ID: 1089337866

View in Genome Browser
Species Human (GRCh38)
Location 11:117737505-117737527
Sequence GGACAGCAGGACAGCGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 435}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089337857_1089337866 13 Left 1089337857 11:117737469-117737491 CCAAAGGGGATCGTGGCATAATG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1089337866 11:117737505-117737527 GGACAGCAGGACAGCGGGGCAGG 0: 1
1: 0
2: 4
3: 42
4: 435
1089337854_1089337866 22 Left 1089337854 11:117737460-117737482 CCAGTGCACCCAAAGGGGATCGT 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1089337866 11:117737505-117737527 GGACAGCAGGACAGCGGGGCAGG 0: 1
1: 0
2: 4
3: 42
4: 435
1089337856_1089337866 14 Left 1089337856 11:117737468-117737490 CCCAAAGGGGATCGTGGCATAAT 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1089337866 11:117737505-117737527 GGACAGCAGGACAGCGGGGCAGG 0: 1
1: 0
2: 4
3: 42
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089337866 Original CRISPR GGACAGCAGGACAGCGGGGC AGG Intronic
900242447 1:1623522-1623544 GGCCAGCAGGACGGCGGCGAGGG + Exonic
900311422 1:2035284-2035306 TGCCAGCAGGACTGCGGGCCAGG - Intergenic
900473083 1:2864047-2864069 GGCCAGCAGGACTGGGGGGTGGG - Intergenic
900553091 1:3266299-3266321 GGACGCCAGGAGAGCCGGGCAGG + Intronic
900942782 1:5811734-5811756 GGACAGCGGCACAGCTGGCCCGG + Intergenic
901201782 1:7471377-7471399 GGTCACCAGGACAGCTGGGGAGG + Intronic
902309296 1:15568593-15568615 TGGCAGCAGCACAGCAGGGCCGG - Exonic
902503649 1:16926078-16926100 GGACTGCAGCACAGGGGGTCTGG + Intronic
903019089 1:20381103-20381125 GGACCTCAGGACAGCTGGGTGGG - Intergenic
903021117 1:20395889-20395911 GGACAGTAGGGAAGAGGGGCAGG + Intergenic
903078083 1:20787270-20787292 GGACTGGAGGACAGCGGTGGCGG - Intronic
903224577 1:21887440-21887462 GGACAGGAGGACTGCGAGGACGG - Exonic
904771534 1:32884060-32884082 GGGCAGCTGGGCAGCGGGCCTGG - Intergenic
904999098 1:34654156-34654178 GGACAGCAGAGGAGCGGAGCTGG + Intergenic
905416659 1:37808546-37808568 GGACCGCGGGAAGGCGGGGCTGG + Exonic
905644764 1:39617407-39617429 AGACAGCAGGAGAGAGTGGCAGG - Intergenic
905788462 1:40776505-40776527 GGACAGAAGGACAGTAAGGCTGG + Intergenic
907223800 1:52926917-52926939 GGACACCAAGAAAGCGGGGATGG - Intronic
907409415 1:54273998-54274020 GGACAGCAGGGCGGAGGAGCTGG + Intronic
907682668 1:56578849-56578871 GGGCCGAGGGACAGCGGGGCTGG + Intronic
909774640 1:79468182-79468204 GCACAGGAGGACAGAGGAGCTGG - Intergenic
910337991 1:86155634-86155656 GGGGAGCAGGACACGGGGGCGGG - Intronic
910773437 1:90851735-90851757 GAAAAGGAGGCCAGCGGGGCGGG - Intergenic
912408943 1:109466726-109466748 GCAGAGCAGGCGAGCGGGGCCGG - Exonic
915367745 1:155324997-155325019 GGACAGCCTGAGAGCAGGGCCGG - Intronic
915589180 1:156860970-156860992 GCACAGCTGGGCTGCGGGGCCGG + Exonic
920046131 1:203133751-203133773 GGTCAGCAGCCCAGTGGGGCAGG - Intronic
920714942 1:208331468-208331490 GAACAGCAGGACAGGGGAGGGGG - Intergenic
921166300 1:212510073-212510095 GCACAGCATGACAGTGAGGCAGG - Intergenic
922534249 1:226368156-226368178 GGACTGCAGGTCTGCTGGGCTGG - Intronic
923119628 1:230978503-230978525 GGGCGGCGGGGCAGCGGGGCTGG - Intronic
923216363 1:231851709-231851731 GGACAGAAGGGCAGCCAGGCTGG + Intronic
923493734 1:234507051-234507073 GGAAAGAAGGGCAGCAGGGCAGG - Intergenic
1062907106 10:1186588-1186610 GGACAGCAGGCCAGGAAGGCAGG - Intronic
1063019595 10:2114510-2114532 GGGCTGCAGGAAAGGGGGGCAGG - Intergenic
1063353112 10:5374218-5374240 GGACGGGAGGGCAGCGGGGTGGG + Exonic
1064122249 10:12630007-12630029 GGTCAGAAGGACAGTGGGACAGG + Intronic
1064466287 10:15585449-15585471 CGGCACCAGGACAGCAGGGCAGG + Intronic
1065362719 10:24904502-24904524 GGACAGCATGTCAGGGAGGCAGG + Intronic
1065507059 10:26439207-26439229 GGTCAGCAGGTCAGCAGGTCCGG + Intronic
1065972487 10:30816526-30816548 AGACAGCAGGTCACTGGGGCTGG + Intergenic
1067495599 10:46757484-46757506 GGACTGCAGGACTGCGGGAACGG + Intergenic
1067508659 10:46877336-46877358 GGACACAGGGCCAGCGGGGCTGG - Intergenic
1067599054 10:47582904-47582926 GGACTGCAGGACTGCGGGAACGG - Intergenic
1067653590 10:48174514-48174536 GGACACAGGGCCAGCGGGGCTGG + Intronic
1067802445 10:49368403-49368425 GGCCTGCAGGGCAGTGGGGCTGG - Intronic
1067948717 10:50709489-50709511 GGACTGCAGGACTGCGGGAACGG - Intergenic
1068393966 10:56437121-56437143 GGACAGAAGGACAGAAGGGTAGG + Intergenic
1068786710 10:60983829-60983851 GGCCAGAAGGAGGGCGGGGCCGG - Intronic
1068796119 10:61082151-61082173 GGACAGGAACACAGCTGGGCAGG + Intergenic
1069421700 10:68252335-68252357 GGACAAAAGGACAGCTGTGCTGG - Intergenic
1069752740 10:70754601-70754623 AGCCAACAGGACAGTGGGGCTGG + Intronic
1070884037 10:79874486-79874508 GGACTGCAGGACCGCGGGAACGG - Intergenic
1071650593 10:87390786-87390808 GGACTGCAGGACCGCGGGAACGG - Intergenic
1073136873 10:101225034-101225056 AGACGGCAGGGCAGCGGGGCAGG - Intergenic
1074546475 10:114405003-114405025 GGCGAGGAGGGCAGCGGGGCGGG + Intergenic
1075443866 10:122500544-122500566 AGACAGTAGGACATCTGGGCTGG - Intronic
1076019746 10:127062864-127062886 GGACAGAAGGACAGGGGCACTGG - Intronic
1076643442 10:131934902-131934924 GCAGGGCAGGACGGCGGGGCTGG - Intronic
1076699399 10:132263421-132263443 GGACACCGGGACTGCGAGGCAGG + Intronic
1076866339 10:133168132-133168154 GGACACCAGGTCTGCGGGGAGGG + Intronic
1077096183 11:800097-800119 GGACAGCAGAGGGGCGGGGCAGG - Intronic
1077317953 11:1927636-1927658 GGACAGACGGACAGCAGGGCAGG + Intronic
1077432167 11:2521227-2521249 GGAGAGCAGGATGGCGGGGCCGG - Intronic
1077580665 11:3415143-3415165 GCACGGCAGGACACCGAGGCAGG - Intergenic
1078483829 11:11703991-11704013 GGACAGCAGGACAGGGGAGAAGG - Intergenic
1079242259 11:18729286-18729308 GGACAGCTGGGTAGAGGGGCAGG - Intronic
1080297839 11:30750849-30750871 GGACAGGGGAACAGTGGGGCAGG - Intergenic
1081605428 11:44524591-44524613 GGACTCCAGGACATCTGGGCTGG - Intergenic
1081668285 11:44929247-44929269 GGCCAAGAGGACAGCGGGGAGGG - Exonic
1081710275 11:45211578-45211600 GGACAGGGGGACAGCAGGGCTGG + Intronic
1082982629 11:59137329-59137351 GGTCTGGAGGAAAGCGGGGCGGG + Intergenic
1083592088 11:63901821-63901843 GGAGAGCAGGGCAGGGAGGCTGG - Intronic
1083640940 11:64144959-64144981 GGACAGCCGGACGCAGGGGCGGG + Intronic
1083856198 11:65394217-65394239 GGACAGCCGCTCAGCTGGGCTGG - Intronic
1084088268 11:66864673-66864695 GGGCAGCGGGGCAGCGGGACAGG + Intronic
1084182660 11:67454539-67454561 GGACAGCTGGAGTGCTGGGCAGG - Intronic
1084209034 11:67612459-67612481 GGACAGCAGGCCAGGGTGGTGGG - Exonic
1084391105 11:68877687-68877709 GGACAGCTGGACTGCTGGACTGG - Intergenic
1084435448 11:69136729-69136751 GGACAGGAGGAAAGCAGGCCAGG - Intergenic
1084716862 11:70879748-70879770 TGACAGCAGGACACCGGCGGTGG + Intronic
1085083829 11:73653759-73653781 GAACAGAAGGACAGCTGGGGTGG + Intronic
1085522434 11:77146419-77146441 GGACAGCAAGAGGCCGGGGCCGG + Intronic
1089096369 11:115923189-115923211 GGACAGCAGGACCCCTGGGCAGG - Intergenic
1089184597 11:116606309-116606331 GGACAGAGAGACAGTGGGGCTGG - Intergenic
1089337866 11:117737505-117737527 GGACAGCAGGACAGCGGGGCAGG + Intronic
1089624236 11:119741292-119741314 GGACAGTCGGACAGAGGGACAGG - Intergenic
1090224781 11:125063418-125063440 GGACAGCTGGTGAGCGGGGCAGG + Exonic
1090359131 11:126160539-126160561 GGGCAGCAGGACGGAGGGCCAGG + Intergenic
1090808653 11:130218607-130218629 GGCCAGCTGGGCAGCAGGGCAGG + Intergenic
1091695887 12:2627822-2627844 GGGCTGCAGGACTTCGGGGCTGG - Intronic
1092182778 12:6457554-6457576 GTACAGCTGGACCGCAGGGCAGG + Exonic
1092214604 12:6672301-6672323 GGAGGGCATGCCAGCGGGGCGGG + Intronic
1092405247 12:8217316-8217338 GGACAGCAGGATAATGGGGAAGG - Intergenic
1093194875 12:16118750-16118772 GGGCAGCAGTACAAGGGGGCTGG - Intergenic
1093864858 12:24213370-24213392 GGACATCAGGACACCGGGAGTGG - Intergenic
1094214423 12:27925341-27925363 AGAAAGCAGGACAGCGAGGAAGG + Intergenic
1095890962 12:47234981-47235003 GGACAGAAGGAGAGAAGGGCTGG - Intronic
1096250059 12:50025278-50025300 GGACAGCGGGACAGCGGGACAGG - Intronic
1096252264 12:50040792-50040814 GGACAGCGGGACAGGCAGGCAGG + Intergenic
1096513549 12:52144724-52144746 GGTCAGCAGGCAAGAGGGGCCGG + Intergenic
1097053773 12:56238478-56238500 GGACAGCAAGACAGGGGAGAGGG - Exonic
1099935235 12:89117567-89117589 GGGCAGCAGGGCAGCAGGGCTGG - Intergenic
1101842627 12:108339353-108339375 GGAGAGCAGGAGGGAGGGGCAGG + Intergenic
1102583775 12:113909030-113909052 GGACTGCAGGACCGCAGGACAGG + Intronic
1103731908 12:123033325-123033347 GGCCAGCAGGAGAGCTGGGATGG + Intronic
1103809388 12:123601779-123601801 AGGCCGAAGGACAGCGGGGCTGG - Intergenic
1103900953 12:124303423-124303445 GGGCAGCAGGACAGTGTGGGGGG - Intronic
1104729709 12:131098092-131098114 GGACAGCAGCAGAGCCAGGCCGG - Intronic
1104745008 12:131205014-131205036 GGACTGCAGCATGGCGGGGCCGG - Intergenic
1104917728 12:132274476-132274498 AGCCAGCAGGAGAGCAGGGCAGG - Intronic
1104929341 12:132329719-132329741 GGACCCCAGGACAGCAGGTCCGG + Intergenic
1104929350 12:132329727-132329749 GGACAGCAGGTCCGGGGGGCGGG + Intergenic
1105241135 13:18610329-18610351 AGGCAGGAGGACAGAGGGGCTGG - Intergenic
1105389206 13:19959183-19959205 GGACGGCGGGACGGCGGGGCGGG + Intronic
1106457343 13:29938636-29938658 GGAAAGCAGGATATCTGGGCAGG - Intergenic
1107747155 13:43522629-43522651 GGACAGCAGGTGAGGGGGCCTGG + Intronic
1111319563 13:86609308-86609330 GGACAAGAGGACAGAGAGGCAGG + Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112752384 13:102596531-102596553 GGTCAGCAGCACCCCGGGGCTGG + Intergenic
1113693612 13:112329173-112329195 GGACAGAAGGACCCAGGGGCTGG - Intergenic
1113859648 13:113472962-113472984 GGACAGAAGGACAGAGGTACGGG - Intronic
1114686267 14:24534667-24534689 GAAGAGAAGGACTGCGGGGCTGG + Intergenic
1116658029 14:47675218-47675240 GGAAGGCAAGACAGCAGGGCTGG - Intergenic
1121007720 14:90500941-90500963 AGACAGCAGGACTGGGGGACTGG + Intergenic
1121145463 14:91578350-91578372 GGAGTGCAGGCCAGCGGTGCGGG + Intergenic
1122652369 14:103232625-103232647 GGGCAGCAGGAGGGCAGGGCTGG + Intergenic
1122652376 14:103232646-103232668 GGGCAGCAGGAGGGCAGGGCTGG + Intergenic
1122976832 14:105174265-105174287 GGACAGGATGGCAGAGGGGCTGG + Intronic
1123032031 14:105456474-105456496 GAACGGCAGGGCAGCGGGGAAGG - Intronic
1123067474 14:105625890-105625912 GGACTGTAGGACAGCCGGGAAGG + Intergenic
1123071492 14:105644614-105644636 GGACTGTAGGACAGCCGGGAAGG + Intergenic
1123076449 14:105669669-105669691 GGACTGTAGGACAGCCGGGAAGG + Intergenic
1123091151 14:105742895-105742917 GGACTGTAGGACAGCCGGGAAGG + Intergenic
1123096922 14:105771230-105771252 GGACTGTAGGACAGCCGGGAAGG + Intergenic
1123113968 14:105885569-105885591 GGGCAGCAGGAGGGCGGGGCTGG - Intergenic
1123116196 14:105895188-105895210 GGGCAGCAGAAGGGCGGGGCTGG - Intergenic
1123220896 14:106854472-106854494 GGACAGCAGGAAAACAAGGCAGG + Intergenic
1123490219 15:20774818-20774840 AGGCAGGAGGACAGAGGGGCTGG + Intergenic
1123546720 15:21343905-21343927 AGGCAGGAGGACAGAGGGGCTGG + Intergenic
1123690187 15:22832234-22832256 GGCAAGCAGGACAGCGGTGGTGG + Intergenic
1123703830 15:22936554-22936576 GGAGATCAGGACAGCTGTGCTGG + Intronic
1123708156 15:22965769-22965791 GGACACCAGGGCAGCGGGAAGGG - Intronic
1124346368 15:28924063-28924085 TCACAGCAGGGCAACGGGGCAGG - Intronic
1124666038 15:31593637-31593659 CAACAGGAGGTCAGCGGGGCTGG + Intronic
1124678671 15:31710527-31710549 GGACAGCAAGACCTCAGGGCAGG + Intronic
1124983669 15:34584775-34584797 GCACAGAAGGACAGGGGGCCTGG + Intronic
1127142654 15:55993482-55993504 GGACCGCGGGGCTGCGGGGCGGG - Intronic
1128725960 15:69988784-69988806 GCACAGCAGGAGGGCTGGGCCGG + Intergenic
1129319102 15:74763928-74763950 GGACAGCAGTAGTGGGGGGCGGG + Intergenic
1130449179 15:84033756-84033778 TGACAGAAGGACAGTGTGGCTGG - Intronic
1130647890 15:85744719-85744741 GGACAGCAGGAGAGGTGGGCTGG - Exonic
1131231880 15:90665563-90665585 GGACAGCCGGGCAGAGGAGCCGG - Intergenic
1131457171 15:92590584-92590606 GGACACCAGGACCTAGGGGCTGG + Intergenic
1131958519 15:97763775-97763797 TGACAGCAGGACAGCAGCCCAGG + Intergenic
1132156137 15:99496374-99496396 GGGCAGAAGGACAGAGGGGCAGG + Intergenic
1202955051 15_KI270727v1_random:71120-71142 AGGCAGGAGGACAGAGGGGCTGG + Intergenic
1132486462 16:194657-194679 GGACAGCAGGCCAGGGGAGGTGG + Intronic
1132665237 16:1078469-1078491 GGGCAGCAGCACTGCAGGGCAGG + Intergenic
1132674153 16:1114760-1114782 GGTGGGCAGGACAGCGGTGCTGG - Intergenic
1132685420 16:1160008-1160030 GGACAGGAGGAATGCGGGGGAGG + Intronic
1132734608 16:1379328-1379350 GGAGGGCAGGGGAGCGGGGCAGG - Intronic
1132940224 16:2502652-2502674 GGACAGCAGGGCATGGGGACTGG - Exonic
1133720432 16:8489573-8489595 GCACAGCAGGACAGCTGGAGAGG + Intergenic
1133890922 16:9877821-9877843 GGATAGCAGGACAGGGAGGGGGG - Intronic
1134309398 16:13061966-13061988 GGAGAGCAGGCCGGTGGGGCTGG + Intronic
1135109715 16:19681249-19681271 GGGCAGGAGGAAAGCGAGGCTGG + Intronic
1136298455 16:29317311-29317333 GGACTGCAGGACAGCTCGCCAGG + Intergenic
1136397378 16:30000726-30000748 GGACAGCTGGTCAGTGGGGATGG - Intronic
1136429348 16:30187765-30187787 GGGCAGCAGGACACCGCTGCTGG - Exonic
1138302947 16:55947832-55947854 GGTCAGCAGGACAGCAGGGGAGG + Intronic
1138578821 16:57926298-57926320 GGGCAGGAGGACACTGGGGCAGG + Intronic
1138656772 16:58495961-58495983 GGACAGCCGGAGATCAGGGCAGG + Intronic
1140043677 16:71425838-71425860 GGGGAGCAGGAGAGCGCGGCAGG - Intergenic
1141665102 16:85461895-85461917 GGAGAGCAGGAAGGAGGGGCAGG - Intergenic
1141692613 16:85605171-85605193 GGGGAGCAGGACAGCGGGTGGGG - Intergenic
1142003224 16:87675882-87675904 GGCCAGCAGGGCAGAGGTGCAGG - Intronic
1142809595 17:2389133-2389155 AGACAGAAGGACAGTGGGGGAGG - Intronic
1143181756 17:4987842-4987864 GGGCAGCAGCACTGAGGGGCAGG + Intergenic
1143634487 17:8156508-8156530 GGTCAGCAGGCCAACGGGGGCGG + Intronic
1143711068 17:8735700-8735722 GGACACCTGGACACCTGGGCAGG + Intronic
1145281031 17:21467282-21467304 GGACAGCAGAAGAGCGGGTTGGG - Intergenic
1146076746 17:29737323-29737345 GGACAGAAGGAAAGCTGGGAGGG - Intronic
1146275194 17:31511960-31511982 GGACAGTGGGACAGCGAGGTAGG + Intronic
1147446983 17:40480486-40480508 GGCCAGCAGGGAAGTGGGGCAGG - Intronic
1147599842 17:41738850-41738872 AGACAGCAGGACTGCGGCGGGGG - Intergenic
1147746144 17:42695803-42695825 GTAGAGCAGGACAGCAGGGGCGG - Exonic
1148338705 17:46860239-46860261 GGAGAGGAGGGAAGCGGGGCCGG + Intronic
1148496570 17:48056506-48056528 GGCGAGCAGGACACCTGGGCAGG + Exonic
1148550466 17:48547261-48547283 TCACAGCAGGACAGGGGGGCGGG - Intergenic
1148618431 17:49016798-49016820 GGGCAGGAGGACAGGGGGGCGGG - Intronic
1149469701 17:56906237-56906259 GGAAGGCAGGAGAGCGGGACAGG - Intronic
1149574193 17:57699824-57699846 GGGCAGCAGGACAGCCAGGCTGG - Intergenic
1150353114 17:64460984-64461006 AGACAGCAGGACAGAGGGTGAGG + Intronic
1151615165 17:75205406-75205428 GGGCAGGAGGACCCCGGGGCTGG - Intergenic
1151758195 17:76086606-76086628 GGACAGCAAGGCAGGGAGGCCGG + Intronic
1151836641 17:76586351-76586373 GGACGCCAGGACAGCTGGGAGGG + Intronic
1151875238 17:76864258-76864280 GGCCAGCAGGACCCAGGGGCAGG + Intergenic
1152157502 17:78644473-78644495 GGAAAGGAGGAGAGAGGGGCTGG - Intergenic
1152376610 17:79921910-79921932 GGCCGGCGGGACAGTGGGGCGGG - Intergenic
1152526071 17:80888971-80888993 GGCCAGGAGGGCAGTGGGGCAGG + Intronic
1152526991 17:80893994-80894016 GGTCAACAGGACTGCGAGGCAGG + Intronic
1152590496 17:81209193-81209215 GGACAGCAGGGCAGCGCGAGGGG + Intronic
1152605414 17:81287177-81287199 GCACTGGAGGACAGCGGGGAGGG + Intronic
1152743882 17:82030512-82030534 GGCCAGCCAGAGAGCGGGGCTGG + Intronic
1152862890 17:82705951-82705973 GGCCACGGGGACAGCGGGGCTGG + Intergenic
1152870420 17:82750944-82750966 GGACAGGGGGACAGGGGGACGGG - Exonic
1153961967 18:10147689-10147711 GGACACCAAGACAGCAGGGGTGG - Intergenic
1154231124 18:12557230-12557252 GGAGACCACGGCAGCGGGGCAGG + Intronic
1154447823 18:14449572-14449594 AGGCAGGAGGACAGAGGGGCTGG + Intergenic
1155240182 18:23857252-23857274 GATCATCAGGACAGAGGGGCTGG - Intronic
1157568689 18:48697924-48697946 GGACTGCAGGACTGCAGGGCTGG - Intronic
1158514437 18:58119516-58119538 GGACAGCAGGTCAGTGGATCGGG - Intronic
1160210426 18:76873874-76873896 GGAGAGGACGACAGGGGGGCAGG - Intronic
1160210445 18:76873946-76873968 GGAGAGGAGGACAGGCGGGCAGG - Intronic
1160210475 18:76874088-76874110 GGAGAGGAGGACAGGCGGGCAGG - Intronic
1160585647 18:79911933-79911955 GGACAGCAGCAGAGAGGGGACGG + Intronic
1160953944 19:1681084-1681106 GGGCAGCTGGACGGCTGGGCAGG + Intergenic
1160989515 19:1854781-1854803 AGACAGCGGGTCAGCGGGGGCGG + Intronic
1161159723 19:2755117-2755139 GGACAGAAGGACAGCAGGATGGG + Exonic
1161510020 19:4665069-4665091 GGCCACCAGGAGGGCGGGGCAGG - Intronic
1162143974 19:8601862-8601884 GGACATTTGGGCAGCGGGGCAGG - Intronic
1162700895 19:12513858-12513880 GGTCAACAGGTCAGCGGGGCAGG - Intronic
1162820665 19:13221551-13221573 GGACAGCAGGGCAGAGAGACAGG - Intronic
1163035040 19:14565139-14565161 GGGCAGGGGGACAGCTGGGCTGG + Intronic
1163046174 19:14644120-14644142 GGCCATCAGGACAGCGAAGCTGG + Exonic
1163678825 19:18669202-18669224 GGGCAGCAGGACGGGGGCGCAGG - Exonic
1165158608 19:33802974-33802996 GGTGAGCAGCACAGTGGGGCTGG - Intronic
1165476944 19:36036124-36036146 GCACAGAGGGACAGTGGGGCAGG - Intronic
1166194662 19:41197920-41197942 GGACAGAAGGTCAGCATGGCGGG + Exonic
1166364780 19:42272881-42272903 GGGCAGCAGGGCAGGGTGGCAGG - Intronic
1166546861 19:43639418-43639440 GGACAGAAGGACAGCGGGACCGG + Intronic
1167079737 19:47270907-47270929 GGACAGAACGAAAGTGGGGCAGG - Intronic
1167464023 19:49640755-49640777 GGACAGCAGGGTAACGGGGCAGG + Intergenic
1168687756 19:58358590-58358612 GGACAGGAAGGCAGCAGGGCAGG + Intronic
925082093 2:1078479-1078501 GGATTGCAGGACAGCTGGGCAGG + Intronic
925146753 2:1587485-1587507 GGGCAGGAGGACAGAGGGACAGG - Intergenic
925146771 2:1587555-1587577 GGACAGAGGGACAGAGGGACTGG - Intergenic
925146827 2:1587743-1587765 GGACAGAGGGACAGAGGGACTGG - Intergenic
925146959 2:1588193-1588215 GGACAGAGGGACAGAGGGACGGG - Intergenic
925431036 2:3793473-3793495 GGACAGCAGGACAGGGAGCCAGG - Intronic
925451087 2:3969691-3969713 GGGCAGCAGGGCAGAGGGGGAGG - Intergenic
925458952 2:4043493-4043515 GGTCAGCAGGACAGAGGGGAGGG - Intergenic
926736728 2:16079051-16079073 GGTAAGCAGGACAACGTGGCAGG - Intergenic
927477379 2:23423984-23424006 TGACAGGTGGACAGCTGGGCAGG - Intronic
927873104 2:26636511-26636533 TGACAGCAGGACAGTCGGCCTGG - Intronic
928202010 2:29253535-29253557 GGACAGCAGGACATGTGGCCAGG + Intronic
929236980 2:39615891-39615913 GGAGAGCAGGAGAGTGGGGAGGG - Intergenic
929777639 2:44938785-44938807 GGAGAGCAGGGCAGGGAGGCGGG - Intergenic
931643918 2:64404581-64404603 GGACAGCAGGGCAGAGGGAGAGG - Intergenic
932122319 2:69113183-69113205 GGACAGCAGGACTAGGGGGAAGG - Intronic
932212796 2:69946034-69946056 GGCCAGCCAGACAGCCGGGCTGG + Intergenic
933938494 2:87226108-87226130 GGACAGCAGGTCATGGTGGCTGG - Intergenic
934765906 2:96879857-96879879 CGCCAGCAGGCCAGCTGGGCCGG - Intronic
936556702 2:113503113-113503135 GGCGGGCAGGACAGTGGGGCGGG - Intergenic
938043444 2:128095493-128095515 GGACAGGAGGAGAGTGGGGGAGG - Intronic
938043450 2:128095509-128095531 GGACAGGAGGAGAGCAGGACAGG - Intronic
938094869 2:128455071-128455093 GGACAGCAGGGCAGCGTGGAGGG + Intergenic
940363504 2:152820547-152820569 GGACAGGAGGACAGATGGGAAGG - Intergenic
942014073 2:171793381-171793403 GGCCAGCAGGTCTGCGGTGCTGG + Intronic
946061658 2:216947190-216947212 GACCAGCATGACAGAGGGGCTGG - Intergenic
946183792 2:217965470-217965492 GGACAGCAGGAGAGGTGGCCTGG - Intronic
946195764 2:218032417-218032439 GGACAGGAGAATAGCGAGGCTGG + Intergenic
946423001 2:219575397-219575419 GGAGAGCAGCACAGCAGGGCTGG - Exonic
947186016 2:227456370-227456392 GGACAGGAGGTCAGGGGTGCTGG + Intergenic
947634747 2:231674293-231674315 GGACAGGAGGGCAGAGAGGCAGG - Intergenic
947899682 2:233711185-233711207 GGAGAGCAGGACTGTGGGGAGGG - Intronic
947900380 2:233716969-233716991 GGACAGCAGGACTGTGGGGAGGG - Intronic
948055111 2:235005245-235005267 GGCCAACAGCACAGCAGGGCTGG - Intronic
948178396 2:235961508-235961530 GGACAGCAGTGCAGAGGGACAGG + Intronic
948480696 2:238248341-238248363 AGAGAGCAGGAGAGAGGGGCTGG + Intronic
1168830129 20:841285-841307 GGAGCGCAGGCCAGCGGCGCGGG + Intronic
1169867614 20:10218160-10218182 GGTCAGCCGGGCAGCGAGGCTGG - Intergenic
1170369443 20:15632797-15632819 GGAAAGGAGGACAGCAGGGGAGG - Intronic
1171015479 20:21537391-21537413 GGCCAGAAGGACACTGGGGCTGG - Intergenic
1172082182 20:32350805-32350827 GGCCAGCAGTCCAGAGGGGCAGG - Intergenic
1172245761 20:33443882-33443904 GGTCAGAAGGGCGGCGGGGCGGG + Exonic
1172629371 20:36367731-36367753 GGAGAACAGGCCAGAGGGGCAGG - Intronic
1173181608 20:40810401-40810423 AGACAGAAGGGCAGCTGGGCTGG - Intergenic
1173246491 20:41341050-41341072 GGATGGCAGGACAGATGGGCAGG - Intronic
1174169185 20:48605600-48605622 GGACAGAGGGACAGAGGGGATGG + Intergenic
1174653740 20:52152476-52152498 GGTCAGCAGGACAGCCGGCTGGG + Exonic
1175224823 20:57439103-57439125 GGAGAGCAGGGCAGGGGGGCGGG - Intergenic
1175380239 20:58557740-58557762 TGATAGCAGGACAGAGGGGAGGG + Intergenic
1175852285 20:62100064-62100086 GGACAGCAGGGCCGTGGGGCTGG - Intergenic
1176448384 21:6841093-6841115 AGGCAGGAGGACAGAGGGGCTGG - Intergenic
1176826554 21:13706115-13706137 AGGCAGGAGGACAGAGGGGCTGG - Intergenic
1176861887 21:14015379-14015401 GGACAGTAGGATGGGGGGGCGGG + Intergenic
1177166657 21:17612242-17612264 GGACAGCGGACCCGCGGGGCAGG - Intronic
1177993485 21:28067048-28067070 GTACAGCAGGGCAGAGGGGTTGG + Intergenic
1179008039 21:37531670-37531692 GGAGGGCAGGACAGGGTGGCTGG - Intergenic
1179503570 21:41824898-41824920 GGAAGGCAGGACGGCGGGGACGG + Intronic
1179936894 21:44611745-44611767 AGACAGGAGGAAAGTGGGGCTGG + Intronic
1180018399 21:45102888-45102910 GGACAGCATGGAAGTGGGGCGGG + Intronic
1180135442 21:45859278-45859300 GGCCAGCGGGTCAGCCGGGCCGG + Intronic
1180179403 21:46111353-46111375 GCACAGCAGGTCAGCGGGATTGG - Intronic
1180215904 21:46323801-46323823 GTCCACCAGGACAGCGGGCCGGG - Exonic
1180698689 22:17770104-17770126 GGACAGCAGGAGAACAGGACAGG - Intronic
1180705471 22:17807328-17807350 GCAGAGCAGGGCAGGGGGGCAGG + Intronic
1180891361 22:19291498-19291520 GGGCAGCGGCTCAGCGGGGCTGG + Intronic
1180956032 22:19741762-19741784 GGACAGCAGAGCAGGGAGGCAGG + Intergenic
1181038181 22:20179792-20179814 GGGCAGCTGGGCAGAGGGGCAGG - Intergenic
1181350204 22:22249698-22249720 GCAGAGCAGGCCAGCAGGGCTGG - Intergenic
1181970171 22:26683962-26683984 GTACGGCAGGACAGTGGGACAGG + Intergenic
1182028114 22:27136272-27136294 GAAGAGCAGGACAGTGGGTCCGG - Intergenic
1182408524 22:30160153-30160175 TGGCAGCAGGACAGCAGGGATGG - Intronic
1182714017 22:32340748-32340770 GGACAGAGGGACAGTGGGGTGGG + Intergenic
1183427113 22:37746040-37746062 GGACGGCGGGACGGCGGGGTGGG - Intronic
1183484299 22:38081159-38081181 GGACAGCAGGAAGGCGGCGTCGG + Exonic
1183540849 22:38428509-38428531 GGCAAGCAGGACAGAGGGACAGG - Intronic
1184423184 22:44393616-44393638 GAACTGCAGGACTGAGGGGCAGG + Intergenic
1184678835 22:46058872-46058894 GCACAGCAGGACAAGGAGGCTGG - Intronic
1184736144 22:46398789-46398811 GCCCAGCTGGACAGCGAGGCTGG + Intronic
1184900777 22:47445224-47445246 GGACAGGAGGACAGGTGGACAGG - Intergenic
1184900828 22:47445470-47445492 GGACAGAAGGACAGGCGGACAGG - Intergenic
1184900839 22:47445526-47445548 GGACAGGAGGACAGGTGGACAGG - Intergenic
1185049025 22:48544054-48544076 GCTCAGCAGGACAGCAGGGTGGG + Intronic
1185171418 22:49296755-49296777 GGACAGCAGGACAGCCCAGAGGG + Intergenic
950282579 3:11720121-11720143 GGGCAGCAGGTCCGCGGGACGGG - Intronic
950656272 3:14438880-14438902 GGTCTGCAGGACGGCAGGGCAGG + Intronic
950720960 3:14882233-14882255 TGACAGCATGACAGAGGGGCTGG + Intronic
951866256 3:27311589-27311611 GGAGTGCAGGACAGCAGGGCTGG + Intronic
952471194 3:33653690-33653712 GTCCAGCAGGATAGCAGGGCTGG + Intronic
952908875 3:38165559-38165581 GGAGGGCGGGACAGAGGGGCTGG + Exonic
953606582 3:44416715-44416737 GGGCACCAGGACAGTGGGCCAGG - Intergenic
953752797 3:45622199-45622221 GGGCTGGAGGACAGCGGAGCAGG - Intronic
954433068 3:50481529-50481551 GGACAGCAGGAGGCTGGGGCAGG + Intronic
954908670 3:54085131-54085153 GGGCAGCAGGAGAGCCTGGCAGG - Intergenic
955564908 3:60233516-60233538 GGGCAGGAGGAGAGCGGGGAGGG - Intronic
960909716 3:122637207-122637229 GGACAAGAGGACAGTGGGGTAGG - Intronic
960988790 3:123297213-123297235 GGCCAACAGGACAGGGAGGCTGG - Intronic
961352939 3:126315559-126315581 GGACAGGAGGAGAGCGGGAGGGG + Intergenic
961497801 3:127306850-127306872 GGCCAGCAGGACAGCTGTGGTGG + Intergenic
961737299 3:129010325-129010347 GGCCTTCAGGACACCGGGGCAGG + Intronic
961818759 3:129564595-129564617 GGGCAGCTGGACAGTGGGACAGG + Intronic
962754739 3:138458803-138458825 GGACAGGGGGACAGCAGGGGTGG + Intronic
966825454 3:183961315-183961337 GGAGAGCAGGATTGTGGGGCTGG - Intronic
967013429 3:185460369-185460391 GGACAGCAGGAGAGCAACGCTGG + Intronic
968497571 4:927103-927125 GGACTGCAGGTGAGCGGGGAGGG - Intronic
968497628 4:927288-927310 GGACTGCAGGTGAGCGGGGAGGG - Intronic
968497650 4:927362-927384 GGACTGCAGGTGAGCGGGGAGGG - Intronic
968497672 4:927436-927458 GGACTGCAGGTGAGCGGGGAGGG - Intronic
968497692 4:927500-927522 GGACCGCAGGTGAGCGGGGAGGG - Intronic
968642852 4:1722946-1722968 GAAAAGCAGGACAGCGGCTCTGG - Intronic
969244704 4:5924853-5924875 GAACAGCAGGTCAGAGGGTCCGG + Intronic
969522455 4:7686567-7686589 GGACAGGAGAACCCCGGGGCAGG - Intronic
969627905 4:8317019-8317041 GGACAGCAGGGAAGCGAGACAGG + Intergenic
969760867 4:9180655-9180677 GGACAGCAGGATAATGGGGAAGG + Intergenic
970959880 4:21859279-21859301 GGATAGCAGGACAGCGATGAAGG - Intronic
973533985 4:51862270-51862292 GGTCTGCAGGGCAGAGGGGCTGG - Intronic
975026062 4:69550192-69550214 CCAAAGCAGGACAGCTGGGCTGG - Intergenic
979212304 4:118119856-118119878 GGACAGCTGGAGATCGGTGCTGG - Intronic
980483190 4:133416460-133416482 GGACAGAAGGTCAGTGGGACCGG + Intergenic
985548098 5:520064-520086 GGAAACCAGGACAGTGGGGCTGG - Intronic
985553402 5:544401-544423 GGATAGGAGGACAGCAGGACAGG + Intergenic
985588589 5:753384-753406 GGGCATCAGGAGAGCAGGGCCGG - Intronic
985603256 5:845823-845845 GGGCATCAGGAGAGCAGGGCCGG - Intronic
985985783 5:3515194-3515216 GGACACCGGGGCAGGGGGGCGGG - Intergenic
986066697 5:4241026-4241048 GGCCAGCAAGAGAGCTGGGCTGG + Intergenic
986721163 5:10562864-10562886 GGCGACCAGGACAGCGGGTCGGG + Intergenic
988479604 5:31618893-31618915 TGACTGCATGAAAGCGGGGCGGG - Intergenic
988547839 5:32174477-32174499 GGACTGCAGGACCGCGGGTCAGG - Intergenic
988728496 5:33946964-33946986 GGAGGACAGGACAGCTGGGCTGG + Intronic
990752678 5:59035052-59035074 GGAGAGCAGGACAGCGGCCTGGG - Intronic
992105178 5:73444384-73444406 GGGAAGCAGGGCCGCGGGGCGGG - Intergenic
994420748 5:99525039-99525061 GCAGGGCAGGAGAGCGGGGCAGG - Intergenic
994486295 5:100389275-100389297 GCAGGGCAGGAGAGCGGGGCAGG + Intergenic
997359971 5:133288785-133288807 GGACAGCTGGACAGCGCTGGAGG + Intronic
997511661 5:134458774-134458796 GAACAGCTGGCCAGCAGGGCTGG + Intergenic
997530887 5:134580446-134580468 GGAAGGCAGGACGGCGGGGGGGG - Exonic
998374506 5:141682029-141682051 GGGCAGCAGGAGGGAGGGGCGGG + Intronic
998411680 5:141916001-141916023 GGAGAGCAGGGCTGAGGGGCGGG + Intergenic
999246136 5:150155727-150155749 GGGCAGCAGGGCTGAGGGGCCGG + Exonic
1001057297 5:168460276-168460298 GGTCAGCCGCACAGCAGGGCTGG - Intronic
1001598659 5:172914868-172914890 AGACAGCAGGAAAGGGGAGCAGG - Intronic
1001650003 5:173309562-173309584 GGACAGAAGGAGAGCTGGGCAGG - Intergenic
1001706016 5:173741699-173741721 GGACAGGGGGACAGGGGGACAGG + Intergenic
1001706020 5:173741707-173741729 GGACAGGGGGACAGGGGGACAGG + Intergenic
1002018057 5:176341565-176341587 GGACAGAAGGACAGTGGAGAAGG + Intronic
1002193987 5:177492447-177492469 GGAAAGCGTGACAGCGGGCCGGG + Intronic
1002206925 5:177569290-177569312 GTCCAGCAGGGCAGCGGGGTGGG + Intergenic
1002801109 6:522271-522293 GGACTGCAGGACAGCGTGTGGGG + Intronic
1002801129 6:522369-522391 GGACTGCAGGACAGCGTGTGGGG + Intronic
1002801147 6:522469-522491 GGACTGCAGGACAGCGTGTGGGG + Intronic
1002801181 6:522664-522686 GGACTGCAGGACAGCGTGTGGGG + Intronic
1002848499 6:969828-969850 GGACAGAGGAACAGCGTGGCTGG - Intergenic
1005363059 6:25050599-25050621 GAACAGCAGGCCAGAGGGGGCGG + Intergenic
1006429843 6:33988761-33988783 AGCCAGCAGGACTGAGGGGCAGG + Intergenic
1006594400 6:35182344-35182366 GGACAGCGGGACAGCGAGGCTGG - Intergenic
1007263633 6:40581361-40581383 GGACAGGAAGACAGAGGGGACGG + Intronic
1007735346 6:43978855-43978877 GGACAGCAGGGCTGCTGTGCGGG - Intergenic
1012602703 6:101117498-101117520 TGACAGCAGCAGAGCTGGGCGGG - Intergenic
1014639809 6:123895081-123895103 GAACAGTAGGACAGAGGGGCAGG - Intronic
1016590038 6:145734912-145734934 GGAAACCAGGTCAGAGGGGCAGG + Intronic
1016916483 6:149248763-149248785 GGACAGCAGCACTGGGGGGCTGG - Intronic
1016996234 6:149964063-149964085 GCACAGAAGGAACGCGGGGCTGG - Exonic
1017899244 6:158705408-158705430 GGACAGGAGGAACCCGGGGCAGG + Intronic
1018618627 6:165709796-165709818 GGACCGCAGGACAGCGAGGCTGG - Intronic
1019322967 7:423963-423985 GGGCAGCAGGACAGAGAGGGAGG + Intergenic
1019398597 7:837128-837150 GGGCAGCAGGACAGTGGGCTGGG + Intronic
1019460255 7:1154402-1154424 GGACAGGAGCACAGCGGGCCAGG + Intronic
1019639435 7:2095619-2095641 GGACAGCAGCAATGCTGGGCAGG + Intronic
1019664048 7:2242416-2242438 GGAGACGAGGAGAGCGGGGCCGG + Intronic
1019757462 7:2783403-2783425 GGACAGCAGAGAAGCAGGGCAGG - Intronic
1019909795 7:4092846-4092868 GGAGAGCAGCAGAGCAGGGCAGG + Intronic
1019930348 7:4218675-4218697 TGACAGCAGGAGGGCAGGGCTGG + Intronic
1021927530 7:25547662-25547684 GGACAGCAGGACAGGCTGGTGGG - Intergenic
1022659086 7:32349308-32349330 GGACCTCAGGCCAGTGGGGCAGG + Intergenic
1022827531 7:34031034-34031056 GGACAAAAGGACAGCCAGGCTGG + Intronic
1023797184 7:43803603-43803625 GGAAAGCAGGACAGGGGGGTGGG - Intronic
1024055918 7:45659816-45659838 GCCCAGCAGGACAGCAGGGATGG - Intronic
1024366129 7:48522323-48522345 GGACAGTGGGACAGCTGGACAGG - Intronic
1024377442 7:48655745-48655767 GGGCAGCAAGACGGAGGGGCAGG + Intergenic
1025099899 7:56125416-56125438 GGCCAGCAGCACAGCCGGACAGG + Intergenic
1028983099 7:96989125-96989147 GGAGAACAGGATCGCGGGGCTGG + Intergenic
1030232274 7:107221122-107221144 GGACAGCAGGACAGAAGTGAGGG - Intronic
1032414054 7:131722685-131722707 GGACAGCAGGATATGGGGGTGGG - Intergenic
1032654068 7:133908509-133908531 AGACTGCAGAACAGCGGGTCTGG + Intronic
1032880458 7:136084477-136084499 GGACACCAGGAAAGCTAGGCAGG - Intergenic
1033476993 7:141701622-141701644 GGAGAGGAGGTCGGCGGGGCTGG + Intronic
1033641362 7:143265224-143265246 AGACAGCAGGAAGGCGGTGCGGG - Exonic
1034936939 7:155206390-155206412 GGACCTCAGGACTGCGGGGAAGG - Intergenic
1035050224 7:155994449-155994471 GGGCAGCAGATCAGAGGGGCAGG - Intergenic
1035538819 8:415608-415630 GCACAGCTGGACAGAGGGTCAGG + Intronic
1035608702 8:946917-946939 CGGCAGCAGGACAGGGCGGCCGG - Intergenic
1036270976 8:7302506-7302528 GGACAGCAGGATAATGGGGAAGG + Intergenic
1036350373 8:8007838-8007860 GGACAGCAGGATAATGGGGAAGG - Intergenic
1037684773 8:21129489-21129511 GGACAGAAGGACAGTGGGCCCGG + Intergenic
1037752654 8:21692808-21692830 GGTCAGCGGGGCAGCGGGGCTGG - Exonic
1039795088 8:40906014-40906036 GGAGACCAGGGCAGGGGGGCGGG + Intergenic
1039910469 8:41822849-41822871 GCACAGCACGAGAGCGGGGGCGG + Intronic
1042235861 8:66612990-66613012 GGACGGAGGGACAGCGGGGGCGG + Exonic
1044941230 8:97345971-97345993 GGCCAGCAGCACAGCTGGGTGGG - Intergenic
1048623229 8:136157874-136157896 GAAGAGCTGGACAGAGGGGCAGG + Intergenic
1049393306 8:142382983-142383005 GGAAAGGAGGGCAGGGGGGCAGG + Intronic
1049605949 8:143529255-143529277 GGACAGAGGGACAGAGGGGTAGG + Intronic
1049656226 8:143799448-143799470 GGACAGCAGGGCCGAGGGGGAGG + Intronic
1049672799 8:143877301-143877323 GGGCAGCTGGACAGAGGGTCCGG + Intronic
1049726224 8:144147732-144147754 GGACTGCAGCACCCCGGGGCTGG + Intergenic
1049896317 9:114225-114247 GGCGGGCAGGACAGTGGGGCGGG + Intergenic
1052647335 9:31253839-31253861 GGACAGCAGGAGAGCAGGCGCGG - Intergenic
1053072694 9:35110562-35110584 GGACTGCAGGGGAGGGGGGCAGG + Exonic
1054805937 9:69395861-69395883 GCAGAGGAGGACAGTGGGGCAGG + Intergenic
1056258416 9:84823986-84824008 GGGAAGCAGGACAGTGGGGGAGG + Intronic
1056436309 9:86578543-86578565 GGTCAGCAGGACAGTGGAGCAGG + Intergenic
1056517620 9:87370500-87370522 GGACAGAAGGAGAGCGTGGGTGG + Intergenic
1056574380 9:87843549-87843571 GGACTGCAGGACTGCGGGAGCGG + Intergenic
1056655132 9:88502845-88502867 GGACAGGAGGGCAGCGGGCCCGG + Intergenic
1056905985 9:90648214-90648236 GGACAGCTGGACTGTGGTGCAGG - Intergenic
1057080530 9:92171510-92171532 GGAGAGCAGGCCAGCAGGGCAGG + Intergenic
1059061711 9:111039629-111039651 GAAACGCAGGACAGCGAGGCGGG + Intergenic
1060696220 9:125711182-125711204 AGACATCAGGGCAGCGGGACAGG + Intergenic
1060864290 9:126982698-126982720 AGACAGGAGAACAGCAGGGCAGG - Intronic
1060982737 9:127803073-127803095 GGCCAGCGGGCCAGCGGGCCTGG + Intronic
1061306302 9:129735253-129735275 GCACAGTAGGCCAGCGAGGCAGG - Intergenic
1061615055 9:131774014-131774036 GGGCAGCCGGGCAGCCGGGCAGG + Intergenic
1061728705 9:132596808-132596830 CTTCAGCAGGACAGTGGGGCAGG + Intronic
1061840645 9:133356775-133356797 GGAGAGCAGGAGAGAGGGGAGGG + Intronic
1062057825 9:134477732-134477754 GGACAGCAGGACCTCGCGGAGGG - Intergenic
1062122208 9:134839810-134839832 GGATAGGTGGGCAGCGGGGCTGG - Intronic
1062167557 9:135115493-135115515 GGACAGCAGCGCATCAGGGCTGG + Intronic
1062366618 9:136212628-136212650 GGAGAGCAGGGCAGACGGGCCGG - Intronic
1062392110 9:136337989-136338011 AGACAGCAGGCCGGGGGGGCTGG + Intronic
1062401341 9:136374012-136374034 GCATCTCAGGACAGCGGGGCAGG + Intergenic
1062628400 9:137453195-137453217 GGTCACCAGGACAGCAGGCCCGG + Intronic
1203520807 Un_GL000213v1:43425-43447 AGGCAGGAGGACAGAGGGGCTGG + Intergenic
1186888445 X:13938061-13938083 GAACAGAAGCACGGCGGGGCGGG + Intronic
1189504326 X:41595743-41595765 GGACAGCATATCAGCAGGGCAGG - Intronic
1190085706 X:47393659-47393681 AGACAGGAGGACAGCTGGGTTGG - Intronