ID: 1089325668

View in Genome Browser
Species Human (GRCh38)
Location 11:117655142-117655164
Sequence CAGGGCATGGAGATGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 8, 3: 51, 4: 527}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089325668_1089325684 24 Left 1089325668 11:117655142-117655164 CCAGCTGCCATCTCCATGCCCTG 0: 1
1: 0
2: 8
3: 51
4: 527
Right 1089325684 11:117655189-117655211 AACCACACCAGCAGGCAGAGGGG 0: 1
1: 0
2: 2
3: 30
4: 256
1089325668_1089325681 16 Left 1089325668 11:117655142-117655164 CCAGCTGCCATCTCCATGCCCTG 0: 1
1: 0
2: 8
3: 51
4: 527
Right 1089325681 11:117655181-117655203 GCAGGGGGAACCACACCAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 196
1089325668_1089325682 22 Left 1089325668 11:117655142-117655164 CCAGCTGCCATCTCCATGCCCTG 0: 1
1: 0
2: 8
3: 51
4: 527
Right 1089325682 11:117655187-117655209 GGAACCACACCAGCAGGCAGAGG 0: 1
1: 0
2: 1
3: 21
4: 239
1089325668_1089325683 23 Left 1089325668 11:117655142-117655164 CCAGCTGCCATCTCCATGCCCTG 0: 1
1: 0
2: 8
3: 51
4: 527
Right 1089325683 11:117655188-117655210 GAACCACACCAGCAGGCAGAGGG 0: 1
1: 0
2: 2
3: 11
4: 256
1089325668_1089325686 29 Left 1089325668 11:117655142-117655164 CCAGCTGCCATCTCCATGCCCTG 0: 1
1: 0
2: 8
3: 51
4: 527
Right 1089325686 11:117655194-117655216 CACCAGCAGGCAGAGGGGTCTGG 0: 1
1: 1
2: 6
3: 65
4: 491
1089325668_1089325680 1 Left 1089325668 11:117655142-117655164 CCAGCTGCCATCTCCATGCCCTG 0: 1
1: 0
2: 8
3: 51
4: 527
Right 1089325680 11:117655166-117655188 TATTGGGGGCTTTCTGCAGGGGG 0: 1
1: 0
2: 0
3: 15
4: 165
1089325668_1089325677 -2 Left 1089325668 11:117655142-117655164 CCAGCTGCCATCTCCATGCCCTG 0: 1
1: 0
2: 8
3: 51
4: 527
Right 1089325677 11:117655163-117655185 TGATATTGGGGGCTTTCTGCAGG 0: 1
1: 0
2: 0
3: 11
4: 103
1089325668_1089325679 0 Left 1089325668 11:117655142-117655164 CCAGCTGCCATCTCCATGCCCTG 0: 1
1: 0
2: 8
3: 51
4: 527
Right 1089325679 11:117655165-117655187 ATATTGGGGGCTTTCTGCAGGGG 0: 1
1: 0
2: 5
3: 36
4: 208
1089325668_1089325678 -1 Left 1089325668 11:117655142-117655164 CCAGCTGCCATCTCCATGCCCTG 0: 1
1: 0
2: 8
3: 51
4: 527
Right 1089325678 11:117655164-117655186 GATATTGGGGGCTTTCTGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 118
1089325668_1089325687 30 Left 1089325668 11:117655142-117655164 CCAGCTGCCATCTCCATGCCCTG 0: 1
1: 0
2: 8
3: 51
4: 527
Right 1089325687 11:117655195-117655217 ACCAGCAGGCAGAGGGGTCTGGG 0: 1
1: 0
2: 3
3: 38
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089325668 Original CRISPR CAGGGCATGGAGATGGCAGC TGG (reversed) Intronic
900321563 1:2086926-2086948 AAGGGCATGGGCATGGCAGGAGG - Intronic
900590699 1:3458255-3458277 CAGGGCATGCACAGGGCAGAGGG - Intronic
900719669 1:4167114-4167136 CAGGGCCTGGAGTTGTCTGCTGG + Intergenic
901078827 1:6572128-6572150 GAGGGCAGGGAGAGGCCAGCAGG - Intronic
901974357 1:12932518-12932540 CAGAGGAGAGAGATGGCAGCAGG - Intronic
902010817 1:13269250-13269272 CAGAGGAGAGAGATGGCAGCAGG + Intergenic
902226170 1:14997720-14997742 CTGGGCTGGGAGTTGGCAGCAGG + Intronic
902277588 1:15350650-15350672 GAGGGCATGGAGAGGGCAAGGGG - Intronic
902407306 1:16191788-16191810 CAGGACCTGGAGATGGCGTCTGG - Intergenic
902510739 1:16965775-16965797 CAGGTCCTGGAGATGGTGGCTGG - Exonic
902891115 1:19444339-19444361 CAGGGTGGGGAGGTGGCAGCTGG - Intronic
902923221 1:19679512-19679534 AGGGGCCTGGAGATGGCAGCAGG - Exonic
903548906 1:24143981-24144003 CAGGGCCTGGAGAAGGTAGAAGG + Intergenic
904035616 1:27557124-27557146 CAGGGCAGGGGGCTGGCAGGGGG - Intronic
904420694 1:30389363-30389385 CAGGGCAGGGTGAGGCCAGCAGG + Intergenic
904609690 1:31718667-31718689 CAGGGCATGCATATTGCAGAAGG - Intergenic
904677717 1:32208528-32208550 CAGGAGATGGAGATTGCAGTAGG + Exonic
904717001 1:32475958-32475980 CTGGGCATGGTGATGCCCGCCGG - Intronic
904732745 1:32607086-32607108 GAGGGCATGTTGATGGCAGGAGG - Intronic
905907217 1:41627113-41627135 CAGGGCATGCAGATGGCACAGGG + Intronic
906167344 1:43696609-43696631 AAGGGCATGGTGAGGGCACCAGG - Intronic
906245642 1:44271832-44271854 CCAGGCATGCTGATGGCAGCTGG + Intronic
906246816 1:44282084-44282106 CAGGGGAAGTAGGTGGCAGCAGG + Intronic
908880584 1:68727285-68727307 GAGGGCCTGGAGATGGGAGGAGG - Intergenic
912431179 1:109629255-109629277 CTGGGTATGGGGAGGGCAGCCGG + Intronic
913960586 1:143335759-143335781 AAGGCCATGGAGAGGGCAGCTGG + Intergenic
914054940 1:144161331-144161353 CAGGCCATGGAGAGGGCAGCTGG + Intergenic
914124206 1:144805030-144805052 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
918764305 1:188458735-188458757 CAGGCCATGGTGATGGTAGATGG - Intergenic
919794181 1:201311296-201311318 CAAGGCATGGGGAGAGCAGCTGG - Intronic
920184815 1:204152846-204152868 CAAGGCATGGTGATGGCTGGGGG + Intergenic
920632815 1:207669319-207669341 CAGAGCATGGGGAGGGCTGCGGG - Intronic
920688192 1:208125971-208125993 GACAACATGGAGATGGCAGCAGG + Intronic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
922993537 1:229937829-229937851 CCGGGGATGGAGAAGGAAGCAGG + Intergenic
923272375 1:232369437-232369459 CAGGGGAAGGAGATGACAGTGGG + Intergenic
923562630 1:235053047-235053069 CAGTGCATGGAAATGGCGACAGG + Intergenic
923792758 1:237126406-237126428 CTGGGCATGGTGAGGGGAGCTGG + Intronic
924445339 1:244124662-244124684 CAGGTCATGGAGCAGGCAGGAGG + Intergenic
924619555 1:245648950-245648972 CAGGGCAGGGCAAGGGCAGCTGG - Intronic
1063035311 10:2281112-2281134 CAGCGCCTGGAAATGGAAGCTGG + Intergenic
1063303641 10:4876611-4876633 CAGGGCATGGTGGTGGCAGCAGG - Intergenic
