ID: 1089335998

View in Genome Browser
Species Human (GRCh38)
Location 11:117724402-117724424
Sequence CTGTGGAAGGTGAGGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5001
Summary {0: 1, 1: 1, 2: 26, 3: 317, 4: 4656}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089335990_1089335998 -1 Left 1089335990 11:117724380-117724402 CCGCCAGGAAGAGGGGGCTGGGC 0: 1
1: 0
2: 8
3: 54
4: 703
Right 1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG 0: 1
1: 1
2: 26
3: 317
4: 4656
1089335991_1089335998 -4 Left 1089335991 11:117724383-117724405 CCAGGAAGAGGGGGCTGGGCTGT 0: 1
1: 1
2: 3
3: 49
4: 444
Right 1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG 0: 1
1: 1
2: 26
3: 317
4: 4656
1089335988_1089335998 0 Left 1089335988 11:117724379-117724401 CCCGCCAGGAAGAGGGGGCTGGG 0: 1
1: 1
2: 8
3: 77
4: 598
Right 1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG 0: 1
1: 1
2: 26
3: 317
4: 4656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089335998 Original CRISPR CTGTGGAAGGTGAGGGTGGG AGG Intronic
Too many off-targets to display for this crispr