ID: 1089330558

View in Genome Browser
Species Human (GRCh38)
Location 11:117686166-117686188
Sequence CTATGTGGAGAGATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 241}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089330552_1089330558 10 Left 1089330552 11:117686133-117686155 CCATGGGCTGACATGGTTGAGCC 0: 1
1: 0
2: 0
3: 20
4: 217
Right 1089330558 11:117686166-117686188 CTATGTGGAGAGATGGAGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 241
1089330551_1089330558 13 Left 1089330551 11:117686130-117686152 CCTCCATGGGCTGACATGGTTGA 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1089330558 11:117686166-117686188 CTATGTGGAGAGATGGAGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 241
1089330549_1089330558 20 Left 1089330549 11:117686123-117686145 CCAAAGACCTCCATGGGCTGACA 0: 1
1: 0
2: 2
3: 28
4: 503
Right 1089330558 11:117686166-117686188 CTATGTGGAGAGATGGAGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 241
1089330545_1089330558 30 Left 1089330545 11:117686113-117686135 CCAGCTCCTGCCAAAGACCTCCA 0: 1
1: 0
2: 5
3: 34
4: 322
Right 1089330558 11:117686166-117686188 CTATGTGGAGAGATGGAGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 241
1089330548_1089330558 24 Left 1089330548 11:117686119-117686141 CCTGCCAAAGACCTCCATGGGCT 0: 1
1: 0
2: 2
3: 20
4: 166
Right 1089330558 11:117686166-117686188 CTATGTGGAGAGATGGAGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089330558 Original CRISPR CTATGTGGAGAGATGGAGCT GGG Intronic
900965410 1:5953882-5953904 ATATAGGAAGAGATGGAGCTAGG - Intronic
901018452 1:6244488-6244510 CGAGGTGGAGAGAGGGAGGTTGG - Intronic
901066319 1:6496402-6496424 CTCTGTGGATAGCTGGTGCTGGG + Intronic
903871783 1:26440829-26440851 CAATGTTGAGAGATGGAGAGCGG - Intronic
906276415 1:44519695-44519717 CTACATGGAGAGATGGAGGGAGG - Intronic
907619509 1:55962004-55962026 ATATGTGTGGAGACGGAGCTTGG - Intergenic
907807948 1:57840334-57840356 CTATGGGGAGTCATGGAGATGGG + Intronic
908977537 1:69917338-69917360 CCATGTGGAGAAAGGGAGATAGG + Intronic
909555988 1:76954799-76954821 CTCTGTGGTCAAATGGAGCTGGG + Intronic
910557668 1:88553948-88553970 ATATGTGGAGTGTTGAAGCTAGG - Intergenic
910672184 1:89784519-89784541 CTATGGGGAGCCCTGGAGCTGGG + Intronic
911091142 1:94018142-94018164 CTATGGAGAGAGATGTAGCTAGG - Intronic
913089187 1:115465129-115465151 CCATGTGGAGAGAGGGAGTGTGG - Intergenic
914450266 1:147785444-147785466 CTATCTGGATTGAGGGAGCTAGG + Intergenic
915005202 1:152629198-152629220 CAATGGGGAGAGGTGGAGCAAGG + Intergenic
916146144 1:161741501-161741523 CTATCTTTAGAGAGGGAGCTGGG - Intergenic
916626651 1:166565335-166565357 CTATGGAGAAAGATGGAGCAGGG - Intergenic
918384143 1:183988013-183988035 ATGTGTGGATAGATGGACCTGGG - Intronic