1063413446 10:5854310-5854332 CAGGGACTGGGGATTGCAGCTGG - Intergenic
1065223637 10:23521188-23521210 CTGGGCCTGGAGATGGCACCAGG - Intergenic
1065320242 10:24502586-24502608 CAGGGCAGGGAGGTGGGAGAAGG - Intronic
1065960791 10:30732524-30732546 AAGGGCGAGGAGATGGCAGGAGG - Intergenic
1066372633 10:34830146-34830168 CAGGGCCTGGAAAAGGCAGGAGG - Intergenic
1067029016 10:42868015-42868037 CAGGCCACGGAGAGGGCAGCTGG + Intergenic
1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG + Intergenic
1069615627 10:69804320-69804342 CAGGGCATGGTCAGGCCAGCAGG - Intronic
1069828845 10:71270602-71270624 CTGGGCTTGGAGACTGCAGCGGG + Intronic
1070062712 10:73000608-73000630 AAGGGCATGGTGGTGGCATCTGG + Intergenic
1070644832 10:78194764-78194786 GAGGGCTTGGATATGGCAGTGGG + Intergenic
1070819306 10:79345754-79345776 CAGGGCCTGGAACTGGCCGCAGG + Intergenic
1071329577 10:84546419-84546441 CTGGGCAGGGAGATGGCCGATGG + Intergenic
1075717798 10:124566970-124566992 CAGTGCCTGGAGATGTCATCTGG - Intronic
1075920066 10:126204095-126204117 CAGGGGCTGGAGATAGGAGCTGG - Intronic
1076015528 10:127024498-127024520 CAGGGGTTGGAGCTGGCCGCTGG + Intronic
1076409387 10:130234954-130234976 CAGACCCTGGAGAAGGCAGCTGG - Intergenic
1076574290 10:131453642-131453664 CAGGGCATGGGAGTGCCAGCGGG - Intergenic
1076698328 10:132257621-132257643 CAGGGCAGGGGGCCGGCAGCAGG - Intronic
1076870467 10:133190468-133190490 CAGGGGGAGGAGACGGCAGCCGG + Intronic
1077233631 11:1469597-1469619 TTGGGCATGGAGGAGGCAGCAGG + Intronic
1077244031 11:1527259-1527281 CAGAGCATGGAGACGGCAGTGGG - Intergenic
1078171257 11:8930764-8930786 GACGGCATGTTGATGGCAGCAGG - Intronic
1079252054 11:18793594-18793616 GAGGGGATTGAGATGGGAGCTGG - Intergenic
1079366470 11:19814372-19814394 CAGGGGAGGGAGAGGGCAGTGGG - Intronic
1079904149 11:26224083-26224105 GAGGACCTTGAGATGGCAGCTGG - Intergenic
1080385457 11:31808414-31808436 CAGGGCATGGCTATGGGTGCCGG - Intronic
1080510910 11:32970476-32970498 CAGGAGGTGGAGATGGCAGTGGG - Intronic
1081873122 11:46392079-46392101 CTGGGGAAGGAGCTGGCAGCTGG + Intergenic
1081875760 11:46407451-46407473 AAGGGCCTGAAGATGGCAGAAGG + Intronic
1081984468 11:47291518-47291540 CATGGCAATGAGATGTCAGCTGG - Intronic
1083170033 11:60918354-60918376 AAGGGCATGGCGCTGGCATCTGG + Intronic
1083481280 11:62949215-62949237 CTGTGGATGGGGATGGCAGCAGG + Intronic
1083623141 11:64058816-64058838 GAGGGCGTGAAGAGGGCAGCCGG + Intronic
1083944176 11:65914976-65914998 CAGGGAATGGAGATGGGATGAGG + Intergenic
1084088264 11:66864660-66864682 AAGGGCGAGGAGAGGGCAGCGGG + Intronic
1084179786 11:67440558-67440580 AAAGGCATAGAGATGGCAGAGGG - Intronic
1084224224 11:67705490-67705512 CAGGGCATGAACTTGGAAGCAGG - Intergenic
1084266377 11:68007507-68007529 CAGGGCATGAGCATGGCATCAGG - Intergenic
1084629207 11:70334862-70334884 GAGGGCATGGAGGTGCCACCTGG + Intronic
1085013686 11:73158617-73158639 TAGGGCATGGAGTGGGCAGAGGG + Intergenic
1085053658 11:73392231-73392253 CGTGGCGTGGAGGTGGCAGCAGG + Exonic
1085282863 11:75342243-75342265 CAGGGCTCGGAGAGGGAAGCAGG - Intronic
1085334253 11:75679010-75679032 GAGGGCATGTTGATGGCAGCAGG - Intergenic
1085409900 11:76284688-76284710 CAGGGCAGGGTGAAGACAGCAGG + Intergenic
1085787241 11:79464035-79464057 GAGGGTGTGGAGATGGTAGCAGG - Intergenic
1086501763 11:87461103-87461125 AAGGACAGTGAGATGGCAGCTGG - Intergenic
1088754898 11:112877765-112877787 CAGGGCCTGGGGCTGGCTGCCGG - Intergenic
1088756528 11:112889834-112889856 CAGAGGATGGGGAGGGCAGCAGG - Intergenic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089325668 11:117655142-117655164 CAGGGCATGGAGATGGCAGCTGG - Intronic
1089969065 11:122677931-122677953 CTGGGCATGGAGGTGGGAGCTGG - Intronic
1090351366 11:126110569-126110591 CTGGGCATGGAGCTGCCAGTGGG - Intergenic
1090981302 11:131724885-131724907 CTGGGCAAGGAAAAGGCAGCAGG + Intronic
1092140733 12:6181795-6181817 CAGGGCATGGGGAAGCCAGCAGG + Intergenic
1094676128 12:32621959-32621981 CAGGGTATGGAGGTTGCAGTGGG - Intronic
1095125972 12:38477743-38477765 CAGGGCATACAGAGGGCATCAGG - Intergenic
1095392590 12:41726768-41726790 CAGAGGATGGAAATGGAAGCTGG + Intergenic
1095825307 12:46524800-46524822 CTGGGGATGGAGATGGGAGGAGG + Intergenic
1095908592 12:47403212-47403234 CTGGGCATGGAGATGGCAGGTGG - Intergenic
1096388426 12:51210995-51211017 CCTGACAAGGAGATGGCAGCAGG - Intronic
1096500909 12:52063340-52063362 CAGGGGCTGGGGGTGGCAGCTGG + Intergenic
1096764081 12:53868774-53868796 CAGTGGTGGGAGATGGCAGCAGG + Intergenic
1096807209 12:54148234-54148256 CAGGGCAGGAAGATGGCTGAAGG + Intergenic
1096845268 12:54403157-54403179 CAGGGCAGGGAGAAGGGACCTGG - Intronic
1097059085 12:56269018-56269040 CAGGCCAAGGAGCTGCCAGCTGG - Intronic
1097805529 12:63960822-63960844 CAGGGCCAGGGGATGTCAGCAGG + Intronic
1099119333 12:78668425-78668447 CAGGGCAAGGGGATGGGAGGTGG - Intergenic
1101364175 12:104056152-104056174 CAAAGCATAGAGAGGGCAGCTGG - Intronic
1101586372 12:106089152-106089174 TAGGCCCTGGAGAGGGCAGCGGG + Intronic
1101594226 12:106149471-106149493 CAGGGCAGGGAGAAGGAAGGCGG + Intergenic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1103702501 12:122855192-122855214 CAGGCTATGGAGATGGCGGAAGG + Intronic
1103836375 12:123824330-123824352 CAGGGCAAGGTGATGTCTGCTGG + Intronic
1103990358 12:124795075-124795097 CAGGGCATGGGGAGGGGAGAGGG - Intronic
1104894975 12:132159579-132159601 CAGGGCATGGAGATGTGGGCGGG + Intergenic
1104947273 12:132421673-132421695 AAGGGCATGGAGCGGGCAGGTGG + Intergenic
