ID: 1089333354

View in Genome Browser
Species Human (GRCh38)
Location 11:117705543-117705565
Sequence ATTCCAGGCCACTCCCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089333354_1089333358 -3 Left 1089333354 11:117705543-117705565 CCACTGTGGGAGTGGCCTGGAAT 0: 1
1: 0
2: 1
3: 26
4: 200
Right 1089333358 11:117705563-117705585 AATTACCTCTGGCTATGAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 118
1089333354_1089333357 -4 Left 1089333354 11:117705543-117705565 CCACTGTGGGAGTGGCCTGGAAT 0: 1
1: 0
2: 1
3: 26
4: 200
Right 1089333357 11:117705562-117705584 GAATTACCTCTGGCTATGAGTGG 0: 1
1: 0
2: 0
3: 5
4: 88
1089333354_1089333360 7 Left 1089333354 11:117705543-117705565 CCACTGTGGGAGTGGCCTGGAAT 0: 1
1: 0
2: 1
3: 26
4: 200
Right 1089333360 11:117705573-117705595 GGCTATGAGTGGGAAAATTGAGG 0: 1
1: 0
2: 2
3: 14
4: 192
1089333354_1089333361 30 Left 1089333354 11:117705543-117705565 CCACTGTGGGAGTGGCCTGGAAT 0: 1
1: 0
2: 1
3: 26
4: 200
Right 1089333361 11:117705596-117705618 CTCAGAAAGAGAGACCAGTACGG 0: 1
1: 0
2: 1
3: 28
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089333354 Original CRISPR ATTCCAGGCCACTCCCACAG TGG (reversed) Intronic
900101390 1:963626-963648 ACCCCAGGCCACTGCCACACTGG + Intronic
900197955 1:1386909-1386931 ATGCCAGGCCACGCCAACAAGGG + Exonic
903664208 1:24996650-24996672 ATTCCAGGTGACCCCCACAAGGG + Intergenic
904733311 1:32611511-32611533 ATCCCAGGCCTCTCCGACGGGGG - Intronic
905065278 1:35175743-35175765 ATTCCAAGACCCCCCCACAGTGG + Intergenic
906130032 1:43450474-43450496 GGTCCAGTCCACTCCCTCAGAGG - Exonic
906933324 1:50190245-50190267 ACTCCAGGCCACTGGCCCAGGGG + Intronic
907679585 1:56550874-56550896 TTTCAAGGCCACTTCCACAAAGG - Intronic
908083927 1:60610297-60610319 ATTTCAGAGCACTCCCAGAGAGG - Intergenic
909448908 1:75777092-75777114 ATTACAGGCCATTACCACACTGG - Intronic
912252160 1:108022278-108022300 TTTCCTGGCAACTGCCACAGCGG + Intergenic
916720603 1:167482430-167482452 ACTCCACCCCACCCCCACAGAGG - Intronic
917927653 1:179802646-179802668 GTACCAGGTCACTCCCTCAGTGG + Intronic
918294624 1:183144686-183144708 ATTCCTGGCTAGTCCCACTGTGG - Exonic
919309871 1:195894013-195894035 CATCCAGGCCACCCCAACAGAGG - Intergenic
920898924 1:210087213-210087235 ACTCCAGGCCACCCTCACACTGG + Intronic
921913306 1:220576479-220576501 TTTCCAGGACCCTCCCACTGAGG - Intronic
924230551 1:241958593-241958615 ATTCCAGCCCACACGGACAGTGG - Intergenic
924233285 1:241979914-241979936 AATACAGGCCAGTTCCACAGAGG + Intergenic
924571380 1:245240763-245240785 CTTCCAGCTCCCTCCCACAGCGG - Intronic
1066358937 10:34712021-34712043 ATTCCTGGCCAGTCACACTGGGG - Intronic
1067123683 10:43496932-43496954 ATTCTAGGCCACTTTTACAGTGG - Intergenic
1067346671 10:45443031-45443053 ACTCCAGGCCAACGCCACAGGGG + Exonic
1067431545 10:46249084-46249106 CTGCCAGGCCCCTCCCCCAGGGG - Intergenic
1067441869 10:46313090-46313112 CTGCCAGGCCCCTCCCCCAGAGG + Intronic
