ID: 1089330028

View in Genome Browser
Species Human (GRCh38)
Location 11:117682652-117682674
Sequence CTGGAAAAGGATTCTTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 214}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089330020_1089330028 -1 Left 1089330020 11:117682630-117682652 CCCTCCAGCCCATGCATAAAGGC 0: 1
1: 0
2: 1
3: 19
4: 197
Right 1089330028 11:117682652-117682674 CTGGAAAAGGATTCTTCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 214
1089330024_1089330028 -9 Left 1089330024 11:117682638-117682660 CCCATGCATAAAGGCTGGAAAAG 0: 1
1: 0
2: 1
3: 17
4: 267
Right 1089330028 11:117682652-117682674 CTGGAAAAGGATTCTTCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 214
1089330023_1089330028 -5 Left 1089330023 11:117682634-117682656 CCAGCCCATGCATAAAGGCTGGA 0: 1
1: 0
2: 1
3: 10
4: 121
Right 1089330028 11:117682652-117682674 CTGGAAAAGGATTCTTCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 214
1089330021_1089330028 -2 Left 1089330021 11:117682631-117682653 CCTCCAGCCCATGCATAAAGGCT 0: 1
1: 0
2: 0
3: 10
4: 195
Right 1089330028 11:117682652-117682674 CTGGAAAAGGATTCTTCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 214
1089330014_1089330028 20 Left 1089330014 11:117682609-117682631 CCTGCACCCTGACTTGACACCCC 0: 1
1: 0
2: 0
3: 9
4: 186
Right 1089330028 11:117682652-117682674 CTGGAAAAGGATTCTTCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 214
1089330025_1089330028 -10 Left 1089330025 11:117682639-117682661 CCATGCATAAAGGCTGGAAAAGG 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1089330028 11:117682652-117682674 CTGGAAAAGGATTCTTCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 214
1089330016_1089330028 13 Left 1089330016 11:117682616-117682638 CCTGACTTGACACCCCCTCCAGC 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1089330028 11:117682652-117682674 CTGGAAAAGGATTCTTCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 214
1089330017_1089330028 1 Left 1089330017 11:117682628-117682650 CCCCCTCCAGCCCATGCATAAAG 0: 1
1: 0
2: 1
3: 19
4: 303
Right 1089330028 11:117682652-117682674 CTGGAAAAGGATTCTTCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 214
1089330015_1089330028 14 Left 1089330015 11:117682615-117682637 CCCTGACTTGACACCCCCTCCAG 0: 1
1: 0
2: 2
3: 11
4: 163
Right 1089330028 11:117682652-117682674 CTGGAAAAGGATTCTTCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 214
1089330018_1089330028 0 Left 1089330018 11:117682629-117682651 CCCCTCCAGCCCATGCATAAAGG 0: 1
1: 0
2: 1
3: 7
4: 187
Right 1089330028 11:117682652-117682674 CTGGAAAAGGATTCTTCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 214
1089330013_1089330028 29 Left 1089330013 11:117682600-117682622 CCTGGACATCCTGCACCCTGACT 0: 1
