ID: 1089330709

View in Genome Browser
Species Human (GRCh38)
Location 11:117687067-117687089
Sequence GTCTACATGCAGAATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089330701_1089330709 16 Left 1089330701 11:117687028-117687050 CCATCTCTGCAGAGCTGCAGACA 0: 1
1: 0
2: 1
3: 42
4: 373
Right 1089330709 11:117687067-117687089 GTCTACATGCAGAATGTGGATGG 0: 1
1: 0
2: 0
3: 11
4: 164
1089330699_1089330709 18 Left 1089330699 11:117687026-117687048 CCCCATCTCTGCAGAGCTGCAGA 0: 1
1: 1
2: 4
3: 35
4: 384
Right 1089330709 11:117687067-117687089 GTCTACATGCAGAATGTGGATGG 0: 1
1: 0
2: 0
3: 11
4: 164
1089330700_1089330709 17 Left 1089330700 11:117687027-117687049 CCCATCTCTGCAGAGCTGCAGAC 0: 1
1: 0
2: 0
3: 31
4: 277
Right 1089330709 11:117687067-117687089 GTCTACATGCAGAATGTGGATGG 0: 1
1: 0
2: 0
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089330709 Original CRISPR GTCTACATGCAGAATGTGGA TGG Intronic
900002157 1:20591-20613 GTATAAATACAGAAGGTGGAGGG + Intergenic
900021878 1:191114-191136 GTATAAATACAGAAGGTGGAGGG + Intergenic
902546526 1:17193867-17193889 GTGGGCATGGAGAATGTGGAGGG + Intergenic
904834486 1:33326107-33326129 ATTTTCAGGCAGAATGTGGAAGG + Intronic
906644208 1:47461920-47461942 AGCTACATGCAGAATGTTCAAGG - Intergenic
911124552 1:94328880-94328902 GCCTTCATGCAGCATTTGGATGG + Intergenic
913224506 1:116687168-116687190 CTCCACAGGCAGAATGGGGAGGG - Intergenic
913528799 1:119718199-119718221 GTCTAAATGCTGTATTTGGAAGG + Intronic
915328901 1:155097066-155097088 GACAACAGGCAGAATGGGGAGGG - Intergenic
916169322 1:161988727-161988749 GTCTGCAGGAAGAATGAGGAGGG - Intronic
917906012 1:179587773-179587795 GATTACATGCAGAATGTCCATGG + Intergenic
921535100 1:216339468-216339490 ATGTAAATGCAGAATGTGGGAGG + Intronic
922674022 1:227540254-227540276 AGCTACATGCAGAAGATGGATGG + Intergenic
924667425 1:246087794-246087816 GTCTTCATGTAGAATCTAGAGGG - Intronic
1065986383 10:30957272-30957294 GTTAACATCCAGAATGTGTAAGG - Intronic
1066345729 10:34584217-34584239 GTCTACATGGACAAAGAGGAAGG - Intronic
1067462702 10:46469345-46469367 GTTTACATGCAGAATGAGTCTGG - Intergenic
1067624493 10:47915292-47915314 GTTTACATGCAGAATGAGTCTGG + Intergenic
1069558380 10:69412789-69412811 GTCTCCATGCAGAAGGCAGAGGG + Intronic
1069820436 10:71224208-71224230 GTCTACATACAGAAGTGGGATGG - Intronic
1069820457 10:71224344-71224366 GTCTACATACAGAAGTGGGATGG - Intronic
1071906484 10:90179999-90180021 GCATCCATGCAGACTGTGGAAGG - Intergenic
1072043316 10:91630255-91630277 GTCTATATGAAAAATGTGTATGG - Exonic
1072482893 10:95826862-95826884 GGCTACAAGAAAAATGTGGAAGG + Intronic
1072930275 10:99656429-99656451 GTCAAGATGGAGAATATGGATGG + Intergenic
1074709924 10:116168816-116168838 ATCTGCATGCTGGATGTGGATGG - Intronic
1075265058 10:120993388-120993410 ATTTACATGCAAAATGTGCAAGG + Intergenic
1076361296 10:129890902-129890924 TTCTCCATGCAGATTGAGGATGG - Intronic
1078277118 11:9860134-9860156 GTCTTCATGCAGAGTATAGAAGG - Intronic
1078525822 11:12100574-12100596 GTCTGTTTGCAGAATGTGAAAGG + Intronic
1079774970 11:24513820-24513842 GTCTACATTCAGACTCTGAAAGG - Intronic
1079941460 11:26685717-26685739 GGCAACATGAAGAATGGGGATGG + Intronic
1083332459 11:61905326-61905348 GGCCACATGCAGAATGAGGGAGG + Intronic
1084005040 11:66318010-66318032 GGCTGCACGCAGGATGTGGAAGG + Intergenic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1085156736 11:74302478-74302500 GTGTACATGCTCAATGTGAAAGG - Exonic
1089138551 11:116268597-116268619 GTCTTAGTGCAGAATGTGTAAGG - Intergenic
1089330709 11:117687067-117687089 GTCTACATGCAGAATGTGGATGG + Intronic
1090607237 11:128433803-128433825 GTCTACATGAATGATGGGGAGGG + Intergenic
1091375222 12:20626-20648 GTATAAATACAGAAGGTGGAGGG + Intergenic
1091822847 12:3489660-3489682 GTCAACATGCAGAAAGTGGTAGG - Intronic
1092105170 12:5916308-5916330 ATGTACATGCAGAACGTGAATGG + Intronic
1093744657 12:22726376-22726398 GTCAACATGAAGAAATTGGAAGG + Intergenic
1094218254 12:27968979-27969001 GTATACATACTGAATGTGGGTGG - Intronic
1095067818 12:37803267-37803289 GTCTTCTTGTAGAATCTGGAAGG + Intergenic
1095408449 12:41894248-41894270 GTCTACATGATAAATGTGAATGG + Intergenic
1096107907 12:49008726-49008748 GTTTTCCTGCAGAATGTTGAAGG + Intronic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1098385734 12:69916692-69916714 GACTCCATCCAGATTGTGGAGGG - Intronic
1100017186 12:90025049-90025071 GTCTACCTCCAGAGTGGGGAGGG + Intergenic
1100034773 12:90236899-90236921 GTCAACAGGCAGAAAGTGGGAGG - Intergenic
1100044885 12:90367465-90367487 GTCTACATCCACCCTGTGGAAGG - Intergenic
1100235936 12:92660814-92660836 GTCTACATACAGCATATGGTTGG - Intergenic
1101387806 12:104273268-104273290 GTCTGCATGTAGAAGGTGGCAGG - Intronic
1101958983 12:109233954-109233976 GGACACATTCAGAATGTGGATGG - Exonic
1108166466 13:47698506-47698528 GTCTAGATGCAGAAATTGTATGG + Intergenic
1108344100 13:49527362-49527384 GTGGAAATGCAGAGTGTGGAGGG - Intronic
1110700183 13:78537904-78537926 GTATACTTACAGAATGTGAAGGG + Intergenic
1113315486 13:109175084-109175106 GTCTACATGCAGAGCGTAGTGGG - Intronic
1116233256 14:42245537-42245559 GTCTATATGCAAAATGTGTAAGG - Intergenic
1117751706 14:58930335-58930357 GGCTGCATGCAGTATGGGGACGG + Intergenic
1119624796 14:76163736-76163758 CCCTACATGTAAAATGTGGATGG - Intronic
1121414206 14:93767760-93767782 GTCTCCAGGCAGAATGGAGAGGG - Intronic
1122098385 14:99387864-99387886 GTCCACATGCATAATGTTGATGG + Intergenic
1126413991 15:48398991-48399013 GTAAACATGCAGAATTGGGAAGG - Intergenic
1127891082 15:63251651-63251673 CTCTACCTTCAAAATGTGGAAGG - Intronic
1129513849 15:76144514-76144536 GGCTCCATGCAGAGTGAGGAAGG + Intronic
1132853996 16:2036728-2036750 GTGAACGGGCAGAATGTGGAGGG + Exonic
1133131825 16:3680813-3680835 ATCTTCATACAGAAGGTGGAAGG - Intronic
1139281739 16:65776556-65776578 CTCTACCTCCAAAATGTGGAAGG + Intergenic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1139973189 16:70789081-70789103 GACTAAACGCAGAATGTGGTGGG + Intronic
1142145848 16:88492664-88492686 GTGGACATCCAGAAGGTGGACGG + Intronic
1203137880 16_KI270728v1_random:1740859-1740881 GTATATGTGCAGAATGTGCAGGG + Intergenic
1148481449 17:47962126-47962148 GTCTGAATGAAGAACGTGGAAGG - Intergenic
1150965902 17:69968028-69968050 GTCTACTTGCATGAAGTGGATGG - Intergenic
1152111100 17:78358249-78358271 CTCTCCCTGCAGAATGTGGCAGG - Exonic
1155039706 18:22054727-22054749 GTTTGCAAGCAGAATTTGGAGGG - Intergenic
1156978497 18:43256162-43256184 TTCTTCATGGAAAATGTGGAAGG + Intergenic
1158185913 18:54771040-54771062 GGCTCCATGCAGTATGAGGATGG + Intronic
1158505252 18:58041923-58041945 GTGTACCTCCAGGATGTGGAAGG + Intergenic
1158652921 18:59303776-59303798 GTCTACAGGGAGCATGGGGATGG - Intronic
1159573543 18:70147607-70147629 GTCTACATGGAGTTTATGGATGG + Intronic
1160633910 19:62199-62221 GTATAAATACAGAAGGTGGAGGG + Intergenic
926750244 2:16193177-16193199 GTCTACCTGCAGAGTGTTGAAGG + Intergenic
930951975 2:57154062-57154084 GTCTTCAAACAGAATGTAGAAGG + Intergenic
936120969 2:109744463-109744485 GTCTACATCCAGAATCTATAAGG - Intergenic
936223726 2:110627012-110627034 GTCTACATCCAGAATCTATAAGG + Intergenic
936567569 2:113592830-113592852 GTATAAATACAGAAGGTGGAGGG - Intergenic
943478624 2:188389768-188389790 AGCTACATCCAGAATGGGGAGGG - Intronic
944330407 2:198458787-198458809 ATTTACATGCAGAATTTAGAGGG + Intronic
945190743 2:207184972-207184994 TTCTACATGCTGACAGTGGAAGG - Intergenic
946263418 2:218516666-218516688 GGACACATGCAGAATGTGCAAGG - Intronic
947794369 2:232884952-232884974 GTTTACATGGAGGATGTGGGGGG - Intronic
947984948 2:234439941-234439963 GTCTACCAGGAGAATGTGGCTGG + Intergenic
948171696 2:235908738-235908760 GATTACATGCAGAATGTTCATGG + Exonic
948365351 2:237451018-237451040 CTCTCCATGCAGAATGTCGGTGG - Intergenic
1170614701 20:17939211-17939233 GCCTACAGGCAGAAAGCGGATGG + Intergenic
1171085310 20:22233144-22233166 TTCTACATGCTGAAGGGGGATGG + Intergenic
1172025009 20:31942645-31942667 CTCCAGATGCTGAATGTGGATGG - Intronic
1172094264 20:32453005-32453027 GTCTGCAGGCAGAACGGGGATGG + Exonic
1172839032 20:37890992-37891014 ATCTACTGGCAGAATCTGGATGG - Intergenic
1174829660 20:53800939-53800961 ATCTATTTGCAGAATCTGGAGGG + Intergenic
1177335392 21:19718401-19718423 GACTTCATGCAGAATTTGGAAGG + Intergenic
1177787883 21:25692022-25692044 ATTTACATACATAATGTGGAAGG + Intronic
1178331449 21:31697630-31697652 GTCTATAAGCAGAATGAGCACGG - Intronic
1179085011 21:38208163-38208185 GTTAACATGCAGATTGTGCAGGG + Intronic
1179641732 21:42752163-42752185 GCCTACATGGAGGCTGTGGAAGG - Intronic
1180552700 22:16553416-16553438 GTATATGTGCAGAATGTGCAGGG + Intergenic
1182748734 22:32625187-32625209 GCCCACAGGCTGAATGTGGACGG + Intronic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
954210570 3:49094602-49094624 GTATACAGGGAAAATGTGGAAGG + Intergenic
955637081 3:61042065-61042087 ATCTACATCCAGACGGTGGAAGG - Exonic
960357751 3:116674360-116674382 GTGTACATGCAGAAGGAGGTGGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964826092 3:160829649-160829671 GTCTACCTGCAGGATGAGAAGGG - Intronic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
966061890 3:175767915-175767937 GTCATCATGCAGGATTTGGAAGG - Intronic
966981953 3:185145043-185145065 GTATACACATAGAATGTGGAAGG - Intronic
967788415 3:193521992-193522014 GTCCACCTGCTGACTGTGGAGGG - Intronic
968542175 4:1173160-1173182 GTCTACATGCTGGAAGTGGCTGG + Intronic
971862149 4:32121760-32121782 GGAAACATGCAGAATGGGGAAGG - Intergenic
972224788 4:37000343-37000365 GGCTTCATGGAGAATGTGAATGG - Intergenic
972961272 4:44455123-44455145 TTATAAATGTAGAATGTGGATGG + Intergenic
974599705 4:64061840-64061862 GTCTCCATACTGTATGTGGAAGG + Intergenic
975085872 4:70339120-70339142 GACTACATGCAAAATATGGTGGG + Intergenic
982562558 4:156947999-156948021 GTCTACACACACACTGTGGATGG + Intronic
982670506 4:158314386-158314408 GACAAAATGCTGAATGTGGATGG - Intergenic
984556712 4:181222932-181222954 TTCAGCAAGCAGAATGTGGATGG + Intergenic
993803974 5:92381077-92381099 ATCTCCAAGCAGAATATGGAAGG - Intergenic
994149250 5:96429757-96429779 TTCTTCATGAAGAATGTGGATGG - Intronic
997059894 5:130488430-130488452 TTCTGCATGCAGAAAGGGGAAGG + Intergenic
1000821511 5:165990297-165990319 GTCTACATGCACACTGAGGAAGG + Intergenic
1000970728 5:167711436-167711458 GACTAGCTGCAGAATGTGGAAGG - Intronic
1005213531 6:23497572-23497594 GTCTAAATGAAGCATGTGGAAGG + Intergenic
1009034235 6:58097287-58097309 GACAAAATGCTGAATGTGGATGG + Intergenic
1009209843 6:60848988-60849010 GACAAAATGCTGAATGTGGATGG + Intergenic
1015957439 6:138613468-138613490 GTCAACATGCAGCATGGGAATGG + Intronic
1017687668 6:156929326-156929348 ATCTACACACAGAAAGTGGAGGG + Intronic
1018552379 6:165012486-165012508 ATTTTCATGCAGAATGGGGAAGG - Intergenic
1019173805 6:170149641-170149663 GTCTACCTGCAGGCAGTGGAGGG - Intergenic
1019356369 7:582045-582067 GTTTACATGGTGAATGGGGATGG - Intronic
1020890698 7:13874440-13874462 GTGTCAGTGCAGAATGTGGAAGG + Intergenic
1021971269 7:25967946-25967968 GTTTTCATGCAGATTGTGAATGG - Intergenic
1023225787 7:37967427-37967449 GACTAAATGCAGAATGAGAATGG - Intronic
1023737567 7:43248400-43248422 GTCTAGATGAAGGATGTGGTGGG - Intronic
1026827138 7:73591530-73591552 GTATGCATGCAGAGAGTGGATGG - Intergenic
1028090887 7:86699334-86699356 ATCCAGATGCAGAATCTGGATGG + Intronic
1030993020 7:116324266-116324288 GTCTACATTCAAAATCTGGGTGG - Intronic
1034731872 7:153394179-153394201 TTTTACATGCAGGATGTGTAAGG + Intergenic
1036513718 8:9423915-9423937 GTTTCCTGGCAGAATGTGGATGG + Intergenic
1036619902 8:10417859-10417881 GTCTCCGTGCAGAAGGGGGAAGG + Intronic
1037508080 8:19552639-19552661 GACGACATTCAAAATGTGGATGG + Intronic
1038829359 8:31040094-31040116 GATTAGATGCAGAATGTGAAAGG + Intronic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1040861533 8:52004442-52004464 GTCTAAATAAATAATGTGGAAGG + Intergenic
1044011432 8:86998823-86998845 ATCTACCTGTAAAATGTGGATGG - Intronic
1044299320 8:90565420-90565442 GTTTACTTGCAACATGTGGAAGG - Intergenic
1047207705 8:122816994-122817016 CTCTCCATGCAGATGGTGGATGG + Intronic
1050085157 9:1957894-1957916 GTCTACATACAGGATGGGAAAGG + Intergenic
1052659181 9:31406159-31406181 GTCAACAGGCAGCATTTGGAGGG + Intergenic
1053417882 9:37958245-37958267 CTCTGCCTGCAGAATGTGGCTGG - Intronic
1054941722 9:70750341-70750363 GACTGCATTCAGACTGTGGAGGG + Intronic
1056077739 9:83058861-83058883 TTCTACATGCACGATGTCGAAGG - Intronic
1057174195 9:92983911-92983933 GTTTACATGCAAGATGTGTAGGG - Intronic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1060946154 9:127570090-127570112 GTCAACAAGCAGAAAGTGGATGG - Intronic
1185532880 X:835728-835750 GTATATGTGCAGAATGTGCAGGG + Intergenic
1186309593 X:8303053-8303075 GTCTACATGAAGAAGGTGAGTGG - Intergenic
1186554593 X:10544408-10544430 CACTAAATGCACAATGTGGAAGG + Intronic
1189602850 X:42646359-42646381 TTCTAAATGCAGAGTGTGAAAGG + Intergenic
1195020623 X:100823544-100823566 GTGTACATACAGAATATTGAAGG - Intronic
1199363438 X:146949242-146949264 TTTTAAATGCAGAATTTGGAGGG - Intergenic
1199730323 X:150625704-150625726 AGCTTCATGCAGAATGTGAAAGG - Intronic
1201613260 Y:15866640-15866662 CTCAAAATGCAGTATGTGGATGG + Intergenic
1202603563 Y:26618947-26618969 AACTCCATGCAGAATGTGGCAGG + Intergenic