1105209545 13:18249807-18249829 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1105649456 13:22358854-22358876 CAGAGTGTGGAAATGGCAGCAGG - Intergenic
1105676103 13:22673299-22673321 CCGGGCATGGTGATGGGTGCCGG - Intergenic
1105913322 13:24891292-24891314 CTGGGCAGGGAGAGGCCAGCAGG - Intronic
1106080389 13:26495843-26495865 CAGAGCTTGGAGAGGACAGCTGG + Intergenic
1107457076 13:40564858-40564880 CCAGGCATGCAGATGGCAGATGG - Intronic
1108756605 13:53510552-53510574 CAGGGCACTGAGATGGAAGTGGG - Intergenic
1112124285 13:96447558-96447580 AAGGGCAAGAAGAAGGCAGCAGG - Intronic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1114709234 14:24761356-24761378 CAGGACATGGATATTGCACCTGG - Intergenic
1115047861 14:29019774-29019796 CAGGGAATGGGCATGGCAGAAGG + Intergenic
1116609486 14:47049277-47049299 CAGGACATGGAGATGGAGGTGGG + Intronic
1118465147 14:66024066-66024088 CAGGCCATGGGGATGCCAGCAGG - Intergenic
1118836781 14:69483871-69483893 CAGGCCAGGGAGATGCCGGCCGG - Intergenic
1119182167 14:72612592-72612614 CAGGGAAGGGAGAGGGCAGGAGG + Intergenic
1119829259 14:77686479-77686501 TAGTGCCTGGAGAAGGCAGCAGG - Intronic
1121582166 14:95039378-95039400 CAGGGCATCGAGAGGGTAGAGGG + Intergenic
1121597223 14:95173574-95173596 CAGGGCAGGGACAGGACAGCAGG - Intergenic
1121874708 14:97440682-97440704 GCGTGCATGGAGATTGCAGCTGG + Intergenic
1121937899 14:98037304-98037326 CAAGGCATGGAGATGGGAAGTGG - Intergenic
1122113718 14:99517670-99517692 CAGGGCTGGGAGGTGGCAGCTGG - Intronic
1122951457 14:105047388-105047410 CAGGGCATGGTGCTGGAGGCAGG + Intergenic
1123030693 14:105449785-105449807 CAGGGCATGAAGATGGAAGGAGG - Intronic
1123037797 14:105478515-105478537 CAGGGCAGGCCGAGGGCAGCCGG - Intronic
1123157974 14:106248270-106248292 AAGTGCATTGAGATGTCAGCAGG - Intergenic
1202853983 14_GL000225v1_random:38258-38280 AAGGGCACGGAGAGGTCAGCGGG - Intergenic
1124341735 15:28894347-28894369 GAGGGCATGGAGGGGGCTGCTGG + Intronic
1124899960 15:33813134-33813156 CAGGGCATCGAGATGGCACGTGG - Intronic
1125017548 15:34951202-34951224 GATGGCATGGAGAAGGTAGCTGG - Intronic
1125042984 15:35213736-35213758 CAGGGCCTGGGGGTGGCAGTTGG - Intergenic
1126143233 15:45454555-45454577 CAGGGTGTGGAGGAGGCAGCGGG + Intergenic
1127349588 15:58137185-58137207 GAGGACATGGAGAAAGCAGCTGG - Intronic
1127723042 15:61721484-61721506 CAGGGAAAGGAGAAGACAGCTGG + Intergenic
1127775975 15:62264559-62264581 CAGGGCCTGGACAGGGAAGCTGG + Intergenic
1128463634 15:67890400-67890422 CAGGGCCTGACCATGGCAGCAGG + Intergenic
1128682307 15:69660969-69660991 CAGAACATTGAGATGGAAGCTGG + Intergenic
1128990057 15:72252207-72252229 CAGGGCAAGGGGATAGCAGGAGG + Intronic
1129151403 15:73690508-73690530 AAGGGCATGGTGCTGGCATCTGG + Intronic
1129694584 15:77733421-77733443 CATGGCATGGGGGTGGGAGCTGG - Intronic
1129713979 15:77836366-77836388 CAGGGAAAGGAGAGAGCAGCTGG - Intergenic
1129746751 15:78027248-78027270 AAGGGCACGGGGATGGCAGCTGG + Intronic
1130256303 15:82327584-82327606 CCTGCCATGGAGAGGGCAGCTGG - Intergenic
1130598648 15:85262404-85262426 CCTGCCATGGAGAGGGCAGCTGG + Intergenic
1130957408 15:88637467-88637489 CAGGGCATGAAGATGGAGGTGGG + Intronic
1131802834 15:96089661-96089683 CAAAGCATGGAAATGGTAGCGGG + Intergenic
1132018143 15:98337367-98337389 CCAGGCATGGAGATGGAAGGAGG + Intergenic
1132752653 16:1465887-1465909 CAGGGCAGGGGCAGGGCAGCGGG + Intronic
1132804242 16:1768392-1768414 CAGGGGATGTGGATGGCAGGAGG - Intronic
1132892894 16:2213184-2213206 AAGGGCAGGGAGATGCCACCTGG + Exonic
1133300231 16:4777980-4778002 CAGGTCTTGGAGGTGGGAGCTGG + Exonic
1133546604 16:6813752-6813774 CTGGGCATGCCAATGGCAGCAGG + Intronic
1133933308 16:10249718-10249740 CAGGACATGCAGGGGGCAGCTGG - Intergenic
1134675951 16:16090694-16090716 CAGGGCATGAGGGTGGGAGCTGG + Intronic
1136702006 16:32152813-32152835 CAGGGCATGGGGAAGGGAGACGG + Intergenic
1136718601 16:32302991-32303013 TAGGGCAGGGAAATAGCAGCAGG + Intergenic
1136765660 16:32774647-32774669 CAGGGCATGGGGAAGGGAGACGG - Intergenic
1136802439 16:33095731-33095753 CAGGGCATGGGGAAGGGAGACGG + Intergenic
1136836972 16:33509255-33509277 TAGGGCAGGGAAATAGCAGCAGG + Intergenic
1137706439 16:50538989-50539011 CTGGGCCTGCAGCTGGCAGCTGG + Intergenic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138731887 16:59204782-59204804 CCAGGCATGAAGATGCCAGCAGG + Intergenic
1139531521 16:67544885-67544907 GAGAGCATGCAGATGGCAGTAGG - Intronic
1139915369 16:70424989-70425011 CAGGGCACAGAGATGGCAGCTGG + Intronic
1140411172 16:74741242-74741264 CATGGCAGGGAGCTGGAAGCTGG + Intronic
1140708476 16:77653879-77653901 CCTGGGATGGTGATGGCAGCAGG - Intergenic
1141099270 16:81185202-81185224 CAGGGCAGGGAAGGGGCAGCTGG - Intergenic
1141377058 16:83541114-83541136 CAGAGGCTGGAGGTGGCAGCTGG - Intronic
1141499297 16:84432592-84432614 CAGGAGATGGAGGTGGCAGTGGG - Intronic
1141835550 16:86536721-86536743 CAAGGCGTGCAGATGGAAGCTGG - Intronic
1141920895 16:87134652-87134674 CAGTGCATGGACACGGCAGGCGG - Intronic
1142127492 16:88417428-88417450 CAGGGTGTGGAGGTGGCAGGTGG - Intergenic
1142177766 16:88652790-88652812 CAGGGCAGGGGGCTCGCAGCTGG - Intronic
1142200581 16:88759421-88759443 CAGGCCAGGGGGAGGGCAGCTGG - Intronic
1203007830 16_KI270728v1_random:214780-214802 TAGGGCAGGGAAATAGCAGCAGG - Intergenic
1203068048 16_KI270728v1_random:1036895-1036917 CAGGGCATGGGGAAGGGAGACGG - Intergenic
1203147152 16_KI270728v1_random:1809534-1809556 TAGGGCAGGGAAATAGCAGCAGG + Intergenic
