ID: 1089325015

View in Genome Browser
Species Human (GRCh38)
Location 11:117651035-117651057
Sequence TGACCTCCAAGGTCCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 188}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089325015_1089325020 -5 Left 1089325015 11:117651035-117651057 CCTGGGTGGGACCTTGGAGGTCA 0: 1
1: 0
2: 0
3: 25
4: 188
Right 1089325020 11:117651053-117651075 GGTCATGCCTGTGACCATGGGGG 0: 1
1: 0
2: 5
3: 11
4: 179
1089325015_1089325021 1 Left 1089325015 11:117651035-117651057 CCTGGGTGGGACCTTGGAGGTCA 0: 1
1: 0
2: 0
3: 25
4: 188
Right 1089325021 11:117651059-117651081 GCCTGTGACCATGGGGGACATGG 0: 1
1: 0
2: 0
3: 21
4: 217
1089325015_1089325025 19 Left 1089325015 11:117651035-117651057 CCTGGGTGGGACCTTGGAGGTCA 0: 1
1: 0
2: 0
3: 25
4: 188
Right 1089325025 11:117651077-117651099 CATGGACATGGCCTGATTTGTGG 0: 1
1: 0
2: 2
3: 11
4: 161
1089325015_1089325019 -6 Left 1089325015 11:117651035-117651057 CCTGGGTGGGACCTTGGAGGTCA 0: 1
1: 0
2: 0
3: 25
4: 188
Right 1089325019 11:117651052-117651074 AGGTCATGCCTGTGACCATGGGG 0: 1
1: 0
2: 0
3: 8
4: 193
1089325015_1089325017 -8 Left 1089325015 11:117651035-117651057 CCTGGGTGGGACCTTGGAGGTCA 0: 1
1: 0
2: 0
3: 25
4: 188
Right 1089325017 11:117651050-117651072 GGAGGTCATGCCTGTGACCATGG 0: 1
1: 0
2: 3
3: 29
4: 218
1089325015_1089325023 7 Left 1089325015 11:117651035-117651057 CCTGGGTGGGACCTTGGAGGTCA 0: 1
1: 0
2: 0
3: 25
4: 188
Right 1089325023 11:117651065-117651087 GACCATGGGGGACATGGACATGG 0: 1
1: 0
2: 5
3: 17
4: 205
1089325015_1089325026 20 Left 1089325015 11:117651035-117651057 CCTGGGTGGGACCTTGGAGGTCA 0: 1
1: 0
2: 0
3: 25
4: 188
Right 1089325026 11:117651078-117651100 ATGGACATGGCCTGATTTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 154
1089325015_1089325018 -7 Left 1089325015 11:117651035-117651057 CCTGGGTGGGACCTTGGAGGTCA 0: 1
1: 0
2: 0
3: 25
4: 188
Right 1089325018 11:117651051-117651073 GAGGTCATGCCTGTGACCATGGG 0: 1
1: 0
2: 1
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089325015 Original CRISPR TGACCTCCAAGGTCCCACCC AGG (reversed) Intronic
900097336 1:945279-945301 TGACCTCCCAGTTCCTCCCCAGG - Intronic
900364333 1:2304722-2304744 GGACCCCCAAGGTCCCAGGCAGG - Intronic
902328213 1:15716658-15716680 TGACCTGCATGGGGCCACCCTGG - Intronic
903781256 1:25821252-25821274 TTACCTCCAAAGACCCAGCCGGG - Intronic
904255364 1:29251305-29251327 TGACCTCCAAGGAGTCACTCTGG - Intronic
905121328 1:35684306-35684328 TGTCCTCTGAGGTCACACCCAGG + Intergenic
905132116 1:35769378-35769400 TGACCTCCAGGGCCCCTCCCAGG + Intronic
906102539 1:43272515-43272537 TGTCCCCCACGGTCCCACCTGGG - Intronic
906687403 1:47771556-47771578 TGACCTCCAAAGACCCATCAAGG + Intronic
907474264 1:54695219-54695241 TGACCTCTGAGATCCCACCCAGG + Intronic
912387247 1:109277654-109277676 TTGCCTCTAAGGACCCACCCTGG + Intergenic
