
968690455 4:1987333-1987355 ATGCCCTGCCATGGTTCCCAGGG + Intronic
968698625 4:2044327-2044349 TGGCCCTGCCCTCTCTCCCCGGG - Intergenic
968996804 4:3950969-3950991 CCGCCCTGCACTGTCTCCCATGG + Intergenic
969715140 4:8864692-8864714 TGGCCCTGCCCTGTTATCCGTGG - Intronic
969757204 4:9157707-9157729 CCGCCCTGCACTGTCTCCCATGG - Intergenic
969817155 4:9695272-9695294 CCGCCCTGCACTGTTTCCCATGG - Intergenic
972475767 4:39447490-39447512 TCGCTCTGCCCTGTGTCTGAAGG - Intronic
979106874 4:116700749-116700771 GCGCTGTGCCCTGTTTCCTAGGG - Intergenic
983288610 4:165771717-165771739 GGGTCTTGCCCTGTTTCCCAAGG + Intergenic
984619783 4:181939412-181939434 TCTTCCTGGCCTGTTTCCCATGG - Intergenic
985200387 4:187478638-187478660 TTGCCCTGCCCTGTTTCCCATGG - Intergenic
985802370 5:2013147-2013169 TCTCCCTGCCCTGTGACCCTGGG + Intergenic
989255145 5:39358420-39358442 GCACCCTTCCCTGTTCCCCAGGG - Intronic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
991413378 5:66367052-66367074 TGGCCCTCCCATGTTTCCCAGGG - Intergenic
993680143 5:90867476-90867498 TTGCAATGTCCTGTTTCCCAGGG + Intronic
995549536 5:113267105-113267127 TCACACTCCCCTGTATCCCAGGG + Intronic
996579584 5:125016251-125016273 TGGCCCTGCCATGTCTTCCAAGG + Intergenic
1000203842 5:159038255-159038277 TTTCCCTCCACTGTTTCCCATGG - Intronic
1001065396 5:168531351-168531373 TCGCCCTCCCCTGTCCCCCCCGG + Intergenic
1002536320 5:179878201-179878223 TGACCCTGCCTTGTGTCCCAAGG - Intronic
1003113165 6:3265574-3265596 ACACCCTGCCCTATATCCCAGGG - Intronic
1004802134 6:19160485-19160507 TGGTCCTGACCTGTTTCCCCTGG - Intergenic
1006465927 6:34195017-34195039 ACCCCCTGCCCTGTGTCCCTAGG + Intergenic
1007251786 6:40500229-40500251 TCACCCAGCTCTGTGTCCCAGGG + Intronic
1007324367 6:41048853-41048875 TCTCCCTGTCCTGTTTCCCACGG - Intronic
1007570252 6:42884902-42884924 CCTCCCTACCCTGTGTCCCATGG - Intronic
1007597416 6:43060000-43060022 TCGACCTGCCCTGGTGCCCAGGG - Exonic
1010121808 6:72384745-72384767 TAGCCTTGACCTGTTTCTCATGG + Intronic
1012982448 6:105844424-105844446 ACACCCAGCCATGTTTCCCAGGG + Intergenic
1014374896 6:120660217-120660239 TCTCCCAGCCATGCTTCCCATGG - Intergenic
1016777579 6:147921748-147921770 ACCCCCTGGCCTGTTGCCCATGG + Intergenic
1017461313 6:154653517-154653539 GCCCCCTGCTCTGGTTCCCAGGG - Intergenic
1019148783 6:169990765-169990787 TAGCCCTGCCCGCTTTCCCTGGG + Intergenic
1019650869 7:2157541-2157563 ACCCTCTGCCCTGTGTCCCAGGG - Intronic
1022259457 7:28690384-28690406 TCGCCCTCACATGTTTCCCTTGG + Intronic
1023131899 7:37011843-37011865 TCCTCCTTCCCTCTTTCCCAGGG + Intronic
1023524270 7:41082710-41082732 TCTGCCTGCAGTGTTTCCCATGG + Intergenic
1023967945 7:44972953-44972975 AGACCCTGCCCTGTGTCCCAAGG + Intronic
1025284782 7:57652516-57652538 TCTCCCTACCCTGTTTCTCAGGG - Intergenic
1033248236 7:139736525-139736547 CTGCTCTGCCCTGATTCCCAGGG + Intronic
1034152571 7:148928530-148928552 TCCCCCTGCCCAAATTCCCAAGG + Intergenic
1035451347 7:158979156-158979178 TCGCCCTGCCCTGAAACCCAAGG + Intergenic
1035920094 8:3667467-3667489 TGGCCCTGCATTGTTTGCCAGGG - Intronic
1036380437 8:8233022-8233044 CCACCCTGCACTGTCTCCCATGG - Intergenic
1036774006 8:11597656-11597678 TCCCCCTGCCCTGGATCCCAAGG + Intergenic
1036848673 8:12186673-12186695 GTGCCCTGCCCTGTGCCCCAAGG + Intronic
1036849128 8:12189638-12189660 CCACCCTGCACTGTCTCCCATGG + Intronic
1036870034 8:12428954-12428976 GTGCCCTGCCCTGTGCCCCAAGG + Intronic
1036870489 8:12431912-12431934 CCACCCTGCACTGTCTCCCATGG + Intronic
1037823404 8:22146763-22146785 TGGCCCTGCCCTGCCGCCCACGG - Intergenic
1040902317 8:52429296-52429318 TCCTCCTGCACTTTTTCCCATGG + Intronic
1043295996 8:78664843-78664865 CCGCCCTTCCCTGGTTCCCCTGG - Intergenic
1044181506 8:89201379-89201401 TCGCAGTGCTCTGTGTCCCATGG + Intergenic
1049006173 8:139857033-139857055 TCCCCCCGCCCAGATTCCCAGGG - Intronic
1049429099 8:142550955-142550977 CTTCCCTGCCCTGGTTCCCAAGG - Intergenic
1049521399 8:143093143-143093165 TCTCCCTGCTCTGGTTCCAAAGG + Intergenic
1049811568 8:144576488-144576510 TAGCCCTGCCCTGTCACCCATGG - Intronic
1049879368 8:145051921-145051943 TCGCTCTTCCCCATTTCCCAGGG + Intergenic
1050303732 9:4285683-4285705 TAGCGCTGCCCTGTTTCCCTGGG - Intronic
1052100328 9:24438235-24438257 TTGCACTGCACTGTTTCTCAAGG + Intergenic
1052974392 9:34400671-34400693 GCACCCTGCCCCGCTTCCCAGGG - Exonic
1053784582 9:41645091-41645113 TCTGCCTCCCCTGTTTCTCAGGG + Intergenic
1054160441 9:61669098-61669120 TCTGCCTCCCCTGTTTCTCAGGG - Intergenic
1054161189 9:61672936-61672958 TCTGCCTACCCTGTTTCTCAGGG - Intergenic
1054172548 9:61855241-61855263 TCTGCCTCCCCTGTTTCTCAGGG + Exonic
1054173310 9:61859029-61859051 TCTGCCTCCCCTGTTTCTCAGGG + Intergenic
1054447399 9:65384252-65384274 TCTGCCTCCCCTGTTTCTCAGGG + Intergenic
1054448168 9:65388113-65388135 TCTGCCTCCCCTGTTTCTCAGGG + Intergenic
1054664232 9:67721752-67721774 TCTGCCTCCCCTGTTTCTCAGGG - Intergenic
1054664992 9:67725560-67725582 TCTGCCTCCCCTGTTTCTCAGGG - Intergenic
1056965568 9:91160886-91160908 TCGCCCTCCCCAGTATCCCCTGG - Intergenic
1057223223 9:93268855-93268877 TCACCCTGCCCTGTCTCCCATGG + Exonic
1058126694 9:101203381-101203403 TGGCCCAGCACTGTTTCCAAAGG - Intronic
1060851844 9:126883802-126883824 TCGCACTGTCATGCTTCCCAGGG + Exonic
1060888919 9:127175989-127176011 AGGCTCTGCCCTGATTCCCAGGG + Intronic
1062205210 9:135332740-135332762 CTCCCCTGCCCTGTTTCCCATGG + Intergenic
1062431880 9:136529994-136530016 GGGCCCTGCCCTGGCTCCCAGGG + Intronic
1062455455 9:136635159-136635181 TCGCCCAGCTCTGTTTGTCACGG + Intergenic
1186175491 X:6921784-6921806 TCACCTTTCACTGTTTCCCATGG + Intergenic
1187352676 X:18535479-18535501 TCACCCTTCCATGTTTCTCAAGG - Intronic
1190177102 X:48159353-48159375 TCTACTTGCCCTGATTCCCATGG - Intergenic
1194403039 X:93461619-93461641 TCACCCTGCCCTCTTCGCCAGGG - Intergenic
1196759746 X:119190488-119190510 TGGCCCTGTGCTGTGTCCCAGGG + Intergenic
1197774441 X:130110438-130110460 TCGCCCGGCCCGGCTTCCGAGGG - Exonic
1198960290 X:142175423-142175445 TCCTCCTGCCCCTTTTCCCAGGG + Intergenic
1200249478 X:154545095-154545117 GCACCCTCCCCTGTGTCCCATGG - Intronic