ID: 1089331082

View in Genome Browser
Species Human (GRCh38)
Location 11:117689500-117689522
Sequence CAGGGTATGAAACGTGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089331082 Original CRISPR CAGGGTATGAAACGTGTTTC TGG Intronic
907578753 1:55552927-55552949 AAGGGTAGGAAACTTATTTCAGG + Intergenic
907862179 1:58364131-58364153 CAGTGTATTAAAGGTGTGTCTGG - Intronic
910378631 1:86600887-86600909 AAGGGTATGAAAATTTTTTCTGG - Intergenic
910432106 1:87168935-87168957 CAGGGTGTTAAACATTTTTCAGG - Exonic
914721566 1:150293665-150293687 GAGGGCGAGAAACGTGTTTCGGG + Intergenic
915970940 1:160354682-160354704 CAGAGTATGAATACTGTTTCTGG - Intronic
919750148 1:201032593-201032615 CAGGGTGTGCAAAGGGTTTCAGG + Intergenic
921251620 1:213303563-213303585 CAGGGTACGGAACGTGCTTGGGG - Intergenic
1063010000 10:2012377-2012399 CAGGGAATGGAGGGTGTTTCTGG + Intergenic
1068058799 10:52040340-52040362 CAGATTATGAAATGTGTTACAGG - Intronic
1068107397 10:52635871-52635893 CAGGGTATGAAATATTTTTATGG - Intergenic
1068189506 10:53632696-53632718 CAGGGTATGGCAAGTATTTCAGG - Intergenic
1072431592 10:95376980-95377002 CATGGAATAACACGTGTTTCTGG + Intronic
1074649335 10:115501380-115501402 CAGGTTATGAACCCTGTTACAGG + Intronic
1079460183 11:20671495-20671517 CACGGAATGGAACGTGTTTCAGG + Intronic
1084488658 11:69465738-69465760 CTGGGCATGAAAAGTTTTTCAGG + Intergenic
1084628123 11:70324599-70324621 AAAGGTATGAAAAGTATTTCAGG - Intronic
1084956810 11:72695981-72696003 CAGGGTAGGAACAGTTTTTCTGG + Intronic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089634535 11:119803863-119803885 CAGGGAAGGAAAGGTGTTTCTGG - Intergenic
1093371087 12:18365903-18365925 TAGGGTCTGAAACGAGATTCAGG - Intronic
1094739028 12:33267622-33267644 CAGGTTATGAGATGTTTTTCAGG - Intergenic
1099353138 12:81598500-81598522 CAGTATATGAAACATGCTTCAGG - Intronic
1100023726 12:90102213-90102235 AAGGTTAGGAAAGGTGTTTCTGG - Intergenic
1101665728 12:106811769-106811791 GAAGGTATGAAAGGTGTTTGAGG + Intronic
1102868316 12:116392077-116392099 CAGGGTTTAAAAGGTATTTCTGG - Intergenic
1105539641 13:21304424-21304446 CAGGGTATGAAACCTCCTTTTGG - Intergenic
1105798699 13:23883805-23883827 CAGGGTATGAAACCTCCTTTTGG + Intronic
1106774872 13:32999173-32999195 CAGGGTATGACACGGGAGTCTGG + Intergenic
1119332087 14:73802520-73802542 TAGGGTATGAGCCCTGTTTCCGG + Intergenic
1121599346 14:95191551-95191573 CAGGCTCTGATACGTGTGTCTGG - Exonic
1121827780 14:97024817-97024839 CAGGGCATGCAACTTGGTTCAGG - Intergenic
1125497127 15:40207221-40207243 CAGGGTCTGACACTTGTTTTAGG + Intronic
1132474762 16:128914-128936 AAGGGTATGAACCCTGTATCTGG + Intronic
1133814431 16:9185635-9185657 CAGGTTCAGAAACATGTTTCAGG - Intergenic
1142726525 17:1818992-1819014 CAGAATGTGAAACGTTTTTCTGG - Intronic
1146266914 17:31458791-31458813 CAGGGTGTGAAACACGTTTGGGG + Intronic
1147038946 17:37702378-37702400 CAGGGGATGAATCCTGCTTCTGG + Intronic
1165428963 19:35761130-35761152 CAGGGTATGAAATGTGATTTTGG - Intronic
927835197 2:26391476-26391498 CAAAGTATGAAAGGTCTTTCAGG + Exonic
929162567 2:38847316-38847338 GAGGGTATGAAAGGTGTAACAGG - Intronic