912558456 1:110533278-110533300 TGACCTCCAGGCTGCCATCCTGG + Intergenic
914681712 1:149943562-149943584 TAACCTCCTGGGTCCCATCCAGG - Exonic
915237667 1:154497088-154497110 TGACCTTCAGGGTCACAGCCTGG + Intronic
915560139 1:156682310-156682332 AGAGCTCCCAGGTCCCAGCCAGG - Intergenic
917219721 1:172716125-172716147 TGACTTCCAAGGCCACACACAGG + Intergenic
917620732 1:176793215-176793237 TGGCCTCCAAGATCCCCTCCAGG - Intronic
920177652 1:204113092-204113114 TGACCCCCAAGCTCCAGCCCAGG + Exonic
920956423 1:210623790-210623812 TGACCTCTAAAGTACCAGCCAGG + Intronic
922668587 1:227492499-227492521 TTGTCTCCAAGGTCCCACCTTGG + Intergenic
1063497839 10:6526729-6526751 TGAACTCCAAGTTCTCACCATGG - Intronic
1063616037 10:7601310-7601332 TGACCTCCAAGAACCCCCCTGGG - Intronic
1064116108 10:12578765-12578787 TGACCTCCACAGGGCCACCCAGG + Intronic
1067569417 10:47360566-47360588 CCACCTCCAAGGTCCCTGCCTGG + Intergenic
1071499533 10:86193555-86193577 TGTCCCCCAGGGACCCACCCTGG - Intronic
1071505894 10:86231285-86231307 TGACCTCCCAGGAACCAGCCCGG - Intronic
1073571030 10:104581386-104581408 TGACCTCCACAGTCCTACCGAGG - Intergenic
1075406488 10:122199092-122199114 TTACCTCCAAGGCCCCAACACGG - Intronic
1075421710 10:122306074-122306096 TGATCACCATGGGCCCACCCAGG - Intronic
1075506554 10:123027938-123027960 TGAGCTCCTGGGTCACACCCTGG - Intronic
1075669148 10:124251473-124251495 AAACCTCCAAGGTCCCTCCAAGG + Intergenic
1077230490 11:1456296-1456318 TGGCCTGGCAGGTCCCACCCTGG - Intronic
1077392181 11:2305204-2305226 TGCCCACCATGGGCCCACCCAGG - Intronic
1078259512 11:9691778-9691800 TGACATCCAAGGCCCCTGCCAGG + Intronic
1082000284 11:47390459-47390481 AGCCCTCCAAGCTCCCACCCTGG + Intergenic
1082997674 11:59266391-59266413 TCACCTCCAAGGCCCCTCACAGG - Intergenic
1083924446 11:65797551-65797573 TGGCCTCCCAGGACCCTCCCAGG + Intergenic
1084422574 11:69067618-69067640 CGACCCCCACGGTCCCTCCCTGG - Intronic
1086666664 11:89491604-89491626 ACGCCTCCAAGTTCCCACCCGGG - Intronic
1089325015 11:117651035-117651057 TGACCTCCAAGGTCCCACCCAGG - Intronic
1091250624 11:134141236-134141258 TGACCACCATCCTCCCACCCGGG - Intronic
1091749687 12:3014678-3014700 TGACATCCAAGTTCCCCTCCCGG + Intronic
1091782497 12:3222813-3222835 CCACCCCCCAGGTCCCACCCTGG + Intronic
1093973184 12:25393085-25393107 GGACTTCCCAGGTCACACCCAGG - Intergenic
1098311676 12:69155105-69155127 TCACCTGCAAGGTCAGACCCTGG + Intergenic
1101417499 12:104521183-104521205 TCACCTTAAAGGTCCCACCAGGG - Intronic
1101902706 12:108802708-108802730 TGACCTGCGACCTCCCACCCAGG + Intronic
1102234134 12:111283656-111283678 TGACCTCCAGCCTCCCAGCCTGG + Intronic
1103583673 12:121935447-121935469 AGACATCCAGGATCCCACCCAGG + Intronic
1105714945 13:23053901-23053923 TGACCTGGAAGCTCCCTCCCTGG - Intergenic
1107319426 13:39169686-39169708 TGACCGCCCAGGCCTCACCCAGG - Intergenic
1107389153 13:39945333-39945355 TGCCCACCAGGGCCCCACCCCGG + Intergenic
1109942412 13:69387911-69387933 TGACCTCCCAGCTCCCAGGCAGG + Intergenic
1113583530 13:111447138-111447160 GGACCACCAAGGTGGCACCCTGG + Intergenic
1114438863 14:22730166-22730188 TGACCTCCACGGTCCCCTCTTGG + Intergenic
1114452864 14:22838003-22838025 TCTCCTCCTTGGTCCCACCCCGG + Intronic
1114453260 14:22839805-22839827 TCCCCTCCAAGATCCCATCCTGG + Intronic
1114556446 14:23565101-23565123 TGCCCTCCCAGGCCCCACCTGGG + Exonic
1119384934 14:74252110-74252132 TGTCCTGCAAGCTCCCGCCCTGG - Intronic
1120039628 14:79738042-79738064 TGACATTCAAGATCCCACCAGGG + Intronic
1121244346 14:92451384-92451406 TGGCCTCCCCAGTCCCACCCAGG - Intronic
1121466292 14:94117335-94117357 TGACCTTCAAGATCCCAGCCAGG + Intergenic
1121511173 14:94514544-94514566 CCACCTCGAAGGGCCCACCCAGG - Intronic
1122003486 14:98683707-98683729 TGAAATGCAAGGTCCCACCCTGG + Intergenic
1125728473 15:41880177-41880199 TGACCTCCAGGGTGTCAGCCTGG + Exonic
1127339548 15:58026786-58026808 TGACCTCCAAGGCTGCAGCCTGG + Intronic
1129249475 15:74300957-74300979 TGACCTTGATGGGCCCACCCAGG - Intronic
1129382393 15:75176483-75176505 GGACCTAGAAGTTCCCACCCTGG + Intergenic
1130292372 15:82614043-82614065 AGAGCCCCAGGGTCCCACCCAGG - Intronic
1131207178 15:90460311-90460333 TGGCCTCCTAGATCCCATCCAGG + Intronic
1131459759 15:92609823-92609845 TGATCTCCAAGGGCCCCTCCAGG + Intergenic
1132152922 15:99475154-99475176 AGGCCTCCAAGTTCCCATCCAGG - Intergenic
1133428505 16:5714522-5714544 ACACATCTAAGGTCCCACCCAGG - Intergenic
1133509303 16:6442198-6442220 TAAGCACCAAAGTCCCACCCAGG - Intronic
1134359471 16:13517912-13517934 TGTCCTCCATGTTTCCACCCAGG + Intergenic
1137954233 16:52812713-52812735 TGACCTCTGATGTCCAACCCTGG - Intergenic
1138780857 16:59783799-59783821 TTTCCTCCAAGATCCCATCCAGG + Intergenic
1142278000 16:89133031-89133053 TGCCCACCCAGGGCCCACCCAGG - Intronic
1142483527 17:232735-232757 TGGCTTCCAAGGTGCCACACAGG + Intronic
1143091657 17:4452639-4452661 TGAATTCCAGGGTCCCACCCTGG - Intronic
1146674600 17:34764560-34764582 TGAGCTCCCAGGCCCCACACAGG - Intergenic
1147156890 17:38548517-38548539 TGGCCCCCAAGGTCTCAGCCAGG - Intronic
1148088003 17:45006306-45006328 TGACCCCCAAGACCCCTCCCAGG - Intergenic
1148436005 17:47685845-47685867 TGGCCTCCAAGGTGCCAGCTTGG - Intergenic
1148436086 17:47686698-47686720 TGGCCTCCAAGGTGCCAGCTTGG + Intergenic
1148779565 17:50113666-50113688 TGACCTTCAAGCTCCAGCCCTGG - Intronic
1155766669 18:29642887-29642909 TTACCTCCAGGATCCCCCCCAGG - Intergenic
1156410972 18:36828424-36828446 CGCCAACCAAGGTCCCACCCAGG - Intronic
1156905659 18:42349005-42349027 TGACCCCCAAGGCCCCACAGGGG - Intergenic
1158662340 18:59399736-59399758 TGACCTCAAATGATCCACCCTGG + Intergenic
1160524582 18:79527379-79527401 TTTCCTCCTCGGTCCCACCCTGG - Intronic
1160734956 19:658228-658250 TGCCCTGCCAGGTCCCACCCGGG - Intronic