1142594763 17:1024112-1024134 CTGGGCATGGAGCTTGCTGCCGG + Intronic
1143474303 17:7194043-7194065 CAGAGCATGGGGGTGGCAGGGGG - Intronic
1143520812 17:7443230-7443252 CAGGGCATGTGTGTGGCAGCAGG - Exonic
1143945231 17:10585881-10585903 GAGGGCATAAAGATGGAAGCAGG - Intergenic
1144702044 17:17346476-17346498 CAGGGCACGGAGAGGGAAGTCGG + Intronic
1145825271 17:27872211-27872233 CAGGAGATGAAGATGGCATCGGG + Intronic
1145882963 17:28365144-28365166 CTGGGCATGGAGCTGGCAAAGGG + Exonic
1145911541 17:28546244-28546266 GAGGGCAAGGAGATGGCTCCAGG + Intronic
1146891746 17:36510819-36510841 CAGGGCAGGCAGACAGCAGCAGG - Exonic
1147046444 17:37755611-37755633 CAGAGCGGGGACATGGCAGCTGG + Intergenic
1147507587 17:41034814-41034836 CAGGTCATGGTGTTGGGAGCTGG + Exonic
1147650732 17:42060432-42060454 CAGGGTGTGGAGAGGACAGCGGG - Intronic
1148211795 17:45813214-45813236 AAGGGCAGGGAGGAGGCAGCAGG - Intronic
1148789673 17:50166239-50166261 CAGGGAATGGGGCTGGGAGCTGG + Intronic
1150868581 17:68879931-68879953 GATGGCATGTTGATGGCAGCAGG + Intronic
1150996293 17:70321820-70321842 CAAGGCATGCAGTTGGCAGAAGG - Intergenic
1151285668 17:73109238-73109260 CAGGGGATGGGGATGGGAGGTGG - Intergenic
1151326696 17:73384026-73384048 TAGGGCATGGGGAGGGCACCTGG + Intronic
1151686102 17:75647575-75647597 CTGGGGACTGAGATGGCAGCAGG + Exonic
1151978820 17:77497473-77497495 CAGGGCAGGCAGGTGGCAGGGGG - Intronic
1152446855 17:80349925-80349947 CTGGGGAGGGAGAGGGCAGCAGG - Intronic
1153335690 18:3922052-3922074 CAGGGAATTGGGAAGGCAGCAGG + Intronic
1153423134 18:4931181-4931203 GAGGGCATGGGTATGGCACCAGG + Intergenic
1153505299 18:5790595-5790617 CAAGGAATGGAGAGGGCTGCTGG + Intergenic
1154193904 18:12252332-12252354 CAGGCCATGGCGATGGCAGAAGG - Intergenic
1155171143 18:23267586-23267608 CAGTGCAGGGAGTGGGCAGCCGG - Intronic
1155980502 18:32174838-32174860 GAGGGCTTAGAGAGGGCAGCGGG + Intronic
1156364197 18:36410168-36410190 CAGGGATTGGAGACGGCAGGGGG - Intronic
1156461965 18:37326290-37326312 AAGGGCAAGGAGATGGCAACTGG - Intronic
1156489520 18:37487956-37487978 CAGGGGGTGGAGACGGCAGGGGG - Intronic
1156766243 18:40660055-40660077 CAGGGCATGGGGACAACAGCTGG + Intergenic
1157289231 18:46398310-46398332 CAGGGCAGGAAGAAGGAAGCAGG + Intronic
1157326798 18:46674907-46674929 TAGGGCAGGGAGGTGGCAGGAGG + Intronic
1157341594 18:46783388-46783410 CAGGGAATGGTGGTGGCAGAAGG - Intergenic
1157710551 18:49847076-49847098 CTGGGGATGGAGATGGGAGCGGG + Intronic
1157737130 18:50059688-50059710 CAGAGCGGGGAGGTGGCAGCTGG - Intronic
1157947923 18:52002081-52002103 CAGGGAAAGGAGATGGCATGAGG - Intergenic
1158532259 18:58274079-58274101 CAGGGCCTTTAGGTGGCAGCTGG - Intronic
1158962975 18:62601666-62601688 CAGGGCGAGGAGAGGGCAGCTGG + Intergenic
1160119843 18:76120549-76120571 CAGGGGATGCTGCTGGCAGCTGG - Intergenic
1160912472 19:1481324-1481346 CAGTCCATGGAGAATGCAGCCGG - Intergenic
1161016137 19:1984626-1984648 CAGGCAATGGAGATGGAGGCTGG - Intergenic
1161478320 19:4498410-4498432 CCTGGCAGGGAGGTGGCAGCGGG - Intronic
1161630923 19:5355039-5355061 CAGGGCCTGGGGGTAGCAGCTGG - Intergenic
1162447232 19:10730968-10730990 CTGGGCATGGAGGTGTCACCAGG - Intronic
1162711256 19:12596712-12596734 CAGTGCCTGGTGATGACAGCAGG + Intronic
1163033830 19:14560663-14560685 CAGTGCCTGGAGTTGACAGCAGG + Intronic
1163831258 19:19548178-19548200 CCAGGCATGGAGCGGGCAGCTGG + Intergenic
1165012598 19:32859684-32859706 CACGGCATGGAGCTGGAGGCAGG - Intronic
1165020887 19:32923022-32923044 CAGGGCAGGCGGATGGAAGCTGG + Intronic
1165065818 19:33227078-33227100 CAGGGCCTGGAGGTGGGAGCGGG + Intergenic
1165159640 19:33808466-33808488 CAGGGGATGGGGGTGGCAGATGG + Intronic
1165333812 19:35155458-35155480 CAGGGCAGGGAAAGGGCTGCAGG + Exonic
1165762070 19:38327268-38327290 CAGGGCACGGAGGGGGCAGCAGG - Exonic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166123580 19:40700359-40700381 CTGGGCATGGAGCTGGCTGGAGG - Exonic
1167049857 19:47071795-47071817 GAGGGCATGGAGATGGAGCCCGG - Exonic
1167561453 19:50228471-50228493 CAGGGCATGAAGCAGCCAGCCGG + Intronic
1167627718 19:50603788-50603810 CAGGGGATGGGGATGGCGACAGG - Intergenic
1167628077 19:50605682-50605704 CAGGGGATGGGGATGGCGACAGG - Intergenic
1167648547 19:50718308-50718330 CGGGGCAGGGAGGAGGCAGCCGG - Intronic
1168515133 19:57004546-57004568 CTGGGCATGGAGGTGGGAGGAGG - Intergenic
1202694422 1_KI270712v1_random:114006-114028 CAGGCCATGGAGAGGGCAGCTGG + Intergenic
925295483 2:2773669-2773691 CAGGACTTGGAGCTGGCATCTGG + Intergenic
925815117 2:7739822-7739844 AAGGGCATGGTGATCCCAGCTGG - Intergenic
925919377 2:8628512-8628534 CATGGCACGGAGAAGGCAGTTGG + Intergenic
926204814 2:10828554-10828576 CCGCCCATGCAGATGGCAGCTGG + Intronic
926228179 2:10983247-10983269 CAGGGCAGGGAGGTGGGAGAGGG - Intergenic
927645357 2:24873767-24873789 AAGGGCATGGAGCTGGCGCCAGG - Intronic
928511876 2:32010422-32010444 CAGGAGGAGGAGATGGCAGCCGG + Exonic
929022073 2:37563291-37563313 CAGGGAATGGAGGTGGCAGGAGG + Intergenic
929553148 2:42906897-42906919 GAGGGAATGGAGATGGAAGGAGG - Intergenic
929978735 2:46659040-46659062 GAGGGCATGGAAAGGGCTGCAGG - Intergenic
931766743 2:65463571-65463593 CTGGGCTTGGGGATGGGAGCTGG + Intergenic
932437467 2:71711087-71711109 CAGGGCAGGGAGAGGGCAGAAGG + Intergenic
932467680 2:71934050-71934072 CAGGGCTTGCAGAAGGCACCAGG + Intergenic
932570388 2:72935460-72935482 CAGGGGGTGGAGCAGGCAGCTGG - Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
932696496 2:73961204-73961226 TAGGGCTGGGAGTTGGCAGCAGG - Intergenic