1072108590 10:92296762-92296784 CTTCCAGCCCCCTCCCACAATGG + Intronic
1072540859 10:96397075-96397097 ACTCCAGGCCAGAGCCACAGGGG - Intronic
1072624721 10:97103904-97103926 ATGACAGGCAACTCCCACGGCGG + Intronic
1075234499 10:120714611-120714633 ATTCCAAGTCACTCCCACACGGG + Intergenic
1076817851 10:132923390-132923412 GTTCCAGGGCACCCCCACATGGG - Intronic
1076830682 10:132992759-132992781 ATCCCTGGCCACCCCCACTGAGG + Intergenic
1079176133 11:18142876-18142898 ATTCTAGGTCACTGCCACATAGG - Intronic
1079179632 11:18178595-18178617 ATTCTAGGTCACTGCCACATAGG - Intronic
1082017568 11:47502851-47502873 ATTCCAGGCTTTTCCCACAAAGG + Intronic
1083247262 11:61438693-61438715 ATTCCACTCCATTCCCAGAGTGG - Intronic
1083367611 11:62150893-62150915 ATTCCAGGCCCTTCCCTCTGGGG - Intronic
1084673738 11:70622417-70622439 AGCCCAGGACACTCGCACAGAGG - Intronic
1089162817 11:116452572-116452594 ATGCCAGGCCACATGCACAGAGG - Intergenic
1089333354 11:117705543-117705565 ATTCCAGGCCACTCCCACAGTGG - Intronic
1091656685 12:2351408-2351430 ATTCCAGGCCGCTTCAGCAGAGG - Intronic
1091762725 12:3097712-3097734 TTACCAGGCAACTCCCCCAGAGG - Intronic
1100048589 12:90415204-90415226 CTTACAGGCCACTCTCACACAGG - Intergenic
1100424633 12:94472848-94472870 ATCCCTGGCCTCTCCCACAAAGG - Intergenic
1101711914 12:107275646-107275668 AATCCAGGCCTCTCCTACAGGGG + Intergenic
1102577446 12:113864882-113864904 AGTCATCGCCACTCCCACAGTGG + Intronic
1103024680 12:117563905-117563927 ATCCCAGGCCACACCAATAGAGG - Intronic
1104917974 12:132275909-132275931 ATCCCAGGCCACCCGCACAGTGG + Intronic
1106439805 13:29756095-29756117 ACTCCAGGGCATTCTCACAGTGG + Intergenic
1106944298 13:34809598-34809620 ATACCAGGCCAGTCCCAAAAGGG - Intergenic
1112687955 13:101853288-101853310 TTTCCTTGCCACTCCCAAAGGGG - Intronic
1113395630 13:109944998-109945020 CTTCCAGGGCACTCCAACAAGGG + Intergenic
1115404136 14:32996564-32996586 TATCCCAGCCACTCCCACAGTGG + Intronic
1115529195 14:34311150-34311172 CTTCCAGGCCATCCCCACAAAGG - Intronic
1117581280 14:57153933-57153955 CTTCCAGGCCACTGGGACAGTGG - Intergenic
1118182451 14:63507117-63507139 ATCCCAGGCCACTGCTGCAGGGG + Intronic
1120246336 14:82011307-82011329 CTGCCTGGCCATTCCCACAGGGG + Intergenic
1121583621 14:95048304-95048326 ATTCCATCCCACACCCACTGAGG + Intergenic
1121788482 14:96680859-96680881 TTTCCAGGCCACACCCTCTGGGG - Intergenic
1122849852 14:104522264-104522286 ATTCTATGCCGCTGCCACAGTGG - Intronic
1122971487 14:105154052-105154074 TTTCCCGGCCAGTCCCAGAGCGG - Intronic
1202886051 14_KI270722v1_random:108190-108212 ATTCCAGAACACTCCTACTGTGG - Intergenic
1202886399 14_KI270722v1_random:111431-111453 ATTCCAGAACACTCCCGCTGTGG - Intergenic
1202886435 14_KI270722v1_random:111813-111835 ATTCCAGAACACTCCTGCAGTGG - Intergenic
1202886447 14_KI270722v1_random:111957-111979 ATTCCAGGACACTCCTGCTGTGG - Intergenic
1202887075 14_KI270722v1_random:117873-117895 ATTCCAGAACACTCCTACTGTGG - Intergenic
1202887566 14_KI270722v1_random:122171-122193 ATTCCAGGCCACTCCTGCTGTGG - Intergenic
1123629669 15:22253026-22253048 ACCCCAGGCCATTCCCACTGGGG + Intergenic
1125318551 15:38458186-38458208 TTTCCAGGCCAGTACCCCAGTGG - Intronic
1126547713 15:49890850-49890872 ATGCCAGGCCACTCCCATGTGGG + Intronic
1130297031 15:82654662-82654684 ATACCCTGCCCCTCCCACAGAGG + Intergenic
1131769157 15:95716206-95716228 AAGCCAGGCCATTCACACAGGGG + Intergenic
1131776988 15:95813638-95813660 ATTCCAGAAACCTCCCACAGTGG + Intergenic
1132425098 15:101709458-101709480 ACACCAGGACAGTCCCACAGAGG + Intronic
1132484185 16:181615-181637 ATTCCAGGCCACAGCCGCGGCGG - Intergenic
1134440333 16:14295979-14296001 ATTCCAGGCCACAGGCACAGTGG - Intergenic
1134607588 16:15583288-15583310 ATTTCAGGCCAGGCCCACAGTGG + Intronic
1134862038 16:17568766-17568788 GTTCCTGGCCACTCCCAGAGGGG - Intergenic
1137537793 16:49340602-49340624 ATTCCAGGCCTCACCCTCCGAGG - Intergenic
1137831390 16:51546497-51546519 ATACCAGGGAGCTCCCACAGAGG + Intergenic
1138355309 16:56373090-56373112 ATTCCAGGGCACTCAGGCAGAGG + Intronic
1139713023 16:68790908-68790930 TTTCCAGGCCTCTCCCAGAGAGG - Intronic
1140209259 16:72958222-72958244 ACTCCACGCCACTCCCCGAGGGG + Exonic
1141644744 16:85361461-85361483 TTTCCAGGCCACGGCCTCAGGGG + Intergenic
1147422351 17:40328166-40328188 ATTCCTGGCCTCTTCCACAGTGG + Intronic
1148928426 17:51107962-51107984 ATTCCAGGCCTATACCCCAGAGG + Intronic
1149657703 17:58319057-58319079 ATTCCAGGCCAATGCCACTGGGG + Intronic
1149661223 17:58335000-58335022 GAGCCAGGCCACTCTCACAGAGG - Intergenic
1152687209 17:81700570-81700592 CTACCAGCCTACTCCCACAGCGG + Exonic
1203156694 17_GL000205v2_random:10727-10749 ATTCCAGAACACTCCTACCGGGG - Intergenic
1203157671 17_GL000205v2_random:19876-19898 ATTCCAGGACACTCCTGCTGTGG - Intergenic
1203158723 17_GL000205v2_random:29551-29573 ATTCCAGAGCACTGCTACAGGGG - Intergenic
1203159314 17_GL000205v2_random:34578-34600 ATTCCAGAACACTCCTGCAGTGG - Intergenic
1203159389 17_GL000205v2_random:35250-35272 ATTCCAGAACACTCCTACGGGGG - Intergenic
1154492069 18:14930206-14930228 ATCCCAGGCCAGTCCCTGAGAGG + Intergenic
1156866072 18:41890187-41890209 ACTCCAGTCCATTTCCACAGTGG + Intergenic
1156995846 18:43465842-43465864 ATTTCAGGCCACTGCCCCAGAGG - Intergenic
1158750055 18:60248212-60248234 AACCCAGGGCACTCCCATAGGGG - Intergenic
1160120814 18:76129198-76129220 ATGCCATGCCATGCCCACAGAGG - Intergenic
1163183123 19:15617993-15618015 CTTGCAGGTCACTCCCACAGAGG + Exonic
1163857405 19:19715344-19715366 ACTCCAGGCCACTACTGCAGTGG + Intronic
1168699434 19:58427828-58427850 AATCTTGGCCACTCACACAGAGG + Intergenic
1202661435 1_KI270708v1_random:75022-75044 ATTCCAGAACACTCCTACTGTGG - Intergenic
1202661656 1_KI270708v1_random:77063-77085 ATTCCAGGACACTCCTGCTGTGG - Intergenic
1202661868 1_KI270708v1_random:78925-78947 ATTCCAGAACACTCCCGCTGTGG - Intergenic
1202661904 1_KI270708v1_random:79307-79329 ATTCCAGAACACTCCTGCAGTGG - Intergenic
1202661917 1_KI270708v1_random:79451-79473 ATTCCAGGACACTCCTGCTGTGG - Intergenic
1202662499 1_KI270708v1_random:84818-84840 ATTCCAGAACACTCCTACTGTGG - Intergenic
1202662972 1_KI270708v1_random:89015-89037 ATTCCAGGCCACTCCTGCTGTGG - Intergenic
925637060 2:5950854-5950876 AATCCAGGCCACACCCATACAGG - Intergenic
926730768 2:16034064-16034086 TTACCAGGCCACTCACACAGAGG + Intergenic
926752149 2:16206385-16206407 ATTGCTGGCCACCACCACAGGGG + Intergenic
926904361 2:17792231-17792253 ATTCCAGGAAAGTCCCACAGAGG - Intronic
930163807 2:48184010-48184032 ATTGCAGGCCATTCCCACCCTGG + Intergenic
930744761 2:54870810-54870832 AATCCAGGCCACTCCTACAGAGG - Intronic
932362167 2:71118190-71118212 ATACCAGGCCACTCCCTGCGAGG + Intronic
932605614 2:73163441-73163463 ATGCCATGCCACCTCCACAGAGG + Intergenic
933035975 2:77398875-77398897 ATTCATGGCCCATCCCACAGGGG + Intronic
933740624 2:85531149-85531171 ACACCAGGCCACGCCCACAAGGG + Intergenic
933781826 2:85807860-85807882 ATTCCAGGCCTCTGCCTCAGTGG + Intergenic
934034564 2:88078094-88078116 ATTCCAGGCAGCTGCCAGAGAGG - Intronic
934106297 2:88698025-88698047 ATTCCTGGCCAATCCCAGGGAGG - Intronic
936125860 2:109788757-109788779 ATACCTGTCCACCCCCACAGGGG + Intergenic
936218833 2:110582711-110582733 ATACCTGTCCACCCCCACAGGGG - Intergenic
936258054 2:110934389-110934411 ACTCCAGACCACACCCCCAGAGG + Intronic
939596475 2:144130138-144130160 TTTCCCAGCCACCCCCACAGGGG + Intronic
940048369 2:149434687-149434709 GTTCCCATCCACTCCCACAGAGG + Intronic
940249607 2:151660191-151660213 AGTCTTGGCCAGTCCCACAGAGG - Intronic
943717718 2:191170484-191170506 ATTCCAGGACACTTACACAGTGG + Intergenic
946544231 2:220718957-220718979 ATTCCATGTCACTCCCACTCAGG - Intergenic
1169269968 20:4191665-4191687 ATTCCAGTGCACTCACACAATGG + Intergenic
1172166458 20:32902723-32902745 ATGCCAGGCCCCACCCGCAGAGG - Intronic
1174089811 20:48037936-48037958 TTTCCAGGCCACACACACACAGG - Intergenic
1175322585 20:58099857-58099879 ATCCCAGGCAACTCCAGCAGGGG - Intergenic
1175484352 20:59334631-59334653 ATTTCAAACCTCTCCCACAGGGG - Intergenic
1180329312 22:11462361-11462383 ATTCCAGAACACTCCTACTGTGG - Intergenic
1180439988 22:15355712-15355734 ATTCCAGGACACTACCATAAGGG - Intergenic
1180440177 22:15357388-15357410 ATTCCAGGACACTACTACAAGGG - Intergenic
1180736506 22:18021756-18021778 CTTCCTGGCCACTCCCTCAGTGG + Intronic
1181825929 22:25515694-25515716 TTTCCATTCCACTCCCCCAGTGG - Intergenic
1182430654 22:30297086-30297108 ATGCTAGGACACTCCCACTGAGG - Intronic
1183779685 22:39990797-39990819 ATACCATGCCACTCACAGAGAGG - Intergenic
1184308776 22:43627753-43627775 GTTACAGGCTCCTCCCACAGAGG + Intronic
1184578823 22:45398242-45398264 GTTGCAAGCCACTTCCACAGTGG - Intronic
949862134 3:8515592-8515614 GTTCCAGGGCACACCCAAAGGGG - Intronic
950484414 3:13264578-13264600 ATGCCAAGCCAGTCCCCCAGGGG - Intergenic
954160026 3:48714529-48714551 ATTCCAGGCACCTGCCACAGAGG + Intronic
955060580 3:55488798-55488820 ATCCCAGACCGCTCCCACTGGGG + Intronic
955373946 3:58378342-58378364 ATCCCAGGGCACTCACCCAGAGG + Intronic
956540705 3:70335579-70335601 ATAGCAGGACAATCCCACAGTGG - Intergenic
957092880 3:75749559-75749581 ATTCCAGAACACTGCCACAAGGG + Intronic
957092985 3:75750420-75750442 ATTCCAGAACACTCCTACTGTGG + Intronic
957093054 3:75750946-75750968 ATTCCAGAACACTCCTACTGTGG + Intronic
957093060 3:75750994-75751016 ATTCCAGAACACTCCTACTGTGG + Intronic
957755365 3:84478129-84478151 ATTCCAGGCAACTGCCACAATGG - Intergenic
959303489 3:104631336-104631358 ATCTCAGGCCACTGCTACAGAGG - Intergenic
959525405 3:107371351-107371373 ATTCTCGGGCAATCCCACAGAGG + Intergenic
960022735 3:112973863-112973885 AAACCAGGACACCCCCACAGTGG + Intronic
962854182 3:139329416-139329438 CTTCCGGGCCACGCCCTCAGTGG - Intronic
963755906 3:149235037-149235059 GCTCCATGCCACTCCCACATGGG - Intergenic
965338178 3:167454031-167454053 ATTCCAGGCAATTCCCAATGAGG + Intronic
967443219 3:189533424-189533446 TTTCCAGGGCCCTTCCACAGAGG + Intergenic
969860868 4:10034381-10034403 ATTCCATGCTGCTCCCCCAGGGG - Intronic
969967714 4:11014198-11014220 ATTTCAGGCCAGCTCCACAGTGG + Intergenic
970442048 4:16089503-16089525 TTTTCAGGCCACTGCCACATTGG + Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
973969185 4:56194194-56194216 ATTTCAGACCAATCCAACAGCGG + Intronic
975138788 4:70900100-70900122 ATTCCAGGCAACTCTCCTAGTGG + Intergenic
977929634 4:102737085-102737107 ATTCCTGGCCTATCTCACAGAGG + Intronic
978446076 4:108781293-108781315 ACTCCAGTCCACTCCCAGACAGG + Intergenic
979575969 4:122293260-122293282 AGTCCAGGACTCTCACACAGAGG + Intronic
982309987 4:153974700-153974722 ATTTCAGGCCACTGCTCCAGAGG + Intergenic
1202761848 4_GL000008v2_random:119531-119553 ATTCCAGACCACTGCTACTGGGG - Intergenic
992231746 5:74670770-74670792 GTTGCAAACCACTCCCACAGTGG - Intronic
997210869 5:132075957-132075979 GGTCCAGGCCACTCCCACCATGG - Exonic
999782124 5:154858173-154858195 TTTCCAGGCCGCGCCCACGGCGG + Intronic
1001418956 5:171572379-171572401 ATTCAAGGCCACTCCCAAACTGG - Intergenic
1003389786 6:5703799-5703821 ATCCCAGAGCTCTCCCACAGAGG + Intronic
1003617257 6:7666959-7666981 ACTCCAGGCCAATCACACATAGG - Intergenic
1005790114 6:29291179-29291201 TGTCCAGTCCACTCTCACAGTGG + Intergenic
1007877850 6:45126686-45126708 ATTCCAGGCTTCTCCCTTAGAGG - Intronic
1015773623 6:136792587-136792609 CTTCCTGGCCCCTCCCAGAGCGG - Intergenic
1018480437 6:164184186-164184208 ATTCCTGGCCACTTGGACAGTGG - Intergenic
1019002262 6:168764046-168764068 AGTTCAGGCCACTCCTCCAGAGG - Intergenic
1027476232 7:78634937-78634959 ATTCCAGACCACTCCTCCAAAGG + Intronic
1029282124 7:99442291-99442313 ATTCCAGCACACTCCGACTGTGG + Intronic
1030944210 7:115695858-115695880 ATCCCAGGCCACTCCTTCAAGGG - Intergenic
1035518398 8:255939-255961 AGTGCAGGCCCCTCCCACTGCGG - Intergenic
1035739512 8:1915565-1915587 CTTTCAGGACAGTCCCACAGTGG + Intronic
1037897570 8:22668480-22668502 AAACCAGTCCAATCCCACAGTGG + Intronic
1039774104 8:40718930-40718952 ATTCCAGGTCAGTGCCACAGGGG - Intronic
1040489362 8:47905629-47905651 ATTCAAAGCCAGTACCACAGGGG + Intronic
1044256130 8:90064510-90064532 ATGTCAGGCCAATCCAACAGAGG + Intronic
1047231584 8:123002290-123002312 ACTCCCGGCCCCTCCCACAAAGG + Intergenic
1049048860 8:140175370-140175392 TTTCCAGGCTTCTACCACAGAGG + Intronic
1049440201 8:142606131-142606153 AGTCCAGGTCCCTCCCACAAGGG - Intergenic
1049452049 8:142667261-142667283 ATTCCAGGCCTCTTCCAGAGGGG + Intronic
1050144410 9:2550774-2550796 ACCCCAGGCCACCTCCACAGTGG - Intergenic
1053719471 9:40930838-40930860 ATTCCAGACCACTGCTACAAGGG + Intergenic
1054075302 9:60523327-60523349 ATTCCAGACCACTGCTACAAGGG - Intergenic
1054075671 9:60526629-60526651 ATTCCAGAACACTCCTACAAGGG - Intergenic
1054716827 9:68564936-68564958 ATTACAGCCCAATCCCACAAAGG + Intergenic
1056426795 9:86485435-86485457 ATTTCAGGCCACTGCCCCAAAGG + Intergenic
1058302984 9:103399000-103399022 CTGCTAGGCCATTCCCACAGAGG - Intergenic
1059194181 9:112355195-112355217 ATTCCAGGCCCCACTCACAGGGG - Intergenic
1061101045 9:128492605-128492627 CTACCAGGCCACTCCCAGGGAGG + Intronic
1062485551 9:136773374-136773396 TTTCCAGGCCACTCCCGAACTGG - Intergenic
1062574031 9:137198307-137198329 ATTCCAGGCCACTGGCCAAGAGG + Intronic
1203455452 Un_GL000219v1:163077-163099 ATTCCAGAACACTGCCACAAGGG - Intergenic
1203457130 Un_GL000219v1:178791-178813 ATTCCAGAACACTGCTACAGAGG - Intergenic
1203484343 Un_GL000224v1:38495-38517 ATTCCAGAACACTGCCACAAGGG - Intergenic
1203493035 Un_GL000224v1:124738-124760 ACTCCAGGACACTCCTACTGTGG + Intergenic
1203493852 Un_GL000224v1:132285-132307 ATTCCAGAACACTCCTACAGTGG + Intergenic
1203495353 Un_GL000224v1:146134-146156 ATTCCAGAACACTCCTACTGTGG + Intergenic
1203495966 Un_GL000224v1:151854-151876 ATTCCAGAACACTCCTACTGTGG - Intergenic
1203496285 Un_GL000224v1:154582-154604 ATTCCAGAACACTCCCGCTGTGG - Intergenic
1203496495 Un_GL000224v1:156446-156468 ATTCCAGAACACTCCTACTGTGG - Intergenic
1203496968 Un_GL000224v1:160951-160973 ATTCCAGAACACTCCTGCAGCGG - Intergenic
1203505656 Un_KI270741v1:66609-66631 ACTCCAGGACACTCCTACTGTGG + Intergenic
1203506472 Un_KI270741v1:74160-74182 ATTCCAGAACACTCCTACAGTGG + Intergenic
1203507979 Un_KI270741v1:88057-88079 ATTCCAGAACACTCCTACTGTGG + Intergenic
1203508590 Un_KI270741v1:93777-93799 ATTCCAGAACACTCCTACTGTGG - Intergenic
1203508907 Un_KI270741v1:96504-96526 ATTCCAGAACACTCCCGCTGTGG - Intergenic
1203509119 Un_KI270741v1:98368-98390 ATTCCAGAACACTCCTACTGTGG - Intergenic
1203509591 Un_KI270741v1:102872-102894 ATTCCAGAACACTCCTGCAGTGG - Intergenic
1203542616 Un_KI270743v1:104412-104434 ATTCCAGACCACTGCTACTGGGG - Intergenic
1187227343 X:17386293-17386315 TTTCCAGGCCATTCCCACTCTGG + Intronic
1187831929 X:23391041-23391063 TTTCCAGGCCACTGCAACATTGG - Intronic
1200297264 X:154933010-154933032 ATACCAGGCCCCTCTCAGAGGGG - Intronic