1161420628 19:4174457-4174479 TGCCCTCCGTGGTCCCTCCCTGG - Exonic
1161563035 19:4984215-4984237 TGACCTCCCGGGGCCCAACCTGG - Intronic
1162419511 19:10558090-10558112 TGAAGCCCAAGGTCCCACCCTGG - Intronic
1162490450 19:10988062-10988084 TCACCTCCCTGCTCCCACCCTGG + Intronic
1162958387 19:14112431-14112453 TGGTCTCCAAGTCCCCACCCTGG + Intronic
1164085633 19:21899697-21899719 TGACCTGCAAGGTCACAGCCTGG - Intergenic
1164247079 19:23440347-23440369 TGATCTCCCTGGTTCCACCCAGG - Intergenic
1164304653 19:23994872-23994894 TGACCTCCCTGGTCTCTCCCAGG - Intergenic
1164473109 19:28552352-28552374 TTACCTACAAGATGCCACCCAGG + Intergenic
1165313720 19:35042442-35042464 TCTCCTCACAGGTCCCACCCTGG + Exonic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1167112352 19:47469792-47469814 TGCCCTCCCCGCTCCCACCCTGG - Intronic
1167169240 19:47820181-47820203 TGAGCTCCTGGGTCCCACACGGG - Intronic
1167394915 19:49222187-49222209 TGGACTCCAAGGTCCCACGGGGG - Intergenic
1168003503 19:53467691-53467713 CCACCTCCCAGGTCCCGCCCAGG + Intergenic
1168073314 19:53964430-53964452 TGCCCTCCAACCTCCCATCCTGG + Intronic
929763490 2:44825412-44825434 TGACCTCCCAGGTGCCTGCCAGG - Intergenic
929970757 2:46573291-46573313 TGACCTCAAGAGTCCCACCTCGG + Intronic
932093010 2:68823559-68823581 AGTCCCCCATGGTCCCACCCAGG + Intronic
932115465 2:69042757-69042779 TGCTCGCCAAGGTCTCACCCAGG + Intronic
934161303 2:89252300-89252322 GGACCACCAATGTCCCAGCCTGG - Intergenic
934205976 2:89930115-89930137 GGACCACCAATGTCCCAGCCTGG + Intergenic
935115141 2:100128864-100128886 TGACCTCTAAGGTCTCAGCACGG + Intronic
936011292 2:108926953-108926975 GGGCCTCCAGGGTCCTACCCTGG + Intronic
936248751 2:110851424-110851446 TGAACTCAAAGGCCTCACCCTGG - Intronic
936427761 2:112434872-112434894 TGACCTCCAAGCTCCCACTGGGG + Intergenic
938119126 2:128621488-128621510 TGACCTCCAAGCTGCAAACCAGG + Intergenic
943545944 2:189277915-189277937 TGACCTCCTTGTTCCCACCCAGG - Intergenic
943690481 2:190864731-190864753 TGACCTCAAAGGTGCCTCCTGGG - Intergenic
944481322 2:200160565-200160587 TGACCTCCAAGTTTCCCCACTGG - Intergenic
946629860 2:221655524-221655546 TGACCTCAAAAGCCCCACACTGG + Intergenic
948385317 2:237577245-237577267 TGACCTTCCAGGTACCGCCCAGG - Exonic
1171959931 20:31486005-31486027 TCACCTCCCAGGGCCCACTCCGG - Intergenic
1172474417 20:35226589-35226611 TGCCCTCGCAGGTCCCGCCCGGG + Intergenic
1176374483 21:6080339-6080361 TGACCTCCAAGCTCCCACTGGGG - Intergenic
1176430933 21:6575209-6575231 TAGCCTCCAATGCCCCACCCAGG - Intergenic
1178015829 21:28345110-28345132 TGACTTCAATGTTCCCACCCAGG + Intergenic
1178755889 21:35349292-35349314 AGACAGCCAAGGTCCCAGCCTGG + Intronic
1178920616 21:36735967-36735989 TGCCCTCCCAGGTTCCACCAGGG + Intronic
1179706327 21:43182671-43182693 TAGCCTCCAATGCCCCACCCAGG - Intergenic
1179748992 21:43457906-43457928 TGACCTCCAAGCTCCCACTGGGG + Intergenic
1179838933 21:44057818-44057840 AGACCCCTAAGGGCCCACCCAGG - Intronic
1181427883 22:22855928-22855950 GGAGCTCCTAGGACCCACCCAGG - Intronic
1183469185 22:37996651-37996673 AGGCCTCCCAGGTCCCACCCAGG - Intronic
1184191587 22:42898616-42898638 TGGCCCCCAAGGTCCATCCCTGG - Intronic
1184465521 22:44667322-44667344 TGACCTCAAAGGTCCCTCCAAGG + Intergenic
1184812637 22:46847019-46847041 TGGCCTCCAAGGCCCGGCCCTGG - Intronic
1184992786 22:48182037-48182059 TACCCTCCCAGCTCCCACCCAGG + Intergenic
1185386144 22:50532042-50532064 TGGCCGCCAAAGGCCCACCCAGG + Exonic
952774502 3:37031758-37031780 TGACATCCAAAGCCCCAGCCTGG + Intronic
954362002 3:50126943-50126965 CTGCCTCCAAGGTGCCACCCTGG + Intergenic
955349118 3:58180937-58180959 TGCCCTCCCAGCTCCCAGCCTGG + Intergenic
957760433 3:84548578-84548600 TCCCTTCCAAGGTCCCTCCCTGG - Intergenic
962352608 3:134666653-134666675 TGACCTCCGAGGTGCCTCCCAGG - Intronic
967308293 3:188081337-188081359 TGACATCCAATGTCTCCCCCTGG + Intergenic
969216120 4:5723707-5723729 TGACCTCACAGGTCACACCCAGG - Intronic
969506358 4:7590512-7590534 TGACACCCAACGTCCCAGCCCGG - Intronic
970206542 4:13661020-13661042 TCACCTCCAATATCCCACCTGGG + Intergenic
973150477 4:46881335-46881357 TGACCTGGAAGCTCCCTCCCTGG - Intronic
975203264 4:71616183-71616205 TGACCTGCAAGGTTGCAGCCTGG + Intergenic
975563030 4:75724963-75724985 TCACCTCCAGCGTCCCACCATGG + Intronic
975600741 4:76097056-76097078 TGACTTTCAAGGGCCCATCCAGG - Intronic
976076260 4:81302327-81302349 TAAACTTCAAGGTCCCTCCCCGG - Intergenic
976185545 4:82439370-82439392 TGAGCTCCAAAGTCCCACCAAGG - Intronic
976190095 4:82479201-82479223 TGACATCCAAGGTACCCCTCCGG + Intergenic
978165391 4:105601145-105601167 TGACCTACAAGGTCCTACAGGGG + Intronic
982477519 4:155872098-155872120 TGAATCCCAAGTTCCCACCCAGG + Intronic
986476844 5:8143078-8143100 TGACCTCCAAGTTCCCTGCTTGG - Intergenic
986483961 5:8217027-8217049 GGCCCTCCAAGCCCCCACCCTGG + Intergenic
988519613 5:31933776-31933798 TGATCTTCAGGGTCCCTCCCGGG + Intronic
988891828 5:35625765-35625787 TGACCCTCAATGTGCCACCCAGG - Intronic
998039394 5:138943016-138943038 TGTTCTCCAAGCTCCCACTCTGG + Intergenic
1004348229 6:14868069-14868091 TGAGCTCATAGGTCCCACCATGG + Intergenic
1006153990 6:32004356-32004378 TGACCTCTCAGGTACCATCCAGG + Intergenic
1006160297 6:32037093-32037115 TGACCTCTCAGGTACCATCCAGG + Intergenic
1007505828 6:42334700-42334722 TAAACTCCAAGGCTCCACCCAGG + Intronic
1015046282 6:128779970-128779992 TGACCTGCAAGGTTGCAGCCTGG - Intergenic
1016428827 6:143961999-143962021 TGGCCTCCAAGGGCTCACACAGG + Intronic
1016741985 6:147538552-147538574 TGACGTCCTAGGATCCACCCCGG - Intronic
1018169241 6:161131338-161131360 GGACATCCAGGTTCCCACCCAGG - Exonic
1018414554 6:163590130-163590152 TGACTTCCAGGGTTCCACCTTGG - Intergenic
1019705925 7:2497415-2497437 TGGTCTCCCAGGTCCCACCCAGG + Intergenic