933078044 2:77954293-77954315 CAGGGGATGGGGATGGCGACAGG + Intergenic
933832451 2:86221938-86221960 CATGTCATGGAGTTGGCTGCTGG - Intronic
933952139 2:87340558-87340580 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
934112734 2:88757550-88757572 CAAGGCCTGGAAAAGGCAGCAGG - Intergenic
934236383 2:90236896-90236918 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
934856941 2:97735401-97735423 CTGGTCATGGAGATGGCTGGGGG + Exonic
935853098 2:107244414-107244436 CAGGGCATGGTGGTGGGTGCCGG - Intergenic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
936163942 2:110104011-110104033 CAAGGCCTGGAAAAGGCAGCAGG - Intronic
937236984 2:120437028-120437050 CAGGGCTGGGGGAAGGCAGCAGG + Intergenic
937252618 2:120534120-120534142 CAGGGCTGGGAGCAGGCAGCTGG - Intergenic
937318799 2:120948516-120948538 CTGGGCCTGGAGATGGCAGGTGG - Intronic
937860401 2:126703692-126703714 GAGGTCATGGAGATGCCAGAGGG + Intergenic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
939801847 2:146720604-146720626 GATGGCATGTAGATGGTAGCAGG + Intergenic
939866832 2:147482202-147482224 CAAGGGATGGAGATGTGAGCTGG + Intergenic
940920050 2:159296194-159296216 CAGGCCAAAGAGATGGCAGGGGG + Intergenic
941889543 2:170564397-170564419 CAGGAGATGGAGGTGGCAGTGGG + Intronic
944711774 2:202341133-202341155 CAGGAGATGGAGGTTGCAGCGGG + Intergenic
948385114 2:237576141-237576163 CCAGACATGGAGCTGGCAGCAGG + Intronic
948403788 2:237702766-237702788 CTGGGCAAGGAGGTGGCAGGGGG + Intronic
948415683 2:237801396-237801418 CAGGAGATGGAGGTTGCAGCGGG - Intronic
948781513 2:240324479-240324501 CAGGGCCTGGAGGAGGCAGAAGG - Intergenic
949052318 2:241903828-241903850 CTGGGCATGGGGAGGGCAGCTGG - Intergenic
1168860778 20:1044618-1044640 CAGGGCATGGAGGTGGAACAGGG - Intergenic
1168926671 20:1587423-1587445 CAGGCCATGGAGCTGACACCAGG - Intronic
1168961489 20:1873011-1873033 AAGAGCATGGAGCTGGCATCTGG - Intergenic
1169087351 20:2835656-2835678 CAGGGATTGGAGGTGGCAGAGGG + Exonic
1169729114 20:8767411-8767433 AAGTGCTGGGAGATGGCAGCTGG - Intronic
1170221521 20:13947018-13947040 GATGACATGTAGATGGCAGCAGG + Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170469708 20:16656068-16656090 CAGAGCATGGAGTTGGTAGTGGG + Intergenic
1170554586 20:17505211-17505233 CTGGGCTTGGAGCTGGAAGCTGG - Intronic
1170733807 20:18996330-18996352 AAGGGCATGGAGATACCAGAAGG + Intergenic
1171290700 20:23981474-23981496 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1172577725 20:36022155-36022177 CCGGGCATGGTGATGGTGGCCGG - Intronic
1172693830 20:36808280-36808302 CGGGAGATGGAGATTGCAGCAGG + Intronic
1172766824 20:37355497-37355519 CTGGGTAGGGAGTTGGCAGCTGG + Intronic
1173017244 20:39236892-39236914 CAAGGCATGGAGAGTGGAGCTGG - Intergenic
1173466040 20:43282185-43282207 CAGGGGATGGGGGTGGCAACAGG + Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1175092205 20:56513677-56513699 GAGGGCACGGAGCTGTCAGCAGG + Intronic
1175547162 20:59785839-59785861 CAGGGGATGCAGAGGGCTGCTGG - Intronic
1175568791 20:60002546-60002568 CAGGGCATGGCCATGGCAAAAGG + Intronic
1176098941 20:63356294-63356316 CAGGGCCAGGACAGGGCAGCAGG + Intronic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1177185163 21:17785570-17785592 AAGGGCATGGTGATAGCATCTGG + Intergenic
1178839952 21:36130292-36130314 CAGGAGGAGGAGATGGCAGCCGG - Intergenic
1179108271 21:38423269-38423291 CAGGGCTTGTAAATGGGAGCTGG - Intronic
1179303811 21:40136648-40136670 CAGGGCAGGGTGCTGGTAGCTGG + Intronic
1179495912 21:41771219-41771241 CAGGGGCTGGAGATGGCTGAGGG - Intergenic
1179607401 21:42525925-42525947 CAGAGGATGGGGATGGTAGCAGG + Intronic
1179622350 21:42625588-42625610 CAGGGCCTTGAAGTGGCAGCTGG + Intergenic
1180234274 21:46447939-46447961 CAGGTCAGGGAGGCGGCAGCAGG - Intergenic
1180413962 22:12692777-12692799 AAGGGCATAGAGAGGCCAGCGGG + Intergenic
1180766721 22:18349593-18349615 TAGGGGATAGAGATGGGAGCTGG + Intergenic
1180779593 22:18512785-18512807 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1180812308 22:18770106-18770128 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1180945118 22:19688486-19688508 CCGGGCAGGGAGAGGGCAGTGGG - Intergenic
1181051181 22:20239012-20239034 CAGGGGTTGGGGGTGGCAGCTGG - Intergenic
1181198465 22:21204353-21204375 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1181648263 22:24245445-24245467 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1181703241 22:24632528-24632550 TAGGGGATAGAGATGGGAGCTGG + Intergenic
1182255766 22:29037201-29037223 CAGGGAATAGAGATGGCGGTAGG + Intronic
1182372141 22:29818862-29818884 CAGGGCTTGGTGAGGTCAGCTGG - Intronic
1182426913 22:30278441-30278463 CAGGGCAGGAAGATGGAAGGTGG + Intergenic
1182473755 22:30564596-30564618 CAGTGCAGGCAGCTGGCAGCAGG + Intronic
1182828068 22:33282861-33282883 CGGAGCCAGGAGATGGCAGCAGG + Intronic
1183077745 22:35437403-35437425 CATGGCATGATGATGGCTGCTGG - Intergenic
1183749293 22:39710568-39710590 GAGGGCATGGAGGTGCCACCTGG + Intergenic
1184144307 22:42599863-42599885 CATGGCAAGGAAATGGCTGCTGG + Intronic
1184152403 22:42646584-42646606 CAGGGCAGGGAGCTGGCACCTGG - Intronic
1184258573 22:43301461-43301483 CAAGGCCTGGAGATGGGAACAGG - Intronic
1184258917 22:43303345-43303367 CAGGGCATGGATGGGGCAGGAGG - Intronic
1185045629 22:48527402-48527424 CAGGGCAAGGCCAGGGCAGCAGG + Intronic
1185058031 22:48591454-48591476 CAGGGCAAGGCCATGGCTGCAGG - Intronic
1185202967 22:49519520-49519542 CAGTGCACGCAGTTGGCAGCCGG - Intronic
1185337043 22:50275348-50275370 TAGGGCATGGAGGCGGCTGCTGG + Exonic
1203228340 22_KI270731v1_random:90484-90506 TAGGGGATAGAGATGGGAGCTGG + Intergenic
949398674 3:3642364-3642386 CAGGGCCCAGAGATGGCAGAGGG + Intergenic
950425602 3:12923312-12923334 CAGGGGATGGGGGTGGGAGCTGG + Intronic
950541338 3:13615090-13615112 CAGGGACTGGACATGGCAGCTGG - Intronic
950547395 3:13646515-13646537 CAGGGCATGCAGAGGGCATGTGG + Intergenic
950649111 3:14396298-14396320 CAGGGCAGGCAGGAGGCAGCCGG + Intergenic
950710917 3:14812149-14812171 CAGGGCCTGGACATGGAAGGTGG - Intergenic
950778821 3:15373627-15373649 CAGGTCATGGAGAGGGCCTCAGG - Intergenic
951274464 3:20668690-20668712 CTGGGCCTGGAGATGGCATCTGG + Intergenic
951537303 3:23751582-23751604 CAGGGGAGGGAGATGGGAGGGGG - Intergenic
952024706 3:29065552-29065574 ACTGGCATGGAGATGGCAGTTGG - Intergenic
952682638 3:36112513-36112535 CATGGCATGGATATGGCAATGGG + Intergenic
952880216 3:37980711-37980733 CAGTGCATGGAGGAGGCAGCAGG - Intronic
952990881 3:38829690-38829712 CAGCGCATGGGGCTGGCAGCTGG + Intergenic
953463232 3:43097918-43097940 CAGGCCATGGTGAGGCCAGCAGG - Intronic
953557995 3:43962243-43962265 CTGGGCATGGTGAGGGTAGCAGG - Intergenic
953796686 3:45991549-45991571 CAGGGCATGGCCTTGGCAGAGGG - Intronic
953887044 3:46720021-46720043 GAGGGCATAAGGATGGCAGCAGG + Intronic
954131964 3:48565444-48565466 CACAGCATGGAGCTGGGAGCCGG + Exonic
954314837 3:49795509-49795531 CTGGTCTTGGAGAAGGCAGCAGG - Intronic
954431230 3:50471842-50471864 CAGGGCACAGAGATGGCTGGGGG + Intronic
955433800 3:58877951-58877973 GAGGGCATGGAAAAGGGAGCAGG + Intronic
955444009 3:58988494-58988516 CAGAGCATTGAGATGGGAACAGG + Intronic
956287270 3:67623957-67623979 CAGGGTGTGGAGATGGTAGCAGG - Intronic
956529465 3:70201764-70201786 GAGGGAATGGAGAGGGAAGCAGG - Intergenic
956779444 3:72592619-72592641 CAGGGGATGGAGGAGACAGCTGG + Intergenic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
960254688 3:115499353-115499375 CAGGGCAAGGAAAAGGCAGTGGG + Intergenic
961450489 3:127000218-127000240 CAGAGCAAGGAGGTGACAGCTGG + Intronic
961718966 3:128879539-128879561 CAGGGGATGGAGAGGCCAGAAGG - Intronic
962374781 3:134850773-134850795 CAGGGTATGGAGAGTGAAGCGGG - Intronic
963767863 3:149356452-149356474 CAAGTCATGGAGATGGAGGCAGG + Intergenic
963916352 3:150862115-150862137 CAGAGCCTGGAGCAGGCAGCAGG - Intergenic
965704526 3:171492924-171492946 AAGGCCAGGGAGATGTCAGCAGG + Intergenic
965838104 3:172873471-172873493 CAGAGCATGGTGCTGGCATCTGG + Intergenic
967557673 3:190877306-190877328 CAGGGGATGGGGATGGCGACAGG + Intronic
967869053 3:194214540-194214562 CAGTGCATAGGGAGGGCAGCTGG + Intergenic
968430394 4:555087-555109 GATGGGATGGAGATGGCAGGTGG - Intergenic
968430426 4:555261-555283 GATGGGATGGAGATGGCAGGTGG - Intergenic
968430440 4:555351-555373 GATGGGATGGAGATGGCAGGTGG - Intergenic
968430449 4:555395-555417 GATGGGATGGAGATGGCAGGTGG - Intergenic
968430477 4:555569-555591 GATGGGATGGAGATGGCAGGTGG - Intergenic
968661285 4:1799853-1799875 CAGGGCTTGGCGGTGGCAGCGGG - Intronic
968758296 4:2427947-2427969 CAGGGGCTGGAGAGGGGAGCAGG + Intronic
968826955 4:2905650-2905672 CAGTCCATGCAGAGGGCAGCTGG - Intronic
969704269 4:8783547-8783569 CAGGCCAGGGAGACCGCAGCCGG - Intergenic
969710949 4:8843118-8843140 CAGGGCCTGGACCTGGCATCTGG - Intergenic
971296876 4:25401603-25401625 CAGTGCACGGAGAGGGCAGCTGG - Intronic
973646787 4:52958023-52958045 AAGTGCCTGGAGATGGCAGTTGG - Intronic
974798720 4:66785851-66785873 CAGAGAATGGAGATGGCAGGAGG + Intergenic
975990171 4:80250964-80250986 CTGGGCATGGTGGTGGGAGCTGG + Intergenic
976006472 4:80436439-80436461 CCGGGCATGGTGATGGGTGCCGG - Intronic
976844798 4:89475303-89475325 AAGGGCATGGTGCTGGCATCTGG - Intergenic
977425162 4:96859571-96859593 GGGCCCATGGAGATGGCAGCAGG - Intergenic
977922385 4:102659906-102659928 CTGGGGATGGAGAGGGTAGCTGG - Intronic
978600146 4:110418967-110418989 CAGGGCAAGAGGATGACAGCAGG - Intronic
978644656 4:110915601-110915623 CATGGAAGGGAGATGGTAGCCGG + Intergenic
978796622 4:112714254-112714276 CAGGAGGTGGAGATGGCAGTGGG - Intergenic
979670312 4:123354427-123354449 AAGGCATTGGAGATGGCAGCAGG - Intergenic
979994686 4:127416319-127416341 CTGGGCATGGAACTGGCAGCTGG - Intergenic
981767054 4:148263027-148263049 CAGGGAGTGGAGATGGTGGCAGG - Intronic
983475887 4:168211222-168211244 AAGGGCATGGTGTTGGCATCTGG - Intergenic
985024827 4:185730650-185730672 CAGGCCATGGAGAGGACAACCGG + Intronic
986227393 5:5828450-5828472 CAGGCCTTGCTGATGGCAGCAGG - Intergenic
986471537 5:8081321-8081343 GAGGGCATGGGGCTGGCAGGTGG + Intergenic
987141686 5:14953133-14953155 GAGGGCCTGGAGTTGGCAGTGGG - Intergenic
987616776 5:20284092-20284114 CAGGGGCTGGGGATGGTAGCGGG + Intronic
987787210 5:22516650-22516672 CAGGGCATGGTGATGCATGCCGG + Intronic
989601275 5:43202921-43202943 CAGGACATGGAGCCAGCAGCAGG - Intronic
990335657 5:54769755-54769777 AGGGTCAGGGAGATGGCAGCAGG + Intergenic
990503647 5:56423154-56423176 AAGGGCATGGAGAAGTGAGCTGG - Intergenic
990947499 5:61264138-61264160 AAGGGCATCGAGATGGGAACAGG + Intergenic
991114263 5:62935864-62935886 CAGGGCAGCGAGAGGTCAGCAGG + Intergenic
991684388 5:69167977-69167999 CCGGGCTTGGAGGTTGCAGCAGG - Exonic
993090525 5:83420765-83420787 CCAGGAATGGAAATGGCAGCTGG + Intergenic
993512659 5:88790801-88790823 CTAGGCATTGAGCTGGCAGCTGG + Intronic
993864882 5:93180897-93180919 CAAGGCATGCAGATGGCCTCTGG + Intergenic
994922613 5:106068569-106068591 GAGTGAATGGAGATGGTAGCTGG - Intergenic
995052753 5:107724854-107724876 GAGGACGTGGAGATGGAAGCTGG + Intergenic
996285582 5:121787414-121787436 CAGAGCATGGAAATTGTAGCTGG + Intergenic
996473294 5:123885340-123885362 CATGGCTTGGTGCTGGCAGCAGG - Intergenic
997176784 5:131786798-131786820 GAGAGCATGGTGCTGGCAGCTGG - Intronic
997352868 5:133243603-133243625 CAGGGCATGTAGGTGGCTGTAGG + Intronic
998006917 5:138663177-138663199 ATGAGGATGGAGATGGCAGCTGG - Intronic
998059088 5:139105029-139105051 CAGGGCAGGGATAGGGCGGCAGG + Intronic
998976004 5:147648731-147648753 CAGGGCAGGGAGAGTGCAGAGGG + Intronic
999377975 5:151100239-151100261 CATGGCATGGGGCTGGCTGCTGG - Intergenic
1000300506 5:159951970-159951992 CAAGGCCTGGAGATGGCAAAAGG + Intronic
1000330182 5:160199655-160199677 CAGGGGATGAAGATAGCAGGGGG - Intronic
1000975614 5:167760969-167760991 AAGGACATGGACATTGCAGCAGG - Intronic
1001422660 5:171599385-171599407 CAGAGCCAGGAAATGGCAGCCGG + Intergenic
1001823444 5:174727104-174727126 TTGGGCCTGGAGGTGGCAGCGGG + Intronic
1002194447 5:177494631-177494653 CAGAGCGTGGGGAGGGCAGCAGG + Intronic
1002451476 5:179321463-179321485 CAGGGAATTGGGATGGCAGGGGG - Intronic
1002584481 5:180233910-180233932 GTGGGCCTGGAGATGGGAGCAGG - Exonic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1002866478 6:1126337-1126359 CTGTGCATGGAGATGTCACCAGG - Intergenic
1003148721 6:3530776-3530798 CAGGGCAGGGGGATGTCATCAGG + Intergenic
1005930635 6:30481525-30481547 CAGGGATTGGAGATGGCAGGGGG + Intergenic
1006296013 6:33170462-33170484 CAGGCCAGGGAGTTGGCAGTGGG + Intronic
1006647909 6:35527791-35527813 CAGGGCATGGCCATGGCAGTGGG - Intergenic
1007949041 6:45853235-45853257 TAGGGCATGGGCATGGAAGCAGG + Intergenic
1008472951 6:51904359-51904381 GAGGGCATGCAGATAGCAGGTGG - Intronic
1009035255 6:58110172-58110194 ATTGGCATGGAGTTGGCAGCAGG + Intergenic
1009210768 6:60860880-60860902 ACTGGCATGGAGTTGGCAGCAGG + Intergenic
1011041587 6:83035253-83035275 CAGGGTAAGGAGTGGGCAGCAGG - Intronic
1011284201 6:85706320-85706342 GATGGCATGTTGATGGCAGCAGG - Intergenic
1011292990 6:85795798-85795820 GAGGGAATGGAGAGGGAAGCAGG + Intergenic
1011348879 6:86401054-86401076 CAGCTTATGCAGATGGCAGCAGG + Intergenic
1011869504 6:91875016-91875038 CATGGCAAGGAGTTGGCACCTGG + Intergenic
1013111948 6:107071142-107071164 CAGGGAATGGGGAGAGCAGCAGG - Intronic
1013117175 6:107112470-107112492 CTGGGCATGGAGAAGGTAGGCGG + Intronic
1013273480 6:108561924-108561946 CAGGGCAAGGGGTTGGCAGGGGG + Intronic
1014139491 6:117925212-117925234 CAGGGCATGGAGATTGTTGTTGG + Intronic
1014505359 6:122248132-122248154 GATGGCATGTTGATGGCAGCAGG - Intergenic
1015156432 6:130101607-130101629 CAGGGCCTGGAAAGGGCAGGGGG + Intronic
1016439499 6:144068485-144068507 CAAGGCAGGGAGATGGCTGCTGG - Intergenic
1017373173 6:153736473-153736495 AAGGGCATGGAAATGGAATCTGG - Intergenic
1017702893 6:157093067-157093089 CAGCGAAGGGAGAAGGCAGCGGG - Intronic
1017721343 6:157245414-157245436 TAGGGCATGGGGGTGGCAGGTGG + Intergenic
1017852202 6:158314490-158314512 CAGTGCAGGGAGAGGACAGCAGG - Intronic
1018205083 6:161429609-161429631 GAGGCCACGGAGATGGCTGCTGG + Intronic
1018346878 6:162908857-162908879 CAGCACAGGGAGATGGAAGCTGG + Intronic
1018566810 6:165163180-165163202 CAGGGCATGATGATGGAAGAAGG + Intergenic
1018842130 6:167524986-167525008 CAGGGGAAGGAGGGGGCAGCAGG - Intergenic
1018963892 6:168468464-168468486 CATGGCAGGGAGAAGGCAGTCGG - Intronic
1019422416 7:957238-957260 CAAGGCATAGAAAAGGCAGCAGG + Intronic
1019429751 7:993202-993224 CAGGGCAGGGGGACGGCAGCTGG + Intergenic
1019494557 7:1331716-1331738 CAGGGCAGGGCAGTGGCAGCTGG + Intergenic
1019623487 7:2003725-2003747 CAGGGCAGTGTGAGGGCAGCAGG - Intronic
1019645635 7:2127367-2127389 AGGGGCAAGGAGAGGGCAGCAGG + Intronic
1020208539 7:6139699-6139721 CAGGGCAGGGAGAATGCAGAGGG - Intronic
1021600235 7:22357044-22357066 CAGGGCATGAGGATGGCCGTGGG - Intronic
1022596572 7:31718743-31718765 CAGGGCACAGACCTGGCAGCTGG + Intergenic
1022634406 7:32118601-32118623 CAGAGCATGGTGCTGGCATCTGG + Intronic
1022974746 7:35546842-35546864 CAGGGCAGGGAGAGTGCAGAGGG - Intergenic
1023520917 7:41049265-41049287 CAGGGTATGGAGAGGGCATTTGG + Intergenic
1023878469 7:44305693-44305715 CAGGGCCGGGAGTTGGCAGCAGG + Intronic
1023935659 7:44738086-44738108 CATGGCATGGACATGTCAGCTGG + Intergenic
1023991103 7:45129400-45129422 CAGGGCATGTACATGTCAACAGG - Intergenic
1024540243 7:50470286-50470308 CAGGCCATGGCAATGGGAGCAGG - Intronic
1024944608 7:54796245-54796267 CAGGGCATAGAGAAAGCAGAGGG + Intergenic
1026512026 7:71035347-71035369 TAAGGCAAGGAGATAGCAGCAGG + Intergenic
1027995766 7:85423840-85423862 GATGACATGTAGATGGCAGCAGG + Intergenic
1029241602 7:99167171-99167193 CAGGGCACAGAGGTGGGAGCTGG - Intergenic
1030311828 7:108076596-108076618 CAGGGCAGGGATGTGGAAGCAGG + Intronic
1030327770 7:108239484-108239506 AGGGGCATGGAGTTGGCAGAAGG + Intronic
1031989488 7:128188445-128188467 CAGGGGAGAGAGACGGCAGCAGG + Intergenic
1032363465 7:131277424-131277446 CAGGGCATGGTGGTGGGCGCTGG - Intronic
1032794993 7:135269868-135269890 GAGGGGATGGAGAGGCCAGCAGG + Intergenic
1033153048 7:138933188-138933210 CAGGGAAGGGAGATGGTACCTGG + Intronic
1033222295 7:139536200-139536222 CAGGGTATGGGGCTGGCAGTGGG + Intronic
1033426888 7:141252881-141252903 CAGGGCAAGGAGAATGGAGCTGG - Intronic
1033483809 7:141768060-141768082 AAGGGGATGGAGCTGGAAGCAGG - Intronic
1034176645 7:149105039-149105061 CAGGGCATGGGTAGGGCCGCTGG + Exonic
1034221401 7:149449243-149449265 CAGGGCCTGGAGATGGTGACTGG + Intronic
1034226754 7:149490536-149490558 CAGGGCAGTGAAAAGGCAGCAGG + Intronic
1034343326 7:150371484-150371506 CAGGGCAGGGCAAGGGCAGCCGG - Exonic
1034544124 7:151778546-151778568 CAGGGCTTGGAGAAGGCATGGGG - Intronic
1034546780 7:151794507-151794529 CTGGGCATGGCGAGGGCCGCTGG + Intronic
1035076512 7:156181101-156181123 CAGAGCAAGGAGCTGGCCGCGGG - Intergenic
1035076518 7:156181142-156181164 CAGAGCAAGGAGCTGGCTGCAGG - Intergenic
1035418474 7:158708075-158708097 CAGTGAACGGTGATGGCAGCGGG - Intergenic
1035681775 8:1493726-1493748 CTGCCCAGGGAGATGGCAGCAGG - Intergenic
1035981365 8:4375732-4375754 CAGGGCATGGTGCAGGCAGTCGG - Intronic
1036931984 8:12965351-12965373 CAGAGCATAGAGATGGTGGCAGG + Intronic
1037544120 8:19900859-19900881 GAGGAAATGGAGATGGCAGGAGG + Intergenic
1038476512 8:27872190-27872212 GGGGGCGTGGAGAGGGCAGCTGG - Intronic
1039973290 8:42338528-42338550 CAGGACTTGGAGACGGGAGCAGG - Exonic
1040323594 8:46330219-46330241 GAGGGCATTGAGGTGGCAGAAGG - Intergenic
1040521571 8:48180759-48180781 TAGGGAATGGAGGTGGCAGATGG - Intergenic
1041289421 8:56294625-56294647 CAGGGCAGTGAGAAGGGAGCAGG + Intergenic
1041437360 8:57857076-57857098 AAGAGCAGGGAGATGGCACCAGG + Intergenic
1042509539 8:69597109-69597131 CAGGCCCTGGAGCTGTCAGCTGG - Intronic
1043579444 8:81695472-81695494 TAGGGCATGGAATTGGGAGCTGG + Exonic
1043670827 8:82882090-82882112 CAAGGAATGGGGATGGGAGCTGG - Intergenic
1043958113 8:86386077-86386099 CAGGGTATGAAGATGTAAGCAGG - Intronic
1046214491 8:111126181-111126203 CAGGGGATGGAGGTTGCAGTGGG - Intergenic
1046588715 8:116179570-116179592 CAGGGCATGAACCTGGCAGATGG - Intergenic
1048192238 8:132300520-132300542 CAGGGTTTTGAGATGGCAGCGGG + Intronic
1048407777 8:134140557-134140579 CAGGGCATGGAGATAGCCAGTGG - Intergenic
1048870621 8:138794025-138794047 CAGGGTATGAAGAAGGCACCCGG - Intronic
1049023194 8:139971404-139971426 CTGGGCAGGCAGAGGGCAGCTGG - Intronic
1049161877 8:141103108-141103130 CACAGCTTGGAGGTGGCAGCCGG + Intergenic
1049532462 8:143161116-143161138 CAGGGCAGGGCTAGGGCAGCAGG - Intergenic
1049673796 8:143880869-143880891 AAGGGCCTGGACATAGCAGCCGG + Intergenic
1049766352 8:144357008-144357030 CAGGCTATGGAGCTGGCAGCAGG + Exonic
1049973365 9:840512-840534 TAAGACATGGAGATAGCAGCTGG + Intergenic
1050245479 9:3685366-3685388 CAGGGGTTGGGGATGGCAGAGGG - Intergenic
1050422586 9:5482346-5482368 CATGGCATGGATAGGGCTGCAGG - Intergenic
1052586386 9:30433727-30433749 AGGGGCATGGAGATGGAAGTGGG + Intergenic
1055467252 9:76577864-76577886 CAAGGCATTGAGAAGGAAGCTGG - Intergenic
1055805527 9:80088869-80088891 CAGGCCACAGAGATGGAAGCGGG + Intergenic
1056462149 9:86818469-86818491 GATGGTATGTAGATGGCAGCAGG + Intergenic
1057201548 9:93143073-93143095 CAGGGGTTGGAGGTTGCAGCGGG + Intergenic
1057359402 9:94359557-94359579 CAGTGCATGCAGTTGTCAGCTGG + Intergenic
1057536480 9:95913662-95913684 CAGGGACTGGAGATGGAAGCAGG - Intronic
1057648363 9:96898035-96898057 CAGTGCATGCAGTTGTCAGCTGG - Intergenic
1057704758 9:97388709-97388731 AGGGGCATGGTGAAGGCAGCTGG - Intergenic
1057907430 9:98993612-98993634 GAGGCCATGGAGATGGTTGCTGG + Intronic
1057985754 9:99711924-99711946 CAGGGCATGGGCATGGCAGAAGG + Intergenic
1059112832 9:111573077-111573099 CAGGACTTTGAGATGTCAGCTGG - Intronic
1059312291 9:113396831-113396853 CAGGGCAGGAAGAGGGCAGTGGG + Intronic
1059466315 9:114470848-114470870 CAGGACATGAAGATCCCAGCAGG + Intronic
1059885581 9:118741128-118741150 GAGGGCATGGAAATGGCGGGTGG + Intergenic
1060028307 9:120191800-120191822 CAGGGCATGGAGAATACATCTGG + Intergenic
1060484918 9:124040915-124040937 CCGGGCATGGGGGTGGCCGCGGG + Intergenic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1061012252 9:127962548-127962570 CAGGCCATGGAGGTCACAGCCGG - Intronic
1061275742 9:129568750-129568772 CTGGGAAAGGAGAGGGCAGCGGG + Intergenic
1061574342 9:131496783-131496805 CAAATCATGGAGATGGCTGCTGG + Exonic
1062118192 9:134820418-134820440 CAGGGCATGGAGCTGGGAGACGG - Intronic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062270120 9:135704480-135704502 CATGGCATGGAGGTGGGAGCAGG - Intronic
1062322300 9:135996362-135996384 CAGGACATGGAGCTGGGACCTGG + Intergenic
1062425343 9:136503666-136503688 CAGGGCCTGGGGATGGCTCCTGG - Intronic
1062598541 9:137309960-137309982 CTGGGATTGGAGAGGGCAGCTGG - Intronic
1062715751 9:138009319-138009341 CAGGCCGTGGAGACGGCAGATGG - Intronic
1185953148 X:4458571-4458593 CAGGGGATGGAGATGAGACCAGG - Intergenic
1186725845 X:12357892-12357914 CAGGGAATAGAGATGGGAACAGG - Intronic
1187883184 X:23865031-23865053 TAGGGCATGGAGGTGGGGGCAGG - Intronic
1190453821 X:50606617-50606639 TAGGGCATGCAGATGACAACTGG + Intronic
1192050390 X:67719132-67719154 CAGGGTTGGGAGAGGGCAGCTGG - Intronic
1192317335 X:70063163-70063185 CACGGCATGGGGAGGCCAGCTGG + Exonic
1195244177 X:102980815-102980837 CTGGGCAGGGAGAAGGCAACTGG - Intergenic
1195453091 X:105037586-105037608 CAGAGCATGGATATGGAATCAGG - Intronic
1195736500 X:108018033-108018055 CAGGTCATTGAGATGGGAGTGGG - Intergenic
1196558154 X:117115959-117115981 CAGGGGATGGAGAAAGCAGAAGG - Intergenic
1200062878 X:153491443-153491465 CTGGCCAAGGAGATGGCAGCTGG + Intronic
1200152008 X:153955774-153955796 CAGGGCAAGGGGAAGGCAGGAGG + Intronic
1200181982 X:154156179-154156201 CAGGGCTGGAAGATGGCTGCTGG + Intronic
1200187631 X:154193293-154193315 CAGGGCTGGAAGATGGCTGCTGG + Intergenic
1200193280 X:154230433-154230455 CAGGGCTGGAAGATGGCTGCTGG + Intronic
1200199035 X:154268237-154268259 CAGGGCTGGAAGATGGCTGCTGG + Intronic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic