ID: 1089329613

View in Genome Browser
Species Human (GRCh38)
Location 11:117680401-117680423
Sequence TGGCCTAGCCAGGATCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 141}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089329613_1089329617 -5 Left 1089329613 11:117680401-117680423 CCCCTCAGATCCTGGCTAGGCCA 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1089329617 11:117680419-117680441 GGCCACAGAGCAGAAAGTGTAGG 0: 1
1: 1
2: 2
3: 31
4: 334
1089329613_1089329623 13 Left 1089329613 11:117680401-117680423 CCCCTCAGATCCTGGCTAGGCCA 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1089329623 11:117680437-117680459 GTAGGGGTCTTCCCAGAGTGGGG 0: 1
1: 0
2: 1
3: 9
4: 116
1089329613_1089329620 -3 Left 1089329613 11:117680401-117680423 CCCCTCAGATCCTGGCTAGGCCA 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1089329620 11:117680421-117680443 CCACAGAGCAGAAAGTGTAGGGG 0: 1
1: 0
2: 2
3: 21
4: 288
1089329613_1089329621 11 Left 1089329613 11:117680401-117680423 CCCCTCAGATCCTGGCTAGGCCA 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1089329621 11:117680435-117680457 GTGTAGGGGTCTTCCCAGAGTGG 0: 1
1: 0
2: 0
3: 18
4: 152
1089329613_1089329622 12 Left 1089329613 11:117680401-117680423 CCCCTCAGATCCTGGCTAGGCCA 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1089329622 11:117680436-117680458 TGTAGGGGTCTTCCCAGAGTGGG 0: 1
1: 0
2: 0
3: 17
4: 122
1089329613_1089329618 -4 Left 1089329613 11:117680401-117680423 CCCCTCAGATCCTGGCTAGGCCA 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1089329618 11:117680420-117680442 GCCACAGAGCAGAAAGTGTAGGG 0: 1
1: 0
2: 2
3: 44
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089329613 Original CRISPR TGGCCTAGCCAGGATCTGAG GGG (reversed) Intronic
900915519 1:5635535-5635557 TGGCCCAGCTGGGATCTCAGGGG - Intergenic
901116654 1:6850927-6850949 TGATCCAGCCAGGAACTGAGAGG - Intronic
901740142 1:11336297-11336319 TGTCCTAGCCAGCACCAGAGTGG + Intergenic
903344159 1:22673672-22673694 TAGCCCGGCCAGGAGCTGAGCGG - Intergenic
903897981 1:26621125-26621147 TCGCCCCGCCGGGATCTGAGAGG - Intergenic
903920676 1:26798017-26798039 TGCCCTAGCCAGGACCAGAAGGG - Exonic
904800533 1:33089569-33089591 TGGCCTACCCCGAATCTGAGTGG - Intronic
905006484 1:34714081-34714103 TGACCTAGCCTGGCTCTGAGAGG - Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906196978 1:43935702-43935724 TGGCCTAGGCAGCAGGTGAGTGG + Exonic
908444257 1:64186987-64187009 TGGCCGACCCAGAATCAGAGGGG - Intergenic
911254571 1:95619307-95619329 TGGCCTGGCCAGGCTGTGGGAGG + Intergenic
917678505 1:177342310-177342332 GGGTATAGCCATGATCTGAGAGG - Intergenic
917704615 1:177619608-177619630 TGGCCTTCCCAGTATCTGACCGG - Intergenic
918149127 1:181782988-181783010 TGGCCCAGGCAGGAGCAGAGTGG - Intronic
1064092653 10:12397884-12397906 TGGCCTAGGCTGGAACTGAGGGG + Intronic
1067086102 10:43239085-43239107 TGGAGTTGCCAGGAGCTGAGGGG - Intronic
1069621199 10:69838210-69838232 AGGCCTAGACAGGATCTGGTAGG + Intronic
1069705402 10:70456391-70456413 TGGCCAAGACAGGAGCTGGGGGG - Intergenic
1075785275 10:125045223-125045245 TGGCAGATCCAGGATCTGGGAGG - Intronic
1081798896 11:45843507-45843529 TGAATTAGCCAGGAACTGAGTGG - Intergenic