923427031 1:233881269-233881291 CTAAATGCAGAGATGGAGGTGGG - Intergenic
1063542784 10:6950951-6950973 CTATGGGCAGGGAGGGAGCTGGG + Intergenic
1067692777 10:48512831-48512853 CTAAGTGGTGACATGGAGGTGGG - Intronic
1067801885 10:49365091-49365113 GTATGTGCAGATATGGAGCATGG - Exonic
1067828511 10:49596667-49596689 CTCTGCTGAGAGATGGACCTTGG + Intergenic
1068433645 10:56963544-56963566 GTGTGTGTAGACATGGAGCTGGG - Intergenic
1069321177 10:67173411-67173433 CTATGGGGAGTGTTGGAGCTGGG - Intronic
1070163831 10:73882678-73882700 GTAGGTGGATAGATTGAGCTTGG - Intergenic
1070594768 10:77824800-77824822 CTCTGTGGAGGCAAGGAGCTGGG - Intronic
1073562756 10:104510898-104510920 CTATATGGAGAGAGAGAGCGAGG - Intergenic
1074780795 10:116800512-116800534 CTTTGTGGGGAGAGGGAGCCAGG + Intergenic
1075297077 10:121287096-121287118 CTATGCAGAGAGGTGGTGCTGGG - Intergenic
1076933014 10:133546341-133546363 CAGTGAGGAGAGATGGACCTGGG - Intronic
1077798005 11:5511182-5511204 CTATGTGGAGAGCTTGATTTAGG + Intronic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1078328930 11:10402697-10402719 GTATGTGGGAAGATGAAGCTTGG + Intronic
1078903218 11:15660929-15660951 CTATGGGAAGAGCTGGGGCTGGG - Intergenic
1079387913 11:19997275-19997297 CTATGTGGGGAGATGTTGGTGGG + Intronic
1080072689 11:28108498-28108520 CTAGGGGGAGAGGTGGAGTTTGG + Intronic
1081245134 11:40756538-40756560 CTATGTGGACTGGTGGAGTTGGG + Intronic
1081816659 11:45948117-45948139 CCATGTGGAGAAAAGGATCTTGG + Intronic
1082030970 11:47603114-47603136 CTAAGTGGAGCAATGCAGCTAGG + Intergenic
1083326676 11:61876479-61876501 CTAAGTGGTGAGCTGGACCTAGG - Intronic
1084530806 11:69726772-69726794 CTATGGGGAGCGCTGGCGCTGGG + Intergenic
1087534870 11:99430658-99430680 CTATATAGAGAGAAAGAGCTTGG + Intronic
1088661015 11:112046352-112046374 CGATGGGGAAAGATGGTGCTGGG - Intronic
1089330558 11:117686166-117686188 CTATGTGGAGAGATGGAGCTGGG + Intronic
1089619829 11:119715776-119715798 GATGGTGGAGAGATGGAGCTAGG - Intronic
1090267949 11:125365755-125365777 AAATGTGGAGAGATGCAGCCTGG - Intronic
1090486793 11:127120229-127120251 TTATGTGAATAGATGGATCTTGG - Intergenic
1091303386 11:134521941-134521963 GAATGTGGTGACATGGAGCTGGG + Intergenic
1091678788 12:2511255-2511277 CTTTATGGTGAGATGGAGTTGGG - Intronic
1092052161 12:5479691-5479713 TTTTGGGGAGAGATGGAGTTAGG - Intronic
1092156769 12:6287638-6287660 TTTTTTGTAGAGATGGAGCTTGG - Intergenic
1094314222 12:29120151-29120173 TTATTTGGAGAGATGTAGGTAGG + Intergenic
1094765800 12:33593328-33593350 CTATGTGGAGGGATTGAGTCAGG + Intergenic
1095159639 12:38901788-38901810 CAAAGGGGAGAGATGGGGCTTGG - Intronic
1097102007 12:56596482-56596504 CTAGGGAAAGAGATGGAGCTGGG + Exonic
1097335770 12:58381532-58381554 TTATGTTGAGAGTTCGAGCTAGG + Intergenic
1102019901 12:109675103-109675125 CTCTGTGCAGAGAAGAAGCTGGG + Intergenic
1102082146 12:110107094-110107116 GTAGGTGCAGAGATGGATCTTGG + Intergenic
1102377969 12:112438962-112438984 GTATGGGGAGAGATGGATTTAGG + Intronic
1102672064 12:114628581-114628603 CTTTGTGGGGAGATTGAGATAGG + Intergenic
1102808048 12:115799452-115799474 ATATGTGTAGAGATGGGGTTTGG - Intergenic
1104207377 12:126652502-126652524 CTATAGGGAGAGATGGTGGTGGG + Intergenic
1104363474 12:128155185-128155207 CTATGTGCAAAGATGTGGCTAGG - Intergenic
1106247155 13:27960408-27960430 CTCTGGGAAGAGATGGGGCTTGG - Intergenic
1106584213 13:31043312-31043334 CTATGTGAAGAAATGGGTCTGGG + Intergenic
1106950575 13:34879391-34879413 CTATGTGGCGGGATGGAGTTGGG + Intergenic
1109042897 13:57363589-57363611 ATATATGGAGATATGGGGCTAGG - Intergenic
1109326002 13:60869042-60869064 CTTGCTGGAGAGGTGGAGCTCGG + Intergenic
1109994770 13:70108515-70108537 CTATACGGAGAGATGGAGGGAGG + Intergenic
1110910690 13:80958765-80958787 GTATGTGGATAAATGGAGGTAGG - Intergenic
1113172598 13:107522309-107522331 CTATATGGAGAGATTGAGAAAGG - Intronic
1117351100 14:54882966-54882988 CTATGTGTAGGGATGGACCCAGG + Intronic
1117501031 14:56351482-56351504 GTATGTGGAGAGATAAAGATGGG + Intergenic
1118098489 14:62567478-62567500 CTATGTGAAATGATGGTGCTGGG + Intergenic
1118329598 14:64805091-64805113 CTAGGTGGAGAGAAGAACCTTGG + Intronic
1120362530 14:83523956-83523978 CTATGTAGTGAAATGGATCTGGG + Intergenic
1124374995 15:29124164-29124186 CTCTGTGGGGAGCTGGAGCCAGG - Intronic
1126900221 15:53307257-53307279 CTATAGGAAGAAATGGAGCTTGG + Intergenic
1129542156 15:76359216-76359238 CCTTATGGAGAGATGGGGCTGGG - Intronic
1130917343 15:88315661-88315683 TTATGTGGAGTGATGGAGCAAGG - Intergenic
1130994998 15:88898793-88898815 CTATGGGGAGAAAGGGAGCGAGG - Exonic
1131151998 15:90053194-90053216 CTGTTTGGAGTGAGGGAGCTGGG + Intronic
1131880334 15:96855512-96855534 CTATGTGAAGAGATGAAGTGAGG - Intergenic
1134825736 16:17282631-17282653 CTTTAAGGAGAGAAGGAGCTGGG + Intronic
1136359652 16:29770585-29770607 CTATTTGAAGAGGAGGAGCTGGG + Intergenic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1137661730 16:50213018-50213040 CTCTGAGGCGAGATGGACCTGGG - Intronic
1138277131 16:55743234-55743256 CTCTGTGGACAACTGGAGCTGGG + Intergenic
1138283021 16:55786413-55786435 CTCTGTGGACAACTGGAGCTGGG + Intergenic
1138597265 16:58035686-58035708 CTCTGGGGACAGGTGGAGCTAGG - Intronic
1139775826 16:69316569-69316591 CCATGGGGAGAGGGGGAGCTTGG + Intronic
1140150850 16:72363493-72363515 CTCTGTGGAGAGTAGGAGTTTGG - Intergenic
1143230921 17:5353871-5353893 CTATGTGGAGAGGATGAGGTGGG + Intronic
1147953067 17:44117703-44117725 CCCTGGGGAGAGATGGAGCAGGG + Exonic
1148339405 17:46864343-46864365 GTATGTGAAGAGAAGGAGTTGGG - Intronic
1148742662 17:49901739-49901761 TTATGTGGAGACCTGGAGCATGG + Intergenic
1150263790 17:63818507-63818529 CTTAGTGGAGAGCTGGAGCTTGG + Exonic
1150887818 17:69108244-69108266 CTGTGTGGATAGATGGAGACAGG - Intronic
1157009254 18:43627116-43627138 CTATGAGGAGAGCTGGGGTTAGG + Intergenic
1158131039 18:54153037-54153059 CTATGTGGAGGGATGGAGAGAGG + Exonic
1158321446 18:56268536-56268558 TTCTTTGAAGAGATGGAGCTGGG - Intergenic
1160151908 18:76401761-76401783 GTTGGTGGAGAGATGGAGCGCGG - Intronic
1160151928 18:76401824-76401846 GTTGGTGGAGAGATGGAGCGCGG - Intronic
1160954163 19:1682483-1682505 CCATGTGGCGGGAAGGAGCTGGG - Intergenic
1161027446 19:2043083-2043105 CTGTGAGGAGGGAGGGAGCTGGG - Intronic
1162546897 19:11336178-11336200 CTAAGTTGGGAGAGGGAGCTAGG + Intronic
1163402994 19:17105620-17105642 CTCAGTGGAGAGAGGGAGTTGGG + Intronic
1163797449 19:19345733-19345755 CCATGGGGAGTGGTGGAGCTGGG + Intronic
1165927489 19:39335934-39335956 CTATGGGAAGAGCTGGGGCTGGG - Intronic
1166295502 19:41887522-41887544 TTATGTGGAGAGTTGGGGGTTGG + Intronic
1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG + Intergenic
1167217297 19:48173094-48173116 CTAGTTGGAGCGATGGAGTTGGG + Intronic
926157157 2:10462666-10462688 CTGTGTGCAGAGCTGGGGCTGGG - Intergenic
927684788 2:25162791-25162813 CTTAGTGCAGAGATGGAGCTGGG - Intronic
931984850 2:67731377-67731399 ATAAGTGGAGAGATTGACCTTGG - Intergenic
932387988 2:71356091-71356113 CTATGGGAAGAGGTGGAGATAGG - Intronic
933185906 2:79279029-79279051 AGATGTGGAGAGATGGAACAGGG + Intronic
933346177 2:81088479-81088501 GACTGTAGAGAGATGGAGCTGGG + Intergenic
935024349 2:99262002-99262024 CTCGGTGGAGATATGGAGCATGG - Intronic
937883491 2:126885375-126885397 CTATCTGGAGAGAGGGAGAGAGG - Intergenic
944473951 2:200085090-200085112 CTATGGGGAAAAATGGAGATGGG - Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
947589123 2:231374982-231375004 GTATCTGGAGAGATAAAGCTAGG - Intergenic
948601987 2:239112518-239112540 CTCTCTGATGAGATGGAGCTGGG + Intronic
949055101 2:241923381-241923403 CCATGTGCAGACATGAAGCTGGG + Intergenic
949055108 2:241923432-241923454 CCATGTGCAGACATGAAGCTGGG + Intergenic
949055129 2:241923585-241923607 CCATGTGCAGACATGAAGCTGGG + Intergenic
949055141 2:241923687-241923709 CTATGTGCAGAGGTAAAGCTGGG + Intergenic
1168770104 20:408979-409001 CTCTGTGCTGAGATGGGGCTAGG + Intronic
1171251789 20:23654438-23654460 CTGTGTGGAGATATGGGGCCAGG + Intergenic
1173360674 20:42341795-42341817 CCATCTGGAGAGATGGAGACAGG - Intronic
1174124891 20:48297144-48297166 CGAGGTGCAGAGATGGAGATGGG - Intergenic
1174789519 20:53464444-53464466 CTGTGAGGAGGGAAGGAGCTTGG + Intronic
1176905543 21:14496103-14496125 GTTTGTGGAGAGAAGGGGCTGGG - Intronic
1177664631 21:24138687-24138709 CTATTTGGAGATTTGAAGCTTGG - Intergenic
1178127504 21:29530892-29530914 GGATCTGGAGAGATGGAGGTGGG + Intronic
1178671752 21:34596794-34596816 CACTGTGGAGTGAAGGAGCTCGG + Intronic
1178786322 21:35657025-35657047 GTATTTGGAGGGATGGAGGTGGG - Intronic
1179143729 21:38749779-38749801 CTGTCTGGAGAGGTGCAGCTGGG - Intergenic
1181138527 22:20786592-20786614 CAGTGTGGGGAGCTGGAGCTGGG + Intronic
1182058602 22:27380646-27380668 CTATGTCTGGAGATGGTGCTAGG + Intergenic
1183552469 22:38498670-38498692 CACTTTGGAGAGATGAAGCTGGG - Intronic
1183608295 22:38879926-38879948 CTATGGGGAGAGAGGGTGGTGGG - Intergenic
1183733108 22:39629299-39629321 CCATCTGGAGATGTGGAGCTTGG - Intronic
1185173596 22:49306971-49306993 CTCTGTGCAGAGCTGGAGCCGGG - Intergenic
1185362154 22:50414780-50414802 CTAGGTGGAGAGATGGGGGCCGG - Intronic
950167808 3:10814907-10814929 CTTTCTGGGGAGATGGAGGTTGG + Intergenic
950341616 3:12251126-12251148 CTAGGGGGAGAGAGGGAGCTAGG + Intergenic
951027745 3:17847384-17847406 CTAAGAGGTGAGATGGAGGTTGG - Intronic
951219640 3:20055610-20055632 CTGTGTGGCTAGATGGAGGTGGG + Intronic
954881541 3:53839015-53839037 CTCTGTGGAGAGTTGGTTCTGGG - Intronic
957587948 3:82156918-82156940 CTATGTGAAGAGTTGGCACTTGG + Intergenic
959595057 3:108120655-108120677 CCAGGTGGAGAGAGGAAGCTGGG + Intergenic
959681912 3:109105883-109105905 CTAGGTAGAGAGAAGGAACTGGG - Intronic
961863172 3:129934212-129934234 TTATGTGAGGAGATGAAGCTTGG - Intergenic
963075165 3:141339411-141339433 CTATGTGGAGAAATGTTGGTAGG + Intronic
963546959 3:146671848-146671870 GCATGTGTAGACATGGAGCTGGG + Intergenic
964082465 3:152776163-152776185 CTCTCTGAAGAAATGGAGCTGGG + Intergenic
964153231 3:153553814-153553836 CTATGTGGAGCAATGGTGCTTGG + Intergenic
964886250 3:161486497-161486519 GGTTGTGGAGACATGGAGCTAGG + Intergenic
965427995 3:168550932-168550954 ATATGTGGAGGCATAGAGCTTGG + Intergenic
965564616 3:170100982-170101004 CTATGTGGATACCTGGGGCTGGG - Intronic
966224205 3:177580768-177580790 CATTGTGGAGAAATGGAGCCAGG + Intergenic
966619739 3:181951100-181951122 GTATGTGGAGAGAGAGAGTTTGG - Intergenic
968352969 3:198077464-198077486 CTATTTGGACAGAATGAGCTTGG + Intergenic
969253223 4:5983759-5983781 CTAGATGGAGAAATAGAGCTTGG + Intronic
970150634 4:13086239-13086261 CTATGTGTAGAGATGGAAATGGG - Intergenic
971041671 4:22760187-22760209 CTATGTGCAGAGATGGGGGAGGG + Intergenic
972813787 4:42621128-42621150 CTATGTGGAGCAATGCAGGTAGG + Intronic
975573785 4:75843252-75843274 CAATTTGAAGGGATGGAGCTGGG + Intergenic
980602872 4:135047572-135047594 CTGTGTGGAGAGATAAAGCATGG - Intergenic
982570743 4:157048241-157048263 CCATGGAGAGATATGGAGCTGGG - Intergenic
985979273 5:3448925-3448947 TGTTGTGGAGAGATGGTGCTTGG - Intergenic
986779891 5:11055624-11055646 CTAACTGGGGAGATGGAGGTGGG - Intronic
989408262 5:41086693-41086715 TGAGTTGGAGAGATGGAGCTGGG - Intergenic
992688604 5:79221780-79221802 CCATGGGGAGCTATGGAGCTAGG - Intronic
992833066 5:80614418-80614440 GAATATGGAGAGATGGAGCAAGG - Intergenic
993686101 5:90939974-90939996 CTATGTGAAGATATGAGGCTAGG - Intronic
994310738 5:98267647-98267669 CTCTGTGGGGAGTTGGAGGTTGG - Intergenic
996828807 5:127716823-127716845 CCAAGGGGAGATATGGAGCTGGG - Intergenic
999193684 5:149767456-149767478 CTGTGTGGAGAGATGGCATTAGG + Intronic
999298262 5:150474192-150474214 GTCTGGGGTGAGATGGAGCTGGG - Intergenic
999631309 5:153574232-153574254 TTATATGGAGAGAGAGAGCTTGG + Intronic
999891098 5:155979585-155979607 CCATGGGGAGTGATGAAGCTGGG + Intronic
1002037755 5:176485892-176485914 CTTTTCAGAGAGATGGAGCTTGG + Intronic
1004292855 6:14384159-14384181 CTAGGTGGGGAGGTGTAGCTTGG + Intergenic
1005367872 6:25097678-25097700 CTGGGTGGAGAGCTGGGGCTGGG - Intergenic
1006132565 6:31878124-31878146 TTCTGAGGAGAGAGGGAGCTGGG - Intronic
1006865648 6:37207097-37207119 CCACTTGGTGAGATGGAGCTGGG + Intergenic
1006934773 6:37709810-37709832 CACTGTGGGGAGCTGGAGCTCGG - Intergenic
1007993832 6:46285288-46285310 CTATTTCCAGAGATGGAGCCTGG + Intronic
1008102538 6:47407363-47407385 CTCTGTGGAGAGACAGAGCAAGG + Intergenic
1014572483 6:123026989-123027011 GTATGTGGAGAGATGTACGTAGG + Intronic
1014791276 6:125675197-125675219 CTATGGGGAGTGCTGGAGCTGGG - Intergenic
1016860724 6:148716295-148716317 CAAGGTGGATAGATGGGGCTGGG - Intergenic
1017100003 6:150840158-150840180 CTCTGTGCAGAGATGCAGCGTGG + Exonic
1018697150 6:166399292-166399314 CTATGTGAAGAGATTGAGAGAGG + Intergenic
1020157614 7:5739507-5739529 CTATGTAGACAGATGAATCTGGG - Intronic
1022381787 7:29867212-29867234 CTAAGTAGAGAGAAGGAGCCGGG + Intronic
1022534098 7:31085113-31085135 CCATGTGGGGTGGTGGAGCTGGG + Intronic
1023421622 7:39985936-39985958 CCATGAGGAGGGAGGGAGCTAGG + Intronic
1023826984 7:44016250-44016272 TTATGTGAAGACATGGAGGTCGG + Intergenic
1024331168 7:48156625-48156647 ATATGTGGAAACATGGAGCATGG + Intergenic
1024907286 7:54400771-54400793 CTATGTTCAGAGATGGGGCATGG - Intergenic
1027190988 7:75995286-75995308 CTCTGTGGAGGGATGGGGGTGGG - Intergenic
1028348951 7:89819534-89819556 CTATTGGGAGAGATGGAGCTGGG - Intergenic
1028482105 7:91318091-91318113 CTATCTGGAGAGATGGCACGGGG + Intergenic
1029207592 7:98878720-98878742 CTCCGCGGAGGGATGGAGCTGGG + Intronic
1029738137 7:102475997-102476019 TTATGTGAAGACATGGAGGTCGG + Intronic
1029755270 7:102569651-102569673 TTATGTGAAGACATGGAGGTCGG + Intronic
1029773218 7:102668731-102668753 TTATGTGAAGACATGGAGGTCGG + Intronic
1031095091 7:117407722-117407744 CTATGTGAAGAGATGAAGCAGGG + Intronic
1031203239 7:118718623-118718645 CTTGGTGGAGAAATGGAACTTGG + Intergenic
1031734254 7:125337084-125337106 CTATGTGGAGAAATATAGCAAGG + Intergenic
1031836069 7:126683572-126683594 TTAAGTGGAGAGATGGAGGGAGG - Intronic
1032000897 7:128264831-128264853 CTTTGAGGAGAGAAGGTGCTGGG - Intergenic
1032802929 7:135330904-135330926 CTCTGTCTAGTGATGGAGCTGGG - Intergenic