1022612897 7:31894997-31895019 TGACCTCCAAGGTGACTCCCAGG + Intronic
1024563835 7:50665646-50665668 TCACCTCCCTGGTCCCACCCAGG - Intronic
1026876280 7:73880788-73880810 TGCCCTCCAGGGTCCCCTCCCGG - Intergenic
1029438455 7:100574956-100574978 TGACCTCAGAGGCCCCACTCTGG - Exonic
1030762437 7:113368332-113368354 TGACCCCAAATGTTCCACCCAGG + Intergenic
1031790943 7:126103596-126103618 TGGCCTCCAAGGTCCCACAAAGG - Intergenic
1033766895 7:144503386-144503408 TGAGCATGAAGGTCCCACCCAGG + Intronic
1034384929 7:150733044-150733066 TGTCCTCCATGGTGCCAGCCAGG + Intronic
1037141978 8:15531191-15531213 TGACCTCCAAGCTGCCTGCCTGG + Intronic
1038325715 8:26571344-26571366 TGATCTCCAAGGCCCTGCCCTGG + Intronic
1038711779 8:29953500-29953522 TGCCCTCTAACATCCCACCCTGG - Intergenic
1041401294 8:57448191-57448213 TGAATTCCAGGTTCCCACCCAGG + Intergenic
1041695414 8:60730956-60730978 TGACCTGCACTGTCCCATCCAGG + Intronic
1045983772 8:108223348-108223370 TGACCTCCAAGGTCCTCATCTGG - Intronic
1048357124 8:133662788-133662810 GGCCCTCAAAGTTCCCACCCAGG - Intergenic
1048483880 8:134830087-134830109 TGACCTCCACGATGCCACCAAGG + Intergenic
1049799325 8:144510478-144510500 TGGCCAGCAAGGTCCCACCCAGG - Exonic
1050610763 9:7350400-7350422 AGACCTCCCAGGCCCCACCTGGG - Intergenic
1052362643 9:27576755-27576777 TGACCTCCAAGGTGCCCACTTGG - Intergenic
1055818143 9:80231702-80231724 AAACCTCCAAGGTCCCACCTTGG + Intergenic
1060280348 9:122211764-122211786 TGACCTCCAGAGTCCCTGCCAGG - Intronic
1061059479 9:128243424-128243446 TGGCCTCCAAGCCCCCTCCCAGG + Intronic
1061287015 9:129629614-129629636 TGACCACAAAGCTCCCACACTGG - Intronic
1061762601 9:132860784-132860806 TGACCTGCAAGAGCCCACCCGGG - Intronic
1061816749 9:133201923-133201945 AGACCTCCAAGGTGCCCACCTGG + Intergenic
1061952906 9:133946146-133946168 TCATCACCATGGTCCCACCCTGG + Intronic
1062500008 9:136848244-136848266 TGCCCTCCAGGCTCCCACCTGGG - Exonic
1186515660 X:10164656-10164678 TGATCACCAAGGGCCCACTCTGG - Intronic
1187387606 X:18862639-18862661 TGACCTCCAAGATGCCCCCTTGG + Intergenic
1187494842 X:19786204-19786226 TGACCTCCTGAGTCCCACCATGG - Intronic
1188067648 X:25681380-25681402 TGACCCCCAAGGTCTTAGCCTGG - Intergenic
1190304950 X:49076606-49076628 GGACCTCCTACCTCCCACCCCGG + Intronic
1190905955 X:54728610-54728632 TGACCTCTCAGGCTCCACCCAGG + Intergenic
1194980794 X:100438286-100438308 TGACCTCCAAGGTGCCCACTTGG + Intergenic
1196883372 X:120220707-120220729 TGCCCTCCAGGTTCCCATCCAGG - Intergenic
1198880115 X:141271934-141271956 TGACCTGGAAGCTCCCTCCCCGG - Intergenic
1199672030 X:150155554-150155576 TGCCCTCAGAGGCCCCACCCAGG + Intergenic
1200062470 X:153489702-153489724 AGAGGTGCAAGGTCCCACCCAGG - Intronic
1200137038 X:153880179-153880201 CAACCTCCCAGGTCCCTCCCTGG - Intronic
1200737379 Y:6814246-6814268 TGACCTGCAAGGCTCCAGCCTGG + Intergenic