1081988598 11:47325434-47325456 CGGCCTGGCCAGGGTCTGTGGGG - Intronic
1083873347 11:65505968-65505990 TGGCCAAGCTAGCATCTTAGCGG + Intergenic
1083902716 11:65651363-65651385 TGGCCTCGCGAGGAACAGAGAGG - Intergenic
1083909393 11:65697160-65697182 TGAACGAGCCAGGATCTGAAGGG - Intergenic
1085218513 11:74852708-74852730 TGGCCAAGCCAGCCTCTGAAGGG + Intronic
1085282408 11:75339942-75339964 TGGCCTTCCCAGGTTCTGGGTGG - Intronic
1085533369 11:77204365-77204387 GGGCCAAGCTAGGATGTGAGGGG - Intronic
1085717734 11:78888102-78888124 AGGCCTACCCAGGCTCTGTGAGG - Intronic
1088159815 11:106855336-106855358 TGGCCTGGCCAGGATCGGTTTGG - Intronic
1089329613 11:117680401-117680423 TGGCCTAGCCAGGATCTGAGGGG - Intronic
1089364991 11:117916005-117916027 TGGCAGAGCCAGGGTCTGTGTGG + Intronic
1089649392 11:119902606-119902628 TAGCCTAGCCAGGATTTGAATGG + Intergenic
1090247952 11:125230061-125230083 TGGCCTGGGCAGGGCCTGAGGGG + Intronic
1090398782 11:126435430-126435452 TGGGCTAGCCTGGATCTGTTGGG - Intronic
1090439715 11:126715367-126715389 TGCCCTGGCCAGCCTCTGAGGGG + Intronic
1092147962 12:6227872-6227894 TGGCCCAGCCAGCAGCTGACAGG + Intronic
1095957587 12:47815571-47815593 TTGACTAGTCAGAATCTGAGGGG - Intronic
1101641796 12:106591036-106591058 TGGCAGAACCAGGATTTGAGCGG + Intronic
1103245718 12:119455431-119455453 TGACCTAGCCTGGAACTGAGAGG + Intronic
1104635342 12:130434965-130434987 GTGCCTGGCCAGGCTCTGAGGGG - Intronic
1104823429 12:131692269-131692291 GGGCCTAGCTAGGCTGTGAGAGG - Intergenic
1107049440 13:36031865-36031887 GGGCCTAGCAGGGATCTGGGTGG - Intronic
1107523276 13:41204313-41204335 TGGGCTAGGCAGCTTCTGAGAGG - Intergenic
1110229812 13:73156113-73156135 TGAGCTCGCCAGGATCTCAGTGG - Intergenic
1113707105 13:112442065-112442087 TGGCCTTGCCATGTTGTGAGTGG - Intergenic
1118674906 14:68173488-68173510 AGTCCTACTCAGGATCTGAGAGG + Intronic
1119768675 14:77206505-77206527 TGGCCCAGCCAGGCCCTGACAGG + Intronic
1120181076 14:81342812-81342834 AGTCCAAGCCAGGGTCTGAGGGG + Intronic
1121779555 14:96613636-96613658 TGGCATGTGCAGGATCTGAGAGG + Intergenic
1122066579 14:99178003-99178025 TGGACTTGCCAGTTTCTGAGGGG + Intronic
1125153405 15:36559898-36559920 TGGTAGAGCCAGGATCTGAATGG + Intergenic
1127611230 15:60639528-60639550 TGGCCTTGACAGTATCTGAGCGG - Intronic
1127761679 15:62145909-62145931 AGTCCTAGCTAGGATTTGAGGGG - Intergenic
1129297275 15:74606462-74606484 TGGCCTGGACAGTCTCTGAGGGG + Intronic
1129974650 15:79812115-79812137 TGCCCTGGCCAGGATCTGGTGGG + Intergenic
1133001217 16:2852632-2852654 TGGCCTAGCCAGAGACTGCGTGG - Intergenic
1136225323 16:28856595-28856617 TGGGCTAGCCAGGAACTTAGTGG + Intronic
1136463224 16:30424842-30424864 TGAGCTAGCCAGGAGATGAGTGG - Intronic
1137352355 16:47724636-47724658 TCGCTTTGCCAGGATTTGAGAGG + Intergenic
1137586363 16:49666121-49666143 GGGGCCAGCCAGGATCTGGGGGG - Intronic
1138663879 16:58546059-58546081 TGGCCTAGCTGGGGTATGAGAGG + Intronic
1141887861 16:86905088-86905110 TGGAATAGGCAGCATCTGAGGGG - Intergenic
1141899900 16:86984383-86984405 GGGCAGAGCCAGGGTCTGAGCGG + Intergenic
1144999155 17:19291348-19291370 TGGCCTGGCAAGAATCTAAGGGG + Intronic
1146226040 17:31066984-31067006 TGGCCAAGCTGGGATTTGAGCGG + Intergenic
1146296258 17:31653073-31653095 AGGCCTCACCAGGAGCTGAGTGG - Intergenic
1148889827 17:50799632-50799654 TGGCAGAGCCAGGAGCTGTGGGG + Intergenic
1160708986 19:542157-542179 TGGCGTAGCCAGGGTCCCAGTGG - Intergenic
1161731550 19:5964018-5964040 TGGCCTGGCCAGAAACTGAAAGG + Intronic
1164695501 19:30240658-30240680 TGGGCTAAACAGGCTCTGAGAGG + Intronic
1166140059 19:40800659-40800681 TGGCCGGGCCAGGATGGGAGTGG + Exonic
1166292215 19:41870446-41870468 TTGGCCAGCCAGGATCTGAATGG - Intronic
1168074412 19:53971773-53971795 TGGACTACCCAGCATGTGAGGGG + Intronic
1168267795 19:55231828-55231850 AGGGCTGGCCAGGCTCTGAGTGG + Exonic
926716508 2:15928514-15928536 TGGCCTAGCCATCATCCTAGGGG + Intergenic
932000210 2:67878094-67878116 TGGCCTAGAAAGGATCTGTCTGG + Intergenic
935745826 2:106189538-106189560 TGGCCTGCCCAGGAGCTGAGCGG - Intronic
937686014 2:124698187-124698209 TGGACTAGACTGGATCAGAGAGG + Intronic
938118820 2:128619902-128619924 TGACACAGCCAGGATTTGAGTGG + Intergenic
938376066 2:130807654-130807676 AGGTCTAGTCAGGATCTCAGAGG + Intergenic
938606174 2:132894947-132894969 GGGCATTGCCAGCATCTGAGAGG + Intronic
947670679 2:231933713-231933735 GGGCCTGGCCAGGACCTGAAGGG + Intergenic
1170158684 20:13291248-13291270 TGCAATAGCCAGGAACTGAGAGG - Intronic
1172151734 20:32795721-32795743 AGCCCTAGCCAGGGTGTGAGGGG - Intronic
1175312247 20:58019957-58019979 TGCCCTAACCAGGCTCTGAGGGG + Intergenic
1179709504 21:43205018-43205040 TGGCCTTCCCAGGCTTTGAGAGG + Intergenic
1180857500 22:19057747-19057769 TGGCTTAGGCAGGAGCTGAGTGG - Intronic
1181394973 22:22614806-22614828 AGGCATGGGCAGGATCTGAGGGG - Intergenic
1183376762 22:37469816-37469838 TGGCAAGCCCAGGATCTGAGTGG - Exonic
1184199865 22:42961018-42961040 TTGGCAAGCCAGGATCTAAGTGG + Intronic
952979146 3:38721097-38721119 GGGACGAGGCAGGATCTGAGAGG - Intronic
953917016 3:46926725-46926747 TCACCTGGCCAGCATCTGAGGGG - Intronic
954515671 3:51174427-51174449 TGGCCCAGGCTGGATGTGAGTGG - Intronic
954699384 3:52443441-52443463 TGGGATAGCCAGCATCTGTGGGG - Intronic
955386190 3:58482557-58482579 TAGCCAAGACAGGATATGAGGGG + Intergenic
960155180 3:114291653-114291675 TGGCATAGCAGGGATCTGTGAGG - Intronic
961387425 3:126530337-126530359 TGGTCTGGCCAGGAAATGAGAGG + Intronic
964326811 3:155555792-155555814 TGGGCTAGCGAGGTTCTGTGGGG - Intronic
965377141 3:167939370-167939392 TGGCCTTTCAAGGATCTTAGAGG - Intergenic
967161577 3:186743751-186743773 GGGCAGAGCCAGCATCTGAGAGG + Intronic
969630289 4:8332033-8332055 TGACCTAGTCAGGATCCGAGAGG + Intergenic
975829746 4:78356976-78356998 TGGCCTACCCAGGTACCGAGAGG + Intronic
981238832 4:142450183-142450205 TGTCCTTGCCAGGGGCTGAGTGG - Intronic
981390962 4:144191082-144191104 TGGCATAGCCAGGATCATAGGGG + Intergenic
983656595 4:170090390-170090412 TAGCATAGCCATGGTCTGAGCGG - Intronic
983847841 4:172541706-172541728 TGGCCCTGCTAGGATTTGAGAGG + Intronic
985559251 5:574214-574236 GATCCTGGCCAGGATCTGAGAGG + Intergenic
987292191 5:16519780-16519802 TGGCCTATCCAGGCACGGAGAGG - Intronic
991615553 5:68493626-68493648 TTGCCTACCCAGTATTTGAGTGG - Intergenic
993786626 5:92146976-92146998 TAGTCTAGCCAGGTTTTGAGGGG + Intergenic
994590269 5:101762299-101762321 TGGCCTACCCAGGATCACTGGGG + Intergenic
999323572 5:150629467-150629489 TGGGCTAGTAAGGATCTGAGGGG + Intronic
1000172936 5:158721679-158721701 TGTCCTAGCCAGCTTCTCAGAGG - Intronic