1: 0
2: 3
3: 26
4: 228
Right 1089330028 11:117682652-117682674 CTGGAAAAGGATTCTTCCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089330028 Original CRISPR CTGGAAAAGGATTCTTCCAA GGG Intronic
905875291 1:41428227-41428249 GTGGAAACGGATTCTTCATAAGG - Intergenic
906000309 1:42419101-42419123 CTGGAAGACGATTCTTCTAAGGG + Exonic
906386548 1:45374128-45374150 CTGTAAAAAGATTCATCAAATGG + Intronic
907788787 1:57640966-57640988 CTGCAAGATGATTCTTCCAAAGG - Intronic
909042386 1:70669915-70669937 CAGGAAAAGAATTCATCCTAAGG - Intergenic
910435656 1:87202879-87202901 CTGGAAAAGGATCCTTCATGTGG + Intergenic
914254278 1:145948501-145948523 TTGGAAAAGGAATCTGGCAATGG - Intronic
915012169 1:152698007-152698029 CTGGAATAGCATACTTCCACAGG + Intergenic
915035395 1:152919276-152919298 CTGGCTAAGGATTGTTCCCAGGG - Intergenic
918144633 1:181744692-181744714 CTGAAAGGGGAGTCTTCCAAAGG + Intronic
919397478 1:197068995-197069017 CTGGAATTGGTTCCTTCCAATGG + Intergenic
919536094 1:198789587-198789609 CTGTAAAAGGTTTTTTCCAAAGG - Intergenic
920831715 1:209471650-209471672 CTGAAAAAGGAGTCTGCAAAGGG + Intergenic
923499790 1:234555197-234555219 CTGGAAACGGCTTCTTCAAAAGG - Intergenic
923896846 1:238279927-238279949 CTGGAAATGGATACTGGCAATGG + Intergenic
924793486 1:247274753-247274775 ATGGAAGAGGACTCCTCCAAGGG + Intergenic
1063623503 10:7668308-7668330 GTGGGTAAGAATTCTTCCAATGG - Intergenic
1065024048 10:21525223-21525245 CTGGAAAAGAATTTTTAAAAAGG + Intronic
1069724437 10:70568093-70568115 CTGCAAAAGAATTCAGCCAAGGG - Exonic
1070105189 10:73424941-73424963 CTAGCAAAGGACTGTTCCAAGGG + Intronic
1074318109 10:112376980-112377002 CTGGAAAGGGACTCTACCACTGG + Intronic
1074318118 10:112377023-112377045 CTGGAAAGGGACTCTACCACCGG + Intronic
1074318128 10:112377066-112377088 CTGGAAAGGGACTCTACCACCGG + Intronic
1074318138 10:112377109-112377131 CTGGAAAGGGACTCTACCACCGG + Intronic
1075643947 10:124085533-124085555 ATTAAAAATGATTCTTCCAAAGG - Intronic
1076572101 10:131439625-131439647 CTGGAAAAAGGCTCTTCCCATGG + Intergenic
1077261482 11:1623783-1623805 CTGAAAATGGCTTCTTCCTAGGG + Intergenic
1077268218 11:1662504-1662526 CTACAAAAGGACTCTGCCAAGGG - Intergenic
1077487032 11:2843672-2843694 CTTGAAAAAGAGTCTTTCAAGGG - Intronic
1079368033 11:19826500-19826522 AAGGAAAATCATTCTTCCAAGGG - Intronic
1079518543 11:21297475-21297497 CTGGAAAAGGATGAATCCAGAGG - Intronic
1081158079 11:39719142-39719164 CTGGATAAGGAAACTTCAAAGGG + Intergenic
1081597438 11:44468708-44468730 CTGGACAAGCATTCCTTCAATGG - Intergenic
1081776429 11:45678839-45678861 CAGGAAGAGAATTCTTCCAATGG + Intergenic
1082904842 11:58295473-58295495 ATGTGAAAGGATTCTTTCAATGG + Intergenic
1084548901 11:69829017-69829039 CTAGAAAAGAATTCTTCTGAGGG + Intergenic
1085250500 11:75140549-75140571 CTGGAAAAGGAAAGTGCCAAAGG + Intronic
1087808004 11:102577223-102577245 TAGGAGAGGGATTCTTCCAAAGG - Exonic
1088077280 11:105865981-105866003 CTGGAACAGAATTATCCCAATGG + Intronic
1089330028 11:117682652-117682674 CTGGAAAAGGATTCTTCCAAGGG + Intronic
1090625871 11:128608165-128608187 CTGGGAAAGTATTTTTCCAGTGG - Intergenic
1091321234 11:134653604-134653626 CTGGATAAGCACTCATCCAAAGG + Intergenic
1091979882 12:4856194-4856216 TTGGAAAATCATTTTTCCAAAGG - Intergenic
1092621151 12:10270706-10270728 CTAGTAAAGAACTCTTCCAAAGG + Intergenic
1093570054 12:20656741-20656763 CTGGAAAAGCTTTGTTCCCAGGG + Intronic
1095082716 12:38026076-38026098 CTGCAAAAGGACACTTCAAAGGG + Intergenic
1096571472 12:52525824-52525846 CAGGTTAAGGCTTCTTCCAAGGG + Intergenic
1099376887 12:81903225-81903247 CAGTAAAAGGATTCTGCTAAAGG - Intergenic
1099491783 12:83297428-83297450 TTGGAAAAGGATTTTTGCATTGG - Intergenic
1099786648 12:87273044-87273066 CTGGCAAAAGTTTCTGCCAAAGG + Intergenic
1100915811 12:99420644-99420666 CTGGCAAAGGAATATTCAAAAGG + Intronic
1103504046 12:121428542-121428564 CAAGAAAAGGCTTCTTCCACAGG + Intronic
1103730225 12:123022472-123022494 CTGGAAAAAGAGGCTACCAAGGG + Intronic
1103751330 12:123165442-123165464 CTGGAAAAGGATTCTTCACCTGG - Exonic
1107232001 13:38121030-38121052 GTGGAAGTGGATTATTCCAAAGG - Intergenic
1107383021 13:39877210-39877232 TTGGAAAAGGATTCTTACCTAGG - Intergenic
1107417127 13:40211306-40211328 CTGGCAGAGGCTTCTTCCAGAGG + Intergenic
1108964587 13:56282052-56282074 GTGCAAAAGCATTCTTACAAAGG + Intergenic
1109350806 13:61178738-61178760 CTGGCATAGGCTTCTACCAAAGG + Intergenic
1111386899 13:87539297-87539319 CTGAAAGGGGGTTCTTCCAATGG - Intergenic
1111719779 13:91927897-91927919 CTTTAAAAAGATTCTTCAAAGGG + Intronic
1112594514 13:100795720-100795742 ATTCAAAAGGATTCTTGCAAGGG - Intergenic
1112645045 13:101320899-101320921 CTGGGAAAGTATTATTACAATGG - Intronic
1112896588 13:104306742-104306764 CTGGAAAAGGATTCCTGGAATGG - Intergenic
1113313256 13:109153328-109153350 CAGTAAAAGGATTTTTCAAAGGG + Intronic
1115916132 14:38317077-38317099 CTGAAATAGGATTCCTCAAATGG - Intergenic
1116995479 14:51319328-51319350 CAGGGAAAGGATTATTCCAATGG + Intergenic
1117412792 14:55466001-55466023 CTGGAAATGGATGCTGCCATGGG - Intergenic
1118297846 14:64586565-64586587 GAGGAAATGTATTCTTCCAAAGG - Intronic
1118864114 14:69689184-69689206 CTGAAGAAGGATTAATCCAATGG - Intronic
1119423093 14:74519629-74519651 CTGGACAAGGCCTCTTCCAGTGG + Intronic
1119528955 14:75345840-75345862 CTGGAAAAGGAGTTATCTAAGGG + Intergenic
1119701835 14:76761197-76761219 CTTGAAAAAGATTCTTCGCAGGG - Intergenic
1124087235 15:26562409-26562431 CTGAAAAAGGAGACTTTCAAAGG + Intronic
1124291883 15:28459261-28459283 CTTTAAAAAGATTCTTCAAAAGG + Intergenic
1127595365 15:60476851-60476873 GTGGAAAAGGATAATTCCAAGGG + Intronic
1130708891 15:86260031-86260053 CTTGAAAACTATTCTTCAAAAGG + Intronic
1132057802 15:98665362-98665384 CTGGAGGAGGATGCTTCAAACGG - Intronic
1132265742 15:100469174-100469196 GTGGAAAAGGCTTATTACAACGG - Intronic
1133951127 16:10393347-10393369 CTGCCATAGGATTTTTCCAATGG - Intronic
1134779237 16:16880594-16880616 GGGGAAAGGGATTGTTCCAAAGG - Intergenic
1135511532 16:23088676-23088698 CTGGAAAAGAATACCTCCACTGG - Intronic
1135828582 16:25753088-25753110 CTGGAAAATGGCTCTGCCAAGGG + Intronic
1136706902 16:32198411-32198433 CTTTAAAAAGATTCTTCAAAAGG - Intergenic
1136761009 16:32731006-32731028 CTTTAAAAAGATTCTTCAAAAGG + Intergenic
1136807094 16:33139380-33139402 CTTTAAAAAGATTCTTCAAAAGG - Intergenic
1138014416 16:53415740-53415762 CTGGAAAACGGTTGCTCCAAGGG - Intergenic
1138204779 16:55116546-55116568 CTAGAAAGTGATTTTTCCAAGGG + Intergenic
1138218433 16:55226553-55226575 CTGGAAAAGAAATCATCCTAAGG - Intergenic
1138273935 16:55717367-55717389 CTGGAAAGCGATTCTTCTGAAGG - Intergenic
1139911706 16:70401237-70401259 CTGGCACAGGAGGCTTCCAAAGG + Intronic
1141453581 16:84122267-84122289 CTGGAACAAAACTCTTCCAAAGG + Exonic
1203063161 16_KI270728v1_random:991323-991345 CTTTAAAAAGATTCTTCAAAAGG + Intergenic
1145080200 17:19888584-19888606 CTGAAAAAGGAGTCATCAAAGGG + Intergenic
1147014336 17:37478808-37478830 CTGGGAAGGGATTCATCTAAGGG + Exonic
1147020563 17:37529116-37529138 CTAGAAAAGGATGCTTGGAATGG + Intronic
1147533293 17:41300160-41300182 CTGGGACAGGAGTCATCCAAAGG + Intergenic
1147656186 17:42092529-42092551 CTGGAGATGGATTCTTACAGGGG + Intergenic
1147976474 17:44250816-44250838 CTCTAATAGGATTCTTCCACAGG - Intronic
1150936034 17:69636792-69636814 CTGGAAATAGATTCTTCCCCAGG - Intergenic
1150992378 17:70274584-70274606 CTGGTAAAGAATTGTTTCAAGGG - Intergenic
1153120221 18:1715221-1715243 CTGGAAAAGAATTTTACAAATGG - Intergenic
1155125114 18:22866751-22866773 CTGAAAAATTATTCTTCCCAGGG - Intronic
1156099874 18:33579646-33579668 CTGTAAAAGGATTTTTCAAAAGG + Intronic
1156456928 18:37299994-37300016 CTGGAGAAGGATTCCTGGAAGGG - Intronic
1158663971 18:59415578-59415600 CAGGAAAAGCATATTTCCAAAGG + Intergenic
1160178523 18:76615021-76615043 CTGGAAATGAATTTGTCCAAAGG + Intergenic
1167733182 19:51273905-51273927 TTGGAAATGGGTTCATCCAAAGG - Intergenic
925094209 2:1182266-1182288 TTGGTAAAGGTTTCTTACAAAGG - Intronic
925999489 2:9318952-9318974 CTGGGAAAGGATCCTAGCAAGGG + Intronic
927307199 2:21587020-21587042 CTTGCAAAGGATTATTGCAAGGG - Intergenic
928788601 2:34922373-34922395 ATGTAAAAGGATATTTCCAAAGG - Intergenic
929221318 2:39467596-39467618 TTGGAAATGGAGTTTTCCAATGG + Intergenic
929317394 2:40496338-40496360 TTGGAAAAGTATTATTCAAAAGG + Intronic