1034954474 7:155326074-155326096 CTCTGGGGAGCCATGGAGCTTGG + Intergenic
1035351107 7:158247130-158247152 CTATGTGCAGATATGGGGATGGG - Intronic
1035480630 7:159179791-159179813 ATTTTCGGAGAGATGGAGCTGGG - Intergenic
1036251966 8:7170166-7170188 ATAAATGGAGAGAGGGAGCTCGG - Intergenic
1036365524 8:8117295-8117317 ATAAATGGAGAGAGGGAGCTCGG + Intergenic
1036671568 8:10791939-10791961 CTCTGTGGAGAGACTGAGATGGG - Intronic
1037831384 8:22191788-22191810 CTATGAAGAGAGCTGGAGCCAGG + Intronic
1040518205 8:48151595-48151617 CTACATGGTGAGATGAAGCTAGG - Intergenic
1041384403 8:57283954-57283976 CTATTTGGACAGAAAGAGCTTGG - Intergenic
1042311974 8:67387815-67387837 GTCTGTGGAGAGATGGAGAAAGG + Intergenic
1042655976 8:71097015-71097037 ATATGAGGAGAGATGGAGATTGG - Intergenic
1046748220 8:117898406-117898428 CTCAGTGGACAGAAGGAGCTAGG + Intronic
1047897509 8:129383034-129383056 CTACCAGGAGAGTTGGAGCTGGG + Intergenic
1051207149 9:14700050-14700072 CTAGGGGGAGAAATAGAGCTGGG - Intergenic
1052873198 9:33528524-33528546 CTATTTGGATAGAATGAGCTTGG - Intronic
1053502903 9:38616225-38616247 CTATTTGGATAGAATGAGCTTGG + Intergenic
1054825231 9:69566679-69566701 CTCTGAGGAGAGAATGAGCTTGG - Intronic
1056833473 9:89934907-89934929 TTATGTCGAGAGATGGAGAAGGG - Intergenic
1057153186 9:92813390-92813412 CTATTTGGACAGAATGAGCTTGG - Intergenic
1057845158 9:98517223-98517245 CCATGGGGAGCTATGGAGCTAGG - Intronic
1059963700 9:119592640-119592662 CTATGCGGAGAGAAGTATCTAGG + Intergenic
1061369937 9:130192506-130192528 CTTTGTGGAGCGTGGGAGCTGGG + Intronic
1061387279 9:130297844-130297866 CTATGTGTAGTGATGGCGCGGGG + Intronic
1062159723 9:135073689-135073711 CTCTGTGAGGAGATGGTGCTGGG - Intergenic
1062352938 9:136148048-136148070 GCAGGTGGAGGGATGGAGCTGGG + Intergenic
1185884254 X:3768207-3768229 CGATGTGTAGAGATGAAGATTGG + Intergenic
1186471825 X:9827747-9827769 CTGTGTGGGGAGGTGGAGCAAGG + Intronic
1186756799 X:12679714-12679736 GTCTGAGGAGAGAGGGAGCTGGG - Intronic
1190327535 X:49215952-49215974 CTCTGTGGGGAGATGGAGTGGGG - Intronic
1192261701 X:69509423-69509445 CTAGGGGGAGTGATGGAGATGGG + Intronic
1195837229 X:109130177-109130199 ATATGTGTAAAGATGGTGCTAGG + Intergenic
1196199352 X:112867965-112867987 CAGTGTTAAGAGATGGAGCTAGG + Intergenic
1196206751 X:112948504-112948526 CTCAGTGGAGAGATGGACCAAGG + Intergenic
1196315812 X:114221913-114221935 GTATGTGTAGAGATGGAAGTGGG + Intergenic
1197701036 X:129599840-129599862 CTCTGTGGTGAGAGGGAGCAAGG - Intergenic
1197747873 X:129944952-129944974 CTCTGGAGTGAGATGGAGCTAGG + Intergenic
1199536177 X:148905696-148905718 CTATTGGGAGGGCTGGAGCTTGG - Intronic
1199814648 X:151386855-151386877 CCATGTGGAGAGAGGGAGGGAGG - Intergenic
1200133357 X:153863185-153863207 CTGTGTGGAGAGGAGGGGCTGGG + Intronic