932844789 2:75124021-75124043 CAGTCAATGAAACGTCTTTCTGG + Intronic
942334135 2:174862788-174862810 CAAGATATGAAAGGTATTTCTGG + Intronic
948069426 2:235107606-235107628 CAGGGTCTGAAATTTGTCTCTGG + Intergenic
1170286221 20:14712465-14712487 CAGGGCATTCAACGTGTATCAGG - Intronic
1173417288 20:42868166-42868188 CAGAGTATTAAGGGTGTTTCTGG + Intronic
1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG + Intronic
949775170 3:7624696-7624718 CAGGGTATGAAGCATGTTAGGGG + Intronic
950643100 3:14360918-14360940 CAGGGTTAGAAATGTGTTCCAGG + Intergenic
950838995 3:15948751-15948773 CTGGTTATGAAACATGTGTCTGG - Intergenic
951695164 3:25438744-25438766 TAGGGCATGAAACATTTTTCAGG - Intronic
959671765 3:108986396-108986418 CAGGGGATGTAATGTGTCTCAGG - Intronic
959916264 3:111819936-111819958 CATGGTATGAAATGTCTTGCAGG + Intronic
963557849 3:146816936-146816958 CAGAGTACAAAACGTATTTCAGG + Intergenic
966976379 3:185087106-185087128 CAAGGATTGAAACGGGTTTCTGG + Intronic
976768154 4:88620365-88620387 CAGGGTAAGAAACAGGTTTAAGG - Intronic
980429872 4:132680323-132680345 CAGGGTATGAAGACTGATTCTGG + Intergenic
985882726 5:2652549-2652571 GAGGGCATGAAACGTCCTTCAGG - Intergenic
990517072 5:56540234-56540256 CAGGGTAATAAACATTTTTCAGG + Intronic
996282345 5:121745773-121745795 CAGGGAATGAAGCATGTTTGGGG + Intergenic
1000827577 5:166065085-166065107 CATGATATGAAGTGTGTTTCTGG - Intergenic
1004857050 6:19761930-19761952 CAGGGGATGAATCCTGTTTCAGG - Intergenic
1006928034 6:37669599-37669621 CAGGGTCAGAAACATGGTTCTGG - Intronic
1011085719 6:83538230-83538252 CAGTGTATGAAACATCTTTGGGG - Intergenic
1011247700 6:85336938-85336960 TAGGGTATGAGACATGTATCAGG + Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1017540548 6:155398004-155398026 CAGGGTTTCAAAGTTGTTTCTGG + Intronic
1019005366 6:168792316-168792338 AAGGCTCTGAAAGGTGTTTCTGG + Intergenic
1032357883 7:131227132-131227154 CAGGGAAAGAAACGGGTTACAGG - Intronic
1032786937 7:135208430-135208452 CTGTGCATGAAACGTGTTCCCGG - Intronic
1034671144 7:152859324-152859346 CTTGGTATGTAACGTGTTCCAGG + Intergenic
1034702669 7:153109870-153109892 CAGGGTTTTTAATGTGTTTCAGG - Intergenic
1036061332 8:5324710-5324732 CAGTGTATGAAAAATGTTACAGG - Intergenic
1050348008 9:4712154-4712176 CAGGTTAAGAAATGTGTTTTAGG - Exonic
1050584075 9:7091891-7091913 CAGGGTCTGAGACCTGTGTCAGG - Intergenic
1050718028 9:8552384-8552406 CAGAGTATGACATGTGTTTTTGG + Intronic
1050891897 9:10835209-10835231 CAGGGTCTGAAACATGGTTCAGG - Intergenic
1056046476 9:82722794-82722816 CAGGCTATGAAACAAGATTCTGG + Intergenic
1058859120 9:109097232-109097254 CAGGGGTAGAAAAGTGTTTCAGG + Intronic
1188347355 X:29083434-29083456 CTGGCCATGAAATGTGTTTCAGG - Intronic
1189540688 X:41984849-41984871 CAGGCTATAAAACCGGTTTCAGG - Intergenic
1194176740 X:90659606-90659628 CAGCATATGGAACATGTTTCTGG - Intergenic
1195087038 X:101422508-101422530 CAGGGTCTGAAAAGTATCTCAGG + Intronic
1195978522 X:110553788-110553810 CAGGGGATGAAACGAGTGTCTGG + Intergenic
1201017668 Y:9622636-9622658 CAGTATTTGAAACATGTTTCAGG - Intergenic