930482842 2:51971215-51971237 CTGGAAATGGATTCTGTGAATGG + Intergenic
931859138 2:66335333-66335355 CTAGAAAATGTGTCTTCCAAGGG + Intergenic
931918603 2:66987636-66987658 CTGGAAAAGAAAGCTTACAATGG + Intergenic
933769499 2:85734134-85734156 CTGGAACTGGATTCTTCCCTGGG - Intergenic
934707783 2:96496894-96496916 CTGGAAAAGGCATCTCCCAGGGG - Intergenic
934904477 2:98186847-98186869 GTGAAAAAGGACTCTTCCCAGGG - Intronic
936663229 2:114565458-114565480 CTGGATAAGGCTTCTTGAAATGG + Intronic
936895761 2:117425780-117425802 CTAGACAAAGATTCTTTCAATGG - Intergenic
938132044 2:128725035-128725057 CTGGATAGGACTTCTTCCAAAGG - Intergenic
938691896 2:133799581-133799603 CTGAAAAAGGATCCTACCCAAGG - Intergenic
939303164 2:140373957-140373979 CTGTAAAAGGATTGGTGCAAAGG - Intronic
940532131 2:154891443-154891465 CTGGCAAAGAAATCTTACAAGGG + Intergenic
940903270 2:159146365-159146387 CTGCAACTGTATTCTTCCAAAGG - Intronic
941182414 2:162275599-162275621 CTGGAAAAAAATTCTTGAAATGG - Intronic
942313585 2:174679129-174679151 CTGTAAAAGGATTGTTCTAAGGG - Intronic
943242661 2:185406635-185406657 CTGTAAAATGATTCATGCAATGG + Intergenic
943641901 2:190368720-190368742 ATGGAAAAGCCTCCTTCCAATGG - Intronic
946235152 2:218319942-218319964 CTGGGGAAGGAATGTTCCAAGGG + Intronic
1170040524 20:12035199-12035221 TTGAGAAAGGATTCTTCCCAAGG - Intergenic
1173048402 20:39535074-39535096 CTGGATCAGGATTGTTGCAAAGG + Intergenic
1174934334 20:54851483-54851505 ATGGAAAAGGAGGCTTCCAGAGG - Intergenic
1176075261 20:63245411-63245433 CTGGAAGGGGCATCTTCCAATGG - Intronic
1177060845 21:16372568-16372590 GTTGAAAAGCATTCTCCCAATGG + Intergenic
1177758903 21:25380658-25380680 CTGTAAAAGGTTTGTTCCACAGG - Intergenic
1179200599 21:39216264-39216286 CTGGGAAATTAATCTTCCAAAGG + Intronic
1181240900 22:21476236-21476258 GTGGAAAAGGACTCTTCAACAGG + Intergenic
1185088030 22:48751161-48751183 CTTGAACATGCTTCTTCCAATGG + Intronic
949421736 3:3873151-3873173 CTGGAAACAGTTTCTTCCCATGG + Intronic
952208310 3:31202881-31202903 CTGGAAAAGCATTGTGCTAAAGG - Intergenic
952330760 3:32362603-32362625 GTGGAAATGGCTACTTCCAAGGG - Intronic
953496481 3:43391757-43391779 CTGGAAATGGATCCTCCCTAAGG + Intronic
953806620 3:46075755-46075777 ATGGAAGAGGATTTTTCAAATGG + Intergenic
954279921 3:49570099-49570121 CTGGAATAGGACTTTCCCAATGG + Intronic
955559154 3:60170016-60170038 GTGAAAAATGATTCTCCCAAAGG - Intronic
956108092 3:65842874-65842896 GTGGAATATGATCCTTCCAATGG + Intronic
956112910 3:65888826-65888848 ATGGAAAATGGTTATTCCAAGGG + Intronic
956643044 3:71432480-71432502 CAGGAAAAGGAAGCGTCCAAAGG - Intronic
957248563 3:77743540-77743562 TTGAAAAAGGAATCATCCAAGGG - Intergenic
958588491 3:96121774-96121796 CTGGGAATGGATTTTTTCAACGG - Intergenic
958729076 3:97941083-97941105 CTGGAAATGAATCCTTCCAGAGG - Intronic
960340490 3:116469115-116469137 CTGGAAAAGGATTTCTGGAAGGG - Intronic
961076745 3:123989860-123989882 CTGGGAAAGGTTTCTTCCTTGGG + Intronic
961514467 3:127424110-127424132 CTGGAAACGGTTTGTTCAAATGG - Intergenic
966596800 3:181731312-181731334 CTTGAAAGGTATTCTTCCACAGG - Intergenic
966923141 3:184627469-184627491 CTGTCAAAGGATTCTTTCCATGG + Intronic
969486617 4:7475791-7475813 CTGGACATGCAGTCTTCCAAAGG - Intronic
969986942 4:11222195-11222217 CCTGGGAAGGATTCTTCCAAGGG + Intergenic
977777425 4:100937867-100937889 CTGGAGAAACATTTTTCCAAAGG + Intergenic
978975695 4:114867872-114867894 CTGGAAATTGATTCTTTCACAGG - Intronic
980959138 4:139457392-139457414 CTGGAAAATGATTGTGCTAAAGG - Intronic
981190317 4:141854889-141854911 ATGGAAAAGGATTCTTCCATAGG + Intergenic
981680905 4:147396737-147396759 CTGGAGGAGGATTTTTCCATGGG + Intergenic
982470598 4:155785572-155785594 CTACAAAAAGATTCTTACAATGG - Intronic
982522740 4:156439703-156439725 CTGGAAAAAGATTTCTCAAAAGG + Intergenic
983882046 4:172943825-172943847 CCAGAAATGGATTCTTCAAATGG + Intronic
985086106 4:186313676-186313698 CTGGAAATGGATTCTCTCATCGG + Intergenic
985892610 5:2727440-2727462 CTGAAACAGGATTCTTCTCAAGG + Intergenic
987677207 5:21089801-21089823 TTGGAAAAGGATAATTCCATTGG + Intergenic
988524751 5:31977285-31977307 CTGGAAATTGTTTCTTCCAAAGG + Intronic
990896252 5:60702898-60702920 CTAGAAAGGCATACTTCCAAAGG + Intergenic
992047744 5:72912865-72912887 GTGCAAAAGCATTCTTCCCAGGG + Exonic
992749601 5:79849900-79849922 CTGGAGACGGATCTTTCCAACGG - Intergenic
992903620 5:81323487-81323509 CTTGAAAAGTATTTTTGCAATGG - Intergenic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
996852835 5:127971920-127971942 CTGAGAAAGCATTTTTCCAAAGG + Intergenic
999718592 5:154381666-154381688 AGGGAAATGGATTCTTCCCAAGG - Intronic
1004903876 6:20218449-20218471 CTGGGGAAGGTTTCTTCTAAAGG - Intergenic
1006279372 6:33036489-33036511 ATGGAAAAGGATTTTTGCACCGG + Intergenic
1006878813 6:37321496-37321518 CTGAAAAAGAATTCCTCCCAGGG + Intronic
1008519924 6:52353365-52353387 CTGGAAAAGAATTGTGCCAGTGG - Intergenic
1009036550 6:58123911-58123933 AGGGAACAGGCTTCTTCCAAAGG + Intergenic
1010001273 6:70952555-70952577 CTGGAAAAGCTTACTTGCAAAGG - Intronic
1010822756 6:80434634-80434656 CTGAAAAAGAATTCTACAAAGGG - Intergenic
1012006843 6:93723249-93723271 CTGGAAAAATATTCTTCTAAAGG - Intergenic
1012271253 6:97214940-97214962 CTGGAATAGTATTCTTTCAGGGG - Intronic
1012330236 6:97976343-97976365 GTGGTAAAGGTTTCATCCAATGG + Intergenic
1014316516 6:119872425-119872447 GAGGAAAAGGATCGTTCCAATGG - Intergenic
1014577491 6:123091560-123091582 CTGGAAATGGATTTTTGCTAGGG + Intergenic
1014927192 6:127286986-127287008 CTGGAAGATGCTTTTTCCAAAGG + Exonic
