ID: 1089333842

View in Genome Browser
Species Human (GRCh38)
Location 11:117709146-117709168
Sequence CAGGGTCACACATTGAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089333842_1089333847 12 Left 1089333842 11:117709146-117709168 CCTAGTTTCAATGTGTGACCCTG 0: 1
1: 0
2: 2
3: 17
4: 205
Right 1089333847 11:117709181-117709203 TATCATGAAACAAGTGTGCATGG 0: 1
1: 0
2: 2
3: 26
4: 211
1089333842_1089333848 13 Left 1089333842 11:117709146-117709168 CCTAGTTTCAATGTGTGACCCTG 0: 1
1: 0
2: 2
3: 17
4: 205
Right 1089333848 11:117709182-117709204 ATCATGAAACAAGTGTGCATGGG 0: 1
1: 0
2: 0
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089333842 Original CRISPR CAGGGTCACACATTGAAACT AGG (reversed) Intronic
904084058 1:27891452-27891474 CAGTGTAACATAGTGAAACTTGG - Intergenic
905434213 1:37945938-37945960 CAAGGCCACACAGTGAATCTGGG - Intronic
906148278 1:43572812-43572834 TGGGGTCACACATCGAGACTCGG + Intronic
910800284 1:91138346-91138368 CAGGGCCAAACTTAGAAACTTGG + Intergenic
911480141 1:98428648-98428670 CAAAGCCAAACATTGAAACTGGG + Intergenic
912145959 1:106794845-106794867 CAGGGTCAGAGATGGAAACCTGG - Intergenic
912321276 1:108715941-108715963 CAGTATCACAGAATGAAACTCGG - Intronic
914425703 1:147573578-147573600 CAGGGTCAGAAATTGAACCCCGG - Intronic
914794017 1:150905166-150905188 CTGGGTAACAGAATGAAACTCGG - Intergenic
918372977 1:183880513-183880535 CAGGGGCACCCCTGGAAACTTGG - Intronic
918422506 1:184378287-184378309 CTGGGTGACAGAGTGAAACTCGG + Intergenic
919297132 1:195717180-195717202 CAGGGTCACAGGTTGAGACAAGG + Intergenic
920278430 1:204825787-204825809 CAGTGTCACACATTGTTCCTGGG - Intergenic
924522614 1:244818238-244818260 TAGGGTCAAACATTAAAATTGGG + Intergenic
1063148479 10:3317670-3317692 CTGGGTGACAGAGTGAAACTTGG + Intergenic
1063189159 10:3678050-3678072 TAGGGTCACACATATAAGCTTGG + Intergenic
1065943161 10:30583322-30583344 CTGGGTGACAGAGTGAAACTGGG - Intergenic
1066959342 10:42205987-42206009 CAGGGTGACATAATGAGACTTGG - Intergenic
1068213843 10:53957000-53957022 CAAGGTCATAAATTGAAACAGGG - Intronic
1068804815 10:61183556-61183578 TATGGTCACACATTGCTACTGGG - Intergenic
1069465996 10:68639649-68639671 CTGGGTGACATAGTGAAACTCGG - Intronic
1070922131 10:80194650-80194672 CAGGCGCACTCATTGAAAATAGG - Intronic
1072712133 10:97722751-97722773 CTGGGTGACAGAGTGAAACTTGG - Intergenic
1079343884 11:19635058-19635080 CAGAGTCACACAATGAAATCAGG - Intronic
1080829563 11:35878721-35878743 CAGAGTCAGAACTTGAAACTTGG + Intergenic
1081027180 11:38030314-38030336 CAGGGGCACACGATGAAACCTGG - Intergenic
1081278674 11:41182456-41182478 CAGAGTCAGACCTTGAACCTAGG - Intronic
1082051736 11:47775937-47775959 CAAGGTTACATATTGAAACTAGG + Intergenic
1087207550 11:95412952-95412974 CAGGGTCAGAATTTGAAACTAGG - Intergenic
1087684429 11:101247259-101247281 TATGGTCAAACATTGAAAATTGG + Intergenic
1087711176 11:101554537-101554559 CAGTGTCTCACACTGAAACCAGG - Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1089183802 11:116601216-116601238 CAGGGTCAGATGCTGAAACTGGG + Intergenic
1089333842 11:117709146-117709168 CAGGGTCACACATTGAAACTAGG - Intronic
1089913749 11:122130678-122130700 CACTGTCACAGATTGAGACTGGG + Intergenic
1090783680 11:130029791-130029813 CTGGGTGACACAGTGAGACTGGG - Intergenic
1092355429 12:7790933-7790955 CAGGGTCTCACTTTGCAGCTCGG + Intronic
1092842297 12:12554170-12554192 CTGGGTGACAGAGTGAAACTGGG + Intronic
1094616113 12:32037847-32037869 CTGGGTGACAGATTGAGACTCGG - Intergenic
1095297046 12:40538394-40538416 GAGGCTACCACATTGAAACTTGG - Intronic
1095536855 12:43259465-43259487 CAGAGTCAGGCATAGAAACTGGG + Intergenic
1096394072 12:51252414-51252436 CTGGGTGACACAGTGAGACTTGG - Intronic
1096420299 12:51451272-51451294 CAGGCTAACACAGTGAAACCCGG - Intronic
1096762588 12:53854790-53854812 CAGGGTCACACAGTGAACAGTGG + Intergenic
1097504954 12:60455222-60455244 CAGGTAAAGACATTGAAACTAGG + Intergenic
1100488622 12:95056073-95056095 CTGGGTAACACAATGAAACTCGG + Intronic
1102876482 12:116453114-116453136 CTGGGTGACAGAGTGAAACTTGG + Intergenic
1103178192 12:118883413-118883435 TAGCCTCACTCATTGAAACTGGG - Intergenic
1104370757 12:128222017-128222039 CAGGAGAACAGATTGAAACTGGG - Intergenic
1105351743 13:19622101-19622123 CTGGGTGACAGATTGAGACTCGG + Intergenic
1106511012 13:30412598-30412620 CAGGGTCACACTTTGAAAGCAGG + Intergenic
1107884703 13:44865757-44865779 CAGAGTCCCACATTTAACCTTGG - Intergenic
1108416418 13:50202207-50202229 CAGGGACACACATTTTAACAAGG + Intronic
1109727567 13:66363801-66363823 CATGAACACACATTGAGACTTGG + Intronic
1109740038 13:66541542-66541564 CAGAGGCACAGATTGAAATTAGG - Intronic
1114033367 14:18596139-18596161 CAGAGCCACTCATTGAAACTAGG - Intergenic
1114078161 14:19175339-19175361 CAGAGCCACTCATTGAAACTAGG - Intergenic
1114125333 14:19719214-19719236 CAGAGCCACTCATTGAAACTAGG + Intronic
1119557005 14:75560985-75561007 CAAGGTCACACAGTTAAACGTGG + Intergenic
1120077178 14:80172293-80172315 CAGGGTCACACAATAAAAGAAGG + Intergenic
1120797009 14:88645049-88645071 CTGGGTGACAAAGTGAAACTTGG - Intronic
1121144441 14:91572150-91572172 CTGGGTGACACAGTGAGACTCGG - Intergenic
1122007228 14:98715613-98715635 CAGGGTGAGACATTGAGGCTGGG + Intronic
1123568756 15:21580108-21580130 CAGAGCCACTCATTGAAACCAGG + Intergenic
1123604866 15:22015429-22015451 CAGAGCCACTCATTGAAACTAGG + Intergenic
1123726979 15:23112838-23112860 CTGGGTCACACAGTGAGACTTGG - Intergenic
1125172477 15:36781436-36781458 CAGGGTCACACTTGGAGCCTGGG + Intronic
1125854832 15:42938861-42938883 CAAGTACACACATTGACACTAGG - Intergenic
1126935721 15:53705485-53705507 CTGGGTGACACAGTGAGACTTGG - Intronic
1128963670 15:72035778-72035800 CAGGGTGACAGACTGAAACCCGG + Intronic
1129175683 15:73838182-73838204 CTTGGTCATAAATTGAAACTCGG - Intergenic
1129476064 15:75785407-75785429 CAGGGTTACACATTGAGGGTGGG + Intergenic
1131745842 15:95446200-95446222 CAAGTCCACACATTGAAAATTGG - Intergenic
1202977111 15_KI270727v1_random:307198-307220 CAGAGCCACTCATTGAAACTAGG + Intergenic
1134771129 16:16810722-16810744 CTGGGTAACAGAGTGAAACTCGG + Intergenic
1135736239 16:24933924-24933946 CAGAGTCACACCTGGAATCTAGG + Intronic
1135815942 16:25633875-25633897 CAGGGTCTCACTTTGTCACTTGG + Intergenic
1137338534 16:47574299-47574321 CATGATTACACATTGACACTGGG - Intronic
1138479537 16:57293038-57293060 CATTGTCACACATTGATGCTGGG + Intergenic
1139375588 16:66494519-66494541 CAGGGTCACACAACTGAACTGGG - Intronic
1141360033 16:83387129-83387151 CTGGGGCAGACATTGTAACTTGG - Intronic
1141512446 16:84521358-84521380 AGGGGTCACACTGTGAAACTGGG + Intronic
1141626225 16:85262689-85262711 CAAGGTCACACATGGAGTCTCGG - Intergenic
1144705851 17:17367375-17367397 CAGGGTCACATATTACAACCAGG - Intergenic
1145245794 17:21268541-21268563 CAAGGTCACACAGCAAAACTGGG - Intergenic
1146424226 17:32720853-32720875 CAGGGACTCATGTTGAAACTGGG + Intronic
1147955654 17:44132796-44132818 CAGGGTCACACAGGGAGACCTGG - Intergenic
1149577965 17:57727384-57727406 CAAGGGCACACAATGACACTTGG + Intergenic
1151411865 17:73936183-73936205 CAGTGTCACACATTTATATTTGG - Intergenic
1157102836 18:44745410-44745432 CAAGGTCACACAATGAATCAAGG - Intronic
1158392763 18:57057164-57057186 CATGGTCCCACAGAGAAACTTGG - Intergenic
1160678619 19:403534-403556 CAGGGTCACACATGCATACACGG + Intergenic
1162966522 19:14158802-14158824 CAAGGTCACACAGTGAGAATGGG - Intronic
1163443636 19:17334207-17334229 CAAGGTCACACAGTCAAGCTGGG + Intronic
1165722785 19:38091359-38091381 CTGGGTGACACAGTGAGACTCGG + Intronic
1167478888 19:49716993-49717015 CTGGGTGACAGAGTGAAACTCGG - Intergenic
1167501010 19:49848111-49848133 CAGGGTCTCACTTTGTCACTTGG + Intergenic
1167658304 19:50780636-50780658 GGGAGTCACACATTGAAAATGGG - Intergenic
1167733120 19:51273494-51273516 CTGGGTGACACAGTGAGACTTGG - Intergenic
1168703051 19:58452904-58452926 CTGGCTCACACAGTGAAACCCGG + Intronic
925902666 2:8519503-8519525 TAGTGTCACACGTTGAAACTGGG + Intergenic
926668547 2:15552017-15552039 CAGGATCACAGATTTAAAATAGG - Intronic
928829114 2:35457530-35457552 CTGGGTCACACAAGGAAACTAGG + Intergenic
929440937 2:41965411-41965433 CAGTGTCACACACAGAGACTAGG - Intergenic
929504552 2:42518154-42518176 CTGGGTGACAGAGTGAAACTCGG + Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930856767 2:56027220-56027242 CAGGGACACTTTTTGAAACTGGG + Intergenic
931767521 2:65470191-65470213 CAGGGTGACAGAGTGAGACTTGG - Intergenic
934463917 2:94241733-94241755 CAGGGTGACATAATGAGACTTGG + Intergenic
934658326 2:96129546-96129568 AAGGGTAAAACATTAAAACTGGG - Intronic
937159958 2:119751141-119751163 GTGGGTGACACATCGAAACTGGG + Intergenic
937299952 2:120832989-120833011 CCAGGTCAGACATGGAAACTTGG + Intronic
939126183 2:138180105-138180127 AAAGGTGACACATTCAAACTGGG - Intergenic
940164703 2:150757553-150757575 CAGGGTCTCACATAGCAAATAGG - Intergenic
940410855 2:153361218-153361240 CAGCCTCAGAGATTGAAACTAGG + Intergenic
940837539 2:158540309-158540331 CTGGATCACACATTCAAACATGG + Intronic
940911560 2:159214349-159214371 CAAGGTCATACATAGCAACTGGG + Intronic
943581009 2:189683546-189683568 CAGTGTGACTCATGGAAACTTGG + Intronic
944335373 2:198527610-198527632 CTGGGTGACACAGTGAGACTCGG - Intronic
945159616 2:206876058-206876080 GAGGGTCACTAATTGAACCTTGG - Intergenic
946187327 2:217988417-217988439 CAAGGTCACACAGTGAATGTTGG + Intronic
946655441 2:221940866-221940888 CTGGGTGACAGAGTGAAACTCGG + Intergenic
946900446 2:224367182-224367204 CAGGGGCAGAGATTGAAGCTAGG + Intergenic
1170697469 20:18672207-18672229 CAGGGTCTCACTTTGTCACTTGG - Intronic
1172075836 20:32296571-32296593 CTGGGTGACAGAGTGAAACTCGG + Intronic
1173235671 20:41243383-41243405 CAGGGTCACATCTGGAACCTTGG + Intronic
1174175048 20:48639290-48639312 AAGGTTCTCACATAGAAACTTGG - Intronic
1174788378 20:53454535-53454557 CTGGGTGACAGAGTGAAACTTGG + Intronic
1175165799 20:57043592-57043614 CAGGGTCACACAGTAGAACCTGG - Intergenic
1175868451 20:62194491-62194513 CAGCATTACACATTGAAATTTGG + Intronic
1180457482 22:15523194-15523216 CAGAGCCACTCATTGAAACTAGG - Intergenic
1180585068 22:16880884-16880906 CAGGGTGACATAATGAGACTTGG + Intergenic
1183127807 22:35801798-35801820 CTGGGTGACACAGTGAGACTCGG + Intronic
950014998 3:9749294-9749316 CAGGGCCACACACTGGGACTTGG + Intergenic
953154667 3:40358815-40358837 TATTGTCACACATTGACACTGGG + Intergenic
954971167 3:54652805-54652827 CCGGGTGACACAGCGAAACTCGG - Intronic
956413015 3:68997949-68997971 CAGAGTCACACACTGATACAAGG + Intronic
958890104 3:99773867-99773889 CTGGGTGACACAGTGAAACTCGG - Intronic
960001438 3:112735671-112735693 CAGGGTCCCTCATTGAAACTTGG + Intergenic
960171453 3:114466380-114466402 CAGGATCACAGATAGGAACTTGG - Intronic
962105594 3:132385415-132385437 AAGGGTCACATATTAAAATTTGG - Intergenic
962199136 3:133387304-133387326 CAGAGTCACAATTTGAACCTAGG + Intronic
962837442 3:139202049-139202071 CAAGGTCACACAGTGAGAGTGGG + Intronic
963734626 3:149006105-149006127 CAGGGTGACAGAGTGAGACTCGG - Intronic
964626353 3:158763834-158763856 CAGGGCCAAACAGTGAAACACGG + Intronic
965250573 3:166338454-166338476 CTGGGTGACAGAGTGAAACTCGG + Intergenic
966618122 3:181933996-181934018 CAGAGTCTCACATTGTCACTCGG - Intergenic
967815777 3:193797047-193797069 CTGGGTGACAGATTGAGACTTGG + Intergenic
968563031 4:1295013-1295035 GAGGGTCTCACAGTGAGACTGGG + Intronic
970711971 4:18874556-18874578 TATGGTCAAACATTGAAATTGGG - Intergenic
973086586 4:46070153-46070175 CAGGGTCAATCATTGGAAATTGG - Intronic
978095355 4:104769539-104769561 CAGGATGACACCTTGAAGCTTGG + Intergenic
980737617 4:136911700-136911722 CAGGATCATACATTGTACCTGGG + Intergenic
980750879 4:137086378-137086400 CTGGGTGACAGAGTGAAACTCGG - Intergenic
983404231 4:167305424-167305446 CTGGGTCACTGGTTGAAACTGGG + Intergenic
983888607 4:173007779-173007801 CTGGGTGACAGAGTGAAACTTGG + Intronic
985822361 5:2169010-2169032 GAGGGTCACAAATTGGAATTAGG + Intergenic
987579929 5:19776593-19776615 CAGTGTCATACATTGACAGTGGG + Intronic
989554239 5:42773511-42773533 CATGGCCATACACTGAAACTAGG - Intronic
990350340 5:54909458-54909480 CAGGGTCACACAGCCAAGCTGGG + Intergenic
990400568 5:55433522-55433544 CTGGGTGACACAGTGAGACTCGG - Intronic
992364162 5:76074714-76074736 CAGGGTCAGAGAAAGAAACTCGG - Intergenic
994508199 5:100668212-100668234 CTGGGTCACAGAGTAAAACTTGG + Intergenic
995011619 5:107262072-107262094 CAGGGACACAGATTTAAACAAGG - Intergenic
995076923 5:107996337-107996359 CTGGGTCACACAGGGAGACTCGG - Intronic
995645545 5:114307041-114307063 CAGGGTCTAACACTGATACTAGG - Intergenic
995815597 5:116164294-116164316 CTGGGCAACACAGTGAAACTCGG + Intronic
998529430 5:142871248-142871270 CAGGGGCACCCATTGAACCAGGG - Intronic
998784258 5:145691511-145691533 CTGGGTAACACAGTGAAACCCGG + Intronic
1000814412 5:165903124-165903146 CACAGTCACACCTGGAAACTTGG + Intergenic
1001745737 5:174090942-174090964 CAGTGCCACACATTGAAATTTGG + Intronic
1002220951 5:177681249-177681271 AAGGTCCACACATTGATACTGGG - Intergenic
1003055922 6:2820285-2820307 CAGGGTGACAGATTGGAATTTGG + Intergenic
1005682613 6:28222032-28222054 CAAAGTCAAACATTGACACTAGG + Intergenic
1006966505 6:37991375-37991397 CTGGGTGACAGAGTGAAACTAGG - Intronic
1007209954 6:40185431-40185453 CAGGATCCCAGATTGAGACTAGG + Intergenic
1007569285 6:42877823-42877845 CAAGGTCACACACTGAAAGAGGG - Intergenic
1010550597 6:77217756-77217778 CAGGGACACAAATTGACAATAGG + Intergenic
1011174715 6:84547319-84547341 CAGTGGCACAAATGGAAACTAGG - Intergenic
1012046640 6:94283893-94283915 CTGAGTTACACATTGATACTAGG - Intergenic
1013199096 6:107874836-107874858 AAGGATCACACATTGTAGCTGGG - Intronic
1013673604 6:112432653-112432675 CAGGGTCACAGTGTAAAACTGGG + Intergenic
1014080290 6:117278943-117278965 CATCATCTCACATTGAAACTTGG + Intergenic
1015508287 6:134011705-134011727 CAGGGTCTCACTCTGACACTTGG - Intronic
1015571346 6:134624487-134624509 CTGGGTGACAGAGTGAAACTCGG - Intergenic
1015589292 6:134807209-134807231 CAGGCTCAGACATGGAAAATGGG - Intergenic
1015664217 6:135609608-135609630 CTGGGTGACAGAGTGAAACTCGG - Intergenic
1017750396 6:157485986-157486008 CTGGGTGACAGAGTGAAACTCGG + Intronic
1017907939 6:158769601-158769623 CAGGGTCACCCATTGAAGGTGGG - Intronic
1018374512 6:163198535-163198557 CAGGGTCACACAGTGAGAACGGG + Intronic
1018481878 6:164199360-164199382 CAGGGCAACACATTCAAACGTGG + Intergenic
1018634759 6:165851143-165851165 CATGATCACACATTCAAACAGGG + Intronic
1020444791 7:8257861-8257883 AAGGGACACACATAGACACTGGG + Intronic
1024083625 7:45876044-45876066 AAGGGTCAGACCTTAAAACTGGG + Intergenic
1026119724 7:67526160-67526182 CAAGGTCACACATTGATACTGGG - Intergenic
1026843117 7:73682069-73682091 CAAGGTCACACATTAAATATGGG + Exonic
1029133306 7:98350079-98350101 CAGGGTCTTACCTTGAAACCCGG - Intronic
1032555892 7:132834745-132834767 CACTGTCACACATTGATACCAGG - Intronic
1034655250 7:152723943-152723965 CTGGGTGACAGAGTGAAACTGGG + Intergenic
1038479021 8:27888818-27888840 TAGGGTTACACAGTGAAACCAGG - Intronic
1038586317 8:28792509-28792531 CAGGGTAACACATTGCATTTAGG - Intronic
1039522227 8:38180963-38180985 CTGGGTAACAGAGTGAAACTCGG - Intronic
1041266498 8:56070586-56070608 CAGGCTCACACCTTGACGCTTGG - Intronic
1041936128 8:63333723-63333745 CAGTGTCAAACATTAAAAATGGG + Intergenic
1044078948 8:87860204-87860226 CTGGGCGACACAGTGAAACTGGG - Intergenic
1047960299 8:130006792-130006814 CAAGGTCACATATAGAAAATGGG + Intronic
1048924708 8:139261143-139261165 CTGTGTTACACATTGGAACTTGG - Intergenic
1051676059 9:19559600-19559622 CATAGTCACACTTTGAAACAGGG + Intronic
1052505643 9:29350421-29350443 CAAGGTTACAGATTGAGACTGGG + Intergenic
1052750557 9:32485563-32485585 CTGGGTGACACAGTGAGACTTGG - Intronic
1053694008 9:40618531-40618553 CAGGGTGACATAATGAGACTTGG + Intergenic
1053941000 9:43248950-43248972 CAGGGTGACATAATGAGACTTGG + Intergenic
1054270827 9:63021596-63021618 CAGGGTGACATAATGAGACTTGG - Intergenic
1054305253 9:63417755-63417777 CAGGGTGACATAATGAGACTTGG + Intergenic
1054404000 9:64741744-64741766 CAGGGTGACATAATGAGACTTGG + Intergenic
1054437621 9:65227244-65227266 CAGGGTGACATAATGAGACTTGG + Intergenic
1054492782 9:65794723-65794745 CAGGGTGACATAATGAGACTTGG - Intergenic
1056374440 9:85993195-85993217 CTGGGTGACAGAGTGAAACTCGG - Intronic
1058057825 9:100466835-100466857 CAGGGTCACACTCTGTCACTTGG - Intronic
1059090903 9:111356799-111356821 CAGAGTTACACACAGAAACTTGG - Intergenic
1059750011 9:117238847-117238869 CAGGGTGATACCTTGCAACTTGG - Intronic
1190217120 X:48487339-48487361 TGGGGTCACACATGGTAACTGGG - Intergenic
1190643635 X:52504594-52504616 CAGGGTCACCCAGTGAGACTTGG - Intergenic
1195705713 X:107736769-107736791 CAGGGTCACACAATGTCCCTGGG + Intronic
1198106814 X:133469904-133469926 CTGGGCAACACAGTGAAACTTGG - Intergenic