1000177114 5:158767829-158767851 TGGCCTATGGAGGATCAGAGAGG + Intronic
1002718634 5:181244849-181244871 TGGCCTAGGCAGGAACGGATTGG - Intronic
1007225275 6:40309345-40309367 TGGCCTTGCCAGGAGCTGGGAGG - Intergenic
1009833717 6:68971048-68971070 TGGCGTAGCCAGTTTCTGAGTGG - Intronic
1014724070 6:124955090-124955112 TGGCCCAGCTGGGACCTGAGAGG + Intergenic
1016899893 6:149091010-149091032 TGGCCTGGCCAGGAACTGCTAGG + Intergenic
1016988982 6:149916511-149916533 TGGCCCTGCCAGGAGCAGAGTGG - Intergenic
1022161530 7:27715599-27715621 GGGCTTGGCAAGGATCTGAGTGG - Intergenic
1022508972 7:30923270-30923292 TGGCCTGGGCCGGTTCTGAGGGG + Intronic
1024471545 7:49772583-49772605 TGGCCTAGCCTGGAGCGCAGTGG - Intergenic
1024548770 7:50543184-50543206 TGGCCTAGTCAGGGTCTGGGTGG - Intronic
1026551723 7:71374548-71374570 TGGCCAAGCCCAGATCCGAGGGG + Intronic
1027464070 7:78492679-78492701 TGCCCTAGCTAGGAACTGAAAGG - Intronic
1028957264 7:96707951-96707973 TGTCCAAGCCAGGATCTGAAAGG - Intronic
1030167705 7:106571438-106571460 TGGCATAGACAGCGTCTGAGTGG + Intergenic
1032490224 7:132318780-132318802 TGGTCTAGCCAGGGTCGGAGGGG + Intronic
1032784333 7:135188565-135188587 AGCCCTGGCCAGGATGTGAGTGG - Intronic
1032916401 7:136495026-136495048 TTGCTTAGGCAGGACCTGAGCGG - Intergenic
1033448372 7:141441285-141441307 GGGACTGGCCAGGTTCTGAGAGG - Intronic
1033535722 7:142310102-142310124 TGGCCTTTCCAGGGTCTTAGTGG + Intergenic
1033539502 7:142343639-142343661 TGGCCTTCCCAGGGTCTTAGTGG + Intergenic
1036102756 8:5805363-5805385 TGACCTTGCCAGGCTCTGAAAGG + Intergenic
1036129345 8:6093997-6094019 TTGCTTAGGCAGAATCTGAGGGG - Intergenic
1036785058 8:11680439-11680461 CGGCCTTGCCAGGAACGGAGAGG - Intronic
1039050028 8:33484684-33484706 TGGCTAAGTCAGGGTCTGAGGGG + Intronic
1039895057 8:41711291-41711313 TGGCCTAGATGGGATCTGTGTGG - Intronic
1041616988 8:59918731-59918753 TGGCCTAGCCAGTTTATTAGAGG + Intergenic
1047255436 8:123210147-123210169 TGGCCTAGCCTGGAGTTGGGGGG - Intergenic
1048040242 8:130720542-130720564 TTGGCTATCCAGGATCAGAGTGG + Intergenic
1053289094 9:36868336-36868358 AGGCAGGGCCAGGATCTGAGAGG + Intronic
1055098267 9:72436820-72436842 TGGGCTACCCAGCATCTGAATGG - Intergenic
1056443562 9:86643482-86643504 TGGCGGGGCCAGGATCTGAAGGG + Intergenic
1057888663 9:98851387-98851409 GGTCCTTGACAGGATCTGAGTGG - Intergenic
1061931299 9:133834430-133834452 TGGCCCAGCCAGGAGCAAAGGGG + Intronic
1203760818 EBV:12456-12478 TGGCCGAGCCCGGGTCTGGGAGG + Intergenic
1203761747 EBV:15528-15550 TGGCCGAGCCCGGGTCTGGGAGG + Intergenic
1203762676 EBV:18600-18622 TGGCCGAGCCCGGGTCTGGGAGG + Intergenic
1203763605 EBV:21672-21694 TGGCCGAGCCCGGGTCTGGGAGG + Intergenic
1203764534 EBV:24744-24766 TGGCCGAGCCCGGGTCTGGGAGG + Intergenic
1203765463 EBV:27816-27838 TGGCCGAGCCCGGGTCTGGGAGG + Intergenic
1203766392 EBV:30888-30910 TGGCCGAGCCCGGGTCTGGGAGG + Intergenic
1203767321 EBV:33960-33982 TGGCCGAGCCCGGGTCTGGGAGG + Intergenic
1189412360 X:40783941-40783963 GGGCCAGGCCAGGATCTGTGTGG - Intergenic
1194815761 X:98439732-98439754 TGGCCTGGGCAAGGTCTGAGTGG + Intergenic
1199860499 X:151796850-151796872 TGGCCTTCCTAGGACCTGAGTGG - Intergenic
1202147692 Y:21817146-21817168 TGGGCTAGCCTGGAATTGAGAGG - Intergenic