1015441938 6:133258708-133258730 CCGGGAAAGAACTCTTCCAAGGG - Intronic
1015549564 6:134398001-134398023 CGGCAAAAATATTCTTCCAAAGG + Intergenic
1017996202 6:159533708-159533730 CTGGAAAAGGAAGCTTCAAAAGG - Intergenic
1020926141 7:14327381-14327403 CTGGAAACAGTTTCTTCCAAAGG - Intronic
1021089460 7:16465858-16465880 CTGCAAAAGAATTTTACCAATGG + Intronic
1023625220 7:42108857-42108879 CGTGCAAAGGATTCTTGCAAGGG - Intronic
1026257778 7:68727320-68727342 TAGGAAAAGGACTCTTGCAATGG + Intergenic
1026607653 7:71829340-71829362 ATGGAAATGGATTCTTCCCTTGG + Intronic
1034307358 7:150055418-150055440 TTGGACAAGGATTCTCCTAAGGG + Intergenic
1034799489 7:154045269-154045291 TTGGACAAGGATTCTCCTAAGGG - Intronic
1036020716 8:4842297-4842319 CTGGTAAATAATTTTTCCAATGG - Intronic
1037282191 8:17254266-17254288 CTGGAAAAGGAGGCTTCCTGGGG + Intronic
1039201707 8:35102087-35102109 CTGCAAAACAATTTTTCCAAAGG - Intergenic
1039490905 8:37946832-37946854 CTGGGAAAGGATTCTCCAACTGG + Intergenic
1040884685 8:52248638-52248660 CTGCAAACGCATTTTTCCAAGGG + Intronic
1042537967 8:69878152-69878174 ATGGAGAAGGATTTTTCCACAGG - Intergenic
1045745753 8:105419224-105419246 GTGGAAAAGCTTTCCTCCAATGG - Exonic
1046059974 8:109127058-109127080 CTTCAAAATGATTCTTCAAAAGG + Intergenic
1046980490 8:120331250-120331272 ATGGAAAATAATTATTCCAATGG + Intronic
1047549221 8:125851536-125851558 CAGATAAAGGATTCTTCCATAGG + Intergenic
1049063458 8:140294493-140294515 CTAGAAAATGATTTTTCAAATGG - Intronic
1050694662 9:8265264-8265286 CTGGAATAGGAATCTGCCAGAGG + Intergenic
1051009139 9:12388947-12388969 GTGGACAAGAATTCTCCCAATGG + Intergenic
1055471590 9:76617328-76617350 ATGGGCAAGGGTTCTTCCAATGG - Intronic
1058285300 9:103169676-103169698 CTGGAAAAGATTCCTTCCAGAGG - Intergenic
1058911448 9:109523665-109523687 CTGGAAAAGGAGAATTCCAGAGG - Intergenic
1188671799 X:32889778-32889800 CTGAAAAAGGAGTCAGCCAAGGG - Intronic
1188794881 X:34450568-34450590 CTTGAAAAGGATTCCTAGAAAGG + Intergenic
1188890800 X:35609713-35609735 CTGAAAAAGGAGTCAGCCAAGGG - Intergenic
1189944568 X:46164904-46164926 TTGGAAAAGGATTCTTGCCAAGG + Intergenic
1192381179 X:70618302-70618324 CTGGAAGGGGATTCTTCTGATGG - Intronic
1193370348 X:80689109-80689131 CTGGAAAACAATTCATCCCAGGG - Intronic
1195725604 X:107912377-107912399 CTTGAAAAGAATACTTTCAATGG - Intronic
1198007533 X:132512427-132512449 CTGGAAAAGAATACTTGGAATGG + Intergenic
1198138232 X:133776331-133776353 CTGGAAAAGGGGTCTGCGAAGGG - Intronic
1198331028 X:135622668-135622690 CTGAAAAAGTATTCTTTCCAAGG + Intergenic
1200303903 X:155006157-155006179 CTGGCAATGAATTCTCCCAAAGG - Intronic
1200317483 X:155148749-155148771 CTGGCAATGAATTCTCCCAAAGG + Intergenic
1202015675 Y:20403960-20403982 ATGGAAAAGGATTTTTCCTCAGG - Intergenic