ID: 1089328892

View in Genome Browser
Species Human (GRCh38)
Location 11:117676509-117676531
Sequence CTGGACCCTTTGGGAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 200}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089328892_1089328907 20 Left 1089328892 11:117676509-117676531 CCTCTTTTTCCCAAAGGGTCCAG 0: 1
1: 0
2: 1
3: 35
4: 200
Right 1089328907 11:117676552-117676574 TGCACAGACGGGGTGCTCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 104
1089328892_1089328903 9 Left 1089328892 11:117676509-117676531 CCTCTTTTTCCCAAAGGGTCCAG 0: 1
1: 0
2: 1
3: 35
4: 200
Right 1089328903 11:117676541-117676563 ATTGCCACAACTGCACAGACGGG 0: 1
1: 0
2: 2
3: 14
4: 152
1089328892_1089328906 19 Left 1089328892 11:117676509-117676531 CCTCTTTTTCCCAAAGGGTCCAG 0: 1
1: 0
2: 1
3: 35
4: 200
Right 1089328906 11:117676551-117676573 CTGCACAGACGGGGTGCTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 140
1089328892_1089328902 8 Left 1089328892 11:117676509-117676531 CCTCTTTTTCCCAAAGGGTCCAG 0: 1
1: 0
2: 1
3: 35
4: 200
Right 1089328902 11:117676540-117676562 CATTGCCACAACTGCACAGACGG 0: 1
1: 1
2: 1
3: 14
4: 129
1089328892_1089328904 10 Left 1089328892 11:117676509-117676531 CCTCTTTTTCCCAAAGGGTCCAG 0: 1
1: 0
2: 1
3: 35
4: 200
Right 1089328904 11:117676542-117676564 TTGCCACAACTGCACAGACGGGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089328892 Original CRISPR CTGGACCCTTTGGGAAAAAG AGG (reversed) Intronic
900242929 1:1625489-1625511 CTGGACGCTTGGGGAGGAAGGGG - Intronic
901599407 1:10411043-10411065 GTGGTAACTTTGGGAAAAAGAGG + Intronic
902983883 1:20143683-20143705 CTGGATCCTTTGGGGAAAGAAGG - Intronic
903809286 1:26025883-26025905 CTGTATCCATTGGGAACAAGGGG + Intronic
905441348 1:37998126-37998148 CGGGACCCTGTGGGGAACAGGGG + Exonic
906078326 1:43068165-43068187 CTGTTCCCTTTGGGGGAAAGGGG + Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909042214 1:70668239-70668261 ATGGAACATTTGGGAACAAGTGG + Intergenic
911473416 1:98346601-98346623 CTGGATCCTATGGGAGCAAGAGG - Intergenic
915496304 1:156285049-156285071 CTGGAGCCTTAGGGAGAACGTGG - Intronic
916448590 1:164896737-164896759 CTGTACACTTTGGGAACCAGAGG + Intronic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917767860 1:178243343-178243365 CTGGCCCATTGGGGAAAATGAGG + Intronic
918665470 1:187145633-187145655 CTGGATTCTTTGGTAAGAAGAGG + Intergenic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
922350748 1:224733024-224733046 CTGGACCTGTTGGGAAGGAGGGG - Intronic
922700784 1:227759099-227759121 GTGAACCCTTTGGGAAAGAAGGG + Exonic
1074097576 10:110327609-110327631 CTGGACACTTGGGGAGCAAGAGG + Intergenic
1074688784 10:115984030-115984052 CTGGACTATTTAGGTAAAAGAGG + Intergenic
1075201157 10:120405259-120405281 CTGGACCATTTGGGACACAGGGG + Intergenic
1075863370 10:125696608-125696630 CTGGGCCCTGTGGGTAACAGAGG - Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1078214521 11:9300364-9300386 ATGGCCCCTTTGGAAAAATGAGG + Intronic
1078901855 11:15649946-15649968 CTGGACCCCTGGGGACACAGGGG - Intergenic
1081800913 11:45858768-45858790 CTGAACCCTTTGGGAAAGAACGG + Exonic
1083743089 11:64721484-64721506 CTGGATCTTTTGGGAGACAGGGG - Intronic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087360276 11:97150025-97150047 CTGGCACCATTGAGAAAAAGGGG + Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1088714433 11:112536397-112536419 ATATACCCTTTGGGAAAAATAGG - Intergenic
1088725898 11:112634352-112634374 CTGCACCCTTTAGGAAATAAAGG - Intergenic
1088923754 11:114280677-114280699 ATGTGCCCTTTGGGAAAAGGAGG + Intronic
1089328892 11:117676509-117676531 CTGGACCCTTTGGGAAAAAGAGG - Intronic
1090176552 11:124654947-124654969 CTGGTCTCTTTTGGTAAAAGTGG - Intronic
1090259373 11:125307678-125307700 CTTTACTCTTTAGGAAAAAGAGG + Intronic
1090413406 11:126524384-126524406 CTGGACCCTTTGGGGTTAACAGG + Intronic
1093030358 12:14282977-14282999 CAGTTCCCTTTGGGAAAAAAGGG - Intergenic
1094542032 12:31370715-31370737 CCCCACCCTTTGAGAAAAAGAGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1099854178 12:88142577-88142599 CTGGTCCCATTCTGAAAAAGTGG + Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1102926370 12:116829342-116829364 CTGGAACTTTTGGGAAGATGGGG - Intronic
1103480476 12:121247178-121247200 TTGGACCCACTGGGAAGAAGTGG - Intronic
1103635583 12:122302472-122302494 GGGGACCCATTGGGAAAAATTGG - Intronic
1103646906 12:122401210-122401232 CTGGATCCTTTTCTAAAAAGTGG + Intronic
1104997611 12:132668419-132668441 CTGGCCCCTCTGGGAACAAGGGG + Exonic
1106916943 13:34525869-34525891 CTGGACCTTTATAGAAAAAGTGG - Intergenic
1106961234 13:35000667-35000689 CTGTATCCTTTAGGAAATAGAGG + Intronic
1108077675 13:46698435-46698457 ATTGCCGCTTTGGGAAAAAGTGG + Intronic
1108876586 13:55056761-55056783 TTGAACCATTTGGGTAAAAGGGG - Intergenic
1110515603 13:76408665-76408687 CTGGAGACTTTGGGACCAAGTGG - Intergenic
1112551474 13:100424671-100424693 CTGGACCCTTGGGGATAGGGCGG - Intronic
1113881388 13:113628707-113628729 CTGGGCCCCTAGGGAAAAAAAGG - Intronic
1114178307 14:20343401-20343423 CTCCGCCCTATGGGAAAAAGTGG + Intergenic
1114670502 14:24408392-24408414 CTGGACCCTTTGTGGACATGGGG + Exonic
1114841294 14:26265434-26265456 CTGGATCCTTTTGAAAAGAGGGG - Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1122683009 14:103480915-103480937 CTGGACCCTTTGGTAAACTGCGG - Intronic
1122942424 14:104987488-104987510 ATGAACCATTTGGGAAGAAGTGG - Intronic
1123811985 15:23936346-23936368 CTTGACCCTTTTGAAAATAGTGG + Intergenic
1125634038 15:41172300-41172322 CTGGTTCATTTGGGAAAAAGAGG + Intergenic
1126676764 15:51165866-51165888 CTACACCCTTAGGGAAAATGCGG + Intergenic
1126901998 15:53323917-53323939 CTGGGCCCTATGGAAGAAAGGGG - Intergenic
1131409310 15:92192985-92193007 CCGGACCCATTGGGAAAAGTGGG - Intergenic
1132670358 16:1099983-1100005 CTGGGCCCTGTGGGAGGAAGAGG - Intergenic
1133027536 16:2995268-2995290 CTAAAGCCTTTGGGAAAATGGGG - Intergenic
1133337473 16:5015378-5015400 CTGGAGCCTTTGGGAGGAAGAGG - Exonic
1133987929 16:10682576-10682598 CTCAACCCTTTGGGAAACTGAGG - Intronic
1134530065 16:14975714-14975736 CTGGGGCCTTTGGTAAAATGCGG + Intronic
1135520864 16:23176961-23176983 GTGTACCCTTTGGGGAAAAAGGG + Intergenic
1135562289 16:23486147-23486169 TTGTTCCTTTTGGGAAAAAGAGG + Exonic
1135705418 16:24670823-24670845 GTGGACCCTTGGGGAACAAGTGG + Intergenic
1139866281 16:70065240-70065262 CTGGGGCCTTTGGTAAAATGCGG - Intergenic
1141612841 16:85192857-85192879 CTCGCCCTTTTGGGAAGAAGGGG + Intergenic
1142245578 16:88968706-88968728 CAGGCCCCCTTGGGAATAAGCGG + Intronic
1142297870 16:89238572-89238594 ATGAAGCCTTTGGGAAAATGTGG + Intergenic
1142969509 17:3601561-3601583 CTGGGGCCTTTGGGAGAAGGTGG - Intergenic
1143591678 17:7888893-7888915 CTGCTCCCTTTGGGAACTAGGGG - Intronic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1147767133 17:42844739-42844761 CTGGGCCCTATGGGATACAGAGG - Exonic
1147886413 17:43687485-43687507 GTGGAACCTTATGGAAAAAGGGG - Intergenic
1151239902 17:72749638-72749660 CTGGTCCCCTTGGGAAACCGGGG + Intronic
1151871828 17:76841774-76841796 CTGGACCCACTGGGTACAAGGGG - Intergenic
1152975866 18:217780-217802 CGGCAACCTTGGGGAAAAAGTGG + Intronic
1153187339 18:2500122-2500144 CTGGACCCTTTGAGAGTAAAAGG + Intergenic
1154205062 18:12329266-12329288 CTGGACCCTGTGGCACCAAGTGG - Exonic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1157573501 18:48729199-48729221 CTGGACCCCCTGGGTAAGAGGGG - Intronic
1157855047 18:51097854-51097876 CTGGACCCTCAGGGAAAGGGTGG + Intergenic
1158415369 18:57245746-57245768 CTGGAAGCTTTGGGAAAAGAAGG + Intergenic
1161044883 19:2129450-2129472 CTGAACCCCTGGGGAACAAGGGG + Exonic
1162322615 19:9978942-9978964 CAGGACCCCTTGGGAAAGAAGGG - Exonic
1165944339 19:39432645-39432667 CTGGACACATTGGGAAGATGAGG + Intergenic
1166250630 19:41568041-41568063 CTTGACATTTTGGGAACAAGTGG + Intronic
1166432225 19:42737464-42737486 ATGGACACTTTGGGAAACACAGG + Intronic
1166435340 19:42762653-42762675 ATGGACACTTTGGGAAACACAGG + Intronic
1166445209 19:42852684-42852706 ATGGACACTTTGGGAAACACAGG + Intronic
1166471010 19:43079611-43079633 ATGGACACTTTGGGAAACACAGG + Intronic
1166491769 19:43266523-43266545 ATGGACACTTTGGGAAACACAGG + Intronic
1166563755 19:43750694-43750716 CTGGACTCTATGGGATAGAGCGG - Exonic
1167071984 19:47227041-47227063 GTGGCCCCTTTGGAAAATAGAGG - Intronic
1167298172 19:48663962-48663984 CTGGACTCTTGAGGAAAAGGAGG - Intronic
1168567657 19:57438582-57438604 ATGGACCCTGTGGGAAGATGTGG - Intronic
1168571838 19:57477045-57477067 CTGGAGCATTTGGGAAAACTGGG - Intronic
925147199 2:1589119-1589141 CTGGACCCTTTATGACAAGGAGG + Intergenic
925199031 2:1951290-1951312 CTGAACCCTTAGGGACACAGGGG + Intronic
926864372 2:17341936-17341958 TTGGACCATTTGGGTAAAAGGGG - Intergenic
927620094 2:24646311-24646333 ATGAACCATTTGAGAAAAAGTGG + Intronic
928682660 2:33718229-33718251 CTGGACACTTTGGGGATAGGAGG - Intergenic
929439384 2:41953346-41953368 CTGGTCCTTCTGGGAGAAAGGGG + Intronic
930034249 2:47075725-47075747 GAGGACCCTCTGGGAAAATGTGG + Exonic
931424079 2:62154913-62154935 CTGGAGCCTTTGGGAAAGCATGG - Intergenic
931639971 2:64373414-64373436 CTTGACCCTTTCTGAAAATGAGG + Intergenic
931668293 2:64625548-64625570 CAGGACCCTTTGGGATGGAGGGG - Intergenic
932917574 2:75874750-75874772 ATGGACCATTTGGGTAAAAGGGG - Intergenic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
933565169 2:83941708-83941730 CTGGAGGTTTTGGTAAAAAGGGG - Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
936935485 2:117835439-117835461 CTGGACATTTTGACAAAAAGAGG - Intergenic
938684003 2:133719294-133719316 CTGGACCCTTTCTGTAAAATTGG - Intergenic
938758149 2:134399574-134399596 CTGGAACCTTTGGGCGACAGAGG + Intronic
941598530 2:167508995-167509017 CTTGACTCTTTGGGAACAAAAGG - Intergenic
942295002 2:174508366-174508388 CTGGACCCACCGGGAACAAGGGG + Intergenic
947771931 2:232676882-232676904 CTGGACACTTTGGGAAGCTGAGG + Intronic
1170339311 20:15305324-15305346 CTGAATCATTTTGGAAAAAGAGG - Intronic
1170473163 20:16688454-16688476 CTGGACTCTTGGGGAAATGGTGG - Intergenic
1170877489 20:20264378-20264400 CTGGAACCTTTGGGTAGAGGTGG + Intronic
1171991620 20:31700924-31700946 CCAGCCCCTTTGGCAAAAAGAGG + Intronic
1172290498 20:33772763-33772785 ATGGGGCCTATGGGAAAAAGTGG + Intronic
1173253176 20:41375286-41375308 CTAGTTCCTTTGGGAAAGAGCGG + Intergenic
1175804520 20:61820136-61820158 CTGGGCCCTCTGGGCAAAACCGG - Intronic
1176657158 21:9597297-9597319 CTGGGACCTGTGGGGAAAAGGGG + Intergenic
1176979908 21:15369620-15369642 CCGAACACTTTGGAAAAAAGTGG - Intergenic
1178096678 21:29222871-29222893 ATGGCCCCTCTGGGAAACAGTGG + Intronic
1178547559 21:33505565-33505587 CTGGCCCCTTTGTCCAAAAGTGG - Exonic
1178925189 21:36768890-36768912 CTGGACCCTCTAGAAAACAGAGG - Intronic
1178953485 21:37004661-37004683 CTGCACACTTTGGGAAGCAGAGG - Intergenic
1178979572 21:37251500-37251522 TTGCACCATTTGTGAAAAAGAGG + Intronic
1179637684 21:42723940-42723962 CTGCAGCATTTAGGAAAAAGAGG + Intronic
1181340068 22:22171705-22171727 CTGGACCTGTTGAGAAAAACAGG - Intergenic
1181878215 22:25956630-25956652 CTGGCCCCGTGGAGAAAAAGTGG - Intronic
1184905262 22:47479582-47479604 GTTGACCTTATGGGAAAAAGGGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950834174 3:15903476-15903498 CTGGACCCTGTGGGAACACAAGG + Intergenic
951109654 3:18786793-18786815 CTGGAGTCTTTGGGGTAAAGGGG - Intergenic
951729577 3:25795850-25795872 CTGGAGTCTTTGGCATAAAGGGG - Intergenic
953843630 3:46409659-46409681 CTGGAAGCTGTGGGAAAAAGAGG + Intronic
956619687 3:71209119-71209141 CAGGCCCCTTTAAGAAAAAGAGG + Intronic
958734442 3:97992573-97992595 CTGTACCCTTTGAATAAAAGGGG - Intronic
960878241 3:122318064-122318086 TTGTAACCTTTGGCAAAAAGAGG + Intergenic
961222505 3:125212074-125212096 CAGGACCCTTTGGTAGAAGGAGG + Intronic
961832859 3:129633153-129633175 CTGGGCCCTGTGGGAAACAGTGG + Intergenic
963187854 3:142438942-142438964 TTGGACCGTTTGGGTTAAAGGGG - Intronic
964953342 3:162324041-162324063 TTGGACCATTTGGGTAAAAGGGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966353405 3:179055511-179055533 TTGGACCGTTTGGGTTAAAGGGG - Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
970602713 4:17652977-17652999 CTGTGGCCTGTGGGAAAAAGTGG + Exonic
971291556 4:25346087-25346109 CTTGACCCTTTGGGGAGTAGGGG - Intronic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
974532557 4:63128552-63128574 CTGGACCATTTAGGAGTAAGAGG - Intergenic
974764376 4:66323318-66323340 CTGGAGCCTGTGAGTAAAAGTGG - Intergenic
977731619 4:100360384-100360406 CTAGAATCTTTGGGAAAGAGTGG - Intergenic
979290268 4:118972188-118972210 CTGTACACTTTGGGAGACAGAGG + Intronic
980402930 4:132316063-132316085 GGGGACCCCTTGGGAAAGAGGGG + Intergenic
981101290 4:140832011-140832033 TTGGACCCTTTGGGACCAATGGG + Intergenic
981341596 4:143627987-143628009 CAAGACCCTTTGGGAATAGGAGG - Intronic
981759533 4:148178624-148178646 CAGGGCCCTTTGGTAGAAAGCGG - Intronic
981836194 4:149057281-149057303 CTGAACTCTTTGGGAATAAGAGG + Intergenic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
989005117 5:36801511-36801533 CTAGATGCTTTGGGATAAAGAGG - Intergenic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
993010489 5:82477204-82477226 CTGGCCCCTTTCAGAAAGAGAGG - Intergenic
993355431 5:86900959-86900981 CTTGTCCCTTTGGGAAATGGAGG - Intergenic
994297599 5:98109737-98109759 CTGGAGCACTAGGGAAAAAGTGG - Intergenic
994469615 5:100186523-100186545 CTGGAGCCTTTGGCAGAAAGGGG - Intergenic
994997415 5:107081707-107081729 ATGGTCCCTTTAGGAAAAAGTGG - Intergenic
995625173 5:114068645-114068667 CTGGACCCTCTGGGAAGCACTGG - Intergenic
997441336 5:133910825-133910847 CTGGGCCCTTTGGGAAAAGTTGG + Intergenic
999433536 5:151544296-151544318 ATAGACCAATTGGGAAAAAGTGG + Exonic
1001015615 5:168138470-168138492 TTGGACCCTTTGGGAAATTTTGG - Intronic
1001134780 5:169093314-169093336 CTGGACCTTTTGGGAGAAGAGGG - Intronic
1001268144 5:170290128-170290150 CTGGAGGCTTTTGGAAAAGGTGG - Intronic
1003321578 6:5057187-5057209 CTAGAGCCTTTGGGGAAAGGGGG - Intergenic
1011539950 6:88418480-88418502 TTGGACCATTCGGGTAAAAGGGG + Intergenic
1013589063 6:111605184-111605206 ACGGAGCCTTTGGGAACAAGGGG - Intronic
1014763111 6:125379755-125379777 CTGCACACTTTGGGAGAACGGGG - Intergenic
1015929907 6:138348869-138348891 CTGCTCTCTTTGGGAACAAGGGG + Intergenic
1016796134 6:148119566-148119588 CTGGGCTCTTTGGAAAAAACAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018656397 6:166041233-166041255 CTGGACACTGTGTGAAAGAGTGG + Intergenic
1019891786 7:3953060-3953082 CTCTCCTCTTTGGGAAAAAGGGG + Intronic
1021412966 7:20348914-20348936 CTGGACCATTTGGGGAAATATGG + Intronic
1024782977 7:52873918-52873940 CAGGCCCCTTTGGGGAAGAGTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027254452 7:76422216-76422238 CTTAGCCCTGTGGGAAAAAGAGG - Intronic
1030205711 7:106950504-106950526 CTGGAGCCATGGGGAGAAAGAGG + Intergenic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1032557372 7:132851014-132851036 CTGACCCCTTTAGGAATAAGAGG + Intronic
1033295300 7:140127743-140127765 CTGGACCTTTCAGGAAAAAAGGG + Intronic
1033361132 7:140639957-140639979 CTCCACCCTTGGGGACAAAGTGG + Intronic
1034413836 7:150954958-150954980 TTGGACCCTGTGGGCAAAGGAGG - Intronic
1034507141 7:151501848-151501870 CTGGGCCCTTAGGGAAGAGGAGG + Intronic
1037279520 8:17222066-17222088 CTGGAAGCTAGGGGAAAAAGAGG + Exonic
1037967180 8:23144325-23144347 ATGGAGCCTTTGGGAGACAGGGG - Intronic
1037994414 8:23342045-23342067 CAGGGCCCTTTGGGAGGAAGTGG + Intronic
1040129026 8:43772722-43772744 CTGGGGCCTATGGGAAAAAATGG + Intergenic
1041326334 8:56670157-56670179 CTGGATCCATTGAGAAAGAGAGG - Intergenic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044701500 8:94969217-94969239 CTGGAACCTTTGGAAATAAGAGG + Intronic
1045470247 8:102505917-102505939 CTAGACCCTCTGGGAGTAAGAGG - Intergenic
1046718656 8:117594817-117594839 CTGGACCCCTTGGCTCAAAGTGG + Intergenic
1046738368 8:117801827-117801849 CAGCACCCTTTGGGAATGAGTGG - Intronic
1047559756 8:125973742-125973764 CTGGTCCCTTTAGGAGAAAGTGG + Intergenic
1048162051 8:132030486-132030508 TTGAACCCCTTGGGAAAAAGTGG - Intronic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1050782161 9:9350884-9350906 CTGGACACTCTCAGAAAAAGAGG - Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052918837 9:33946532-33946554 CTGGCCCCATAGAGAAAAAGAGG - Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1058576922 9:106413881-106413903 GTGGACCCACTGTGAAAAAGTGG + Intergenic
1058895511 9:109397457-109397479 GTGGGCTCTTTGGGAAAAATGGG - Intronic
1059371728 9:113845050-113845072 CTGGTCCCTTTGGCCAAAACAGG + Intergenic
1060819436 9:126652768-126652790 CTGGAGCCTGTGGGAACAAGGGG + Intronic
1062326479 9:136014908-136014930 CTGAACCCTCTGGGAACAATGGG + Intronic
1187370485 X:18701649-18701671 CTAGGCTCTTTGGGAAATAGTGG + Intronic
1191727161 X:64293430-64293452 TTGGACCCTAAGGGACAAAGGGG + Intronic
1192444624 X:71201541-71201563 TTGGAGCCATTTGGAAAAAGAGG + Intergenic
1193306626 X:79958804-79958826 TTAGACCATTTGGGTAAAAGGGG - Intergenic
1198243402 X:134806730-134806752 CAAGACCCTTTGGGACCAAGTGG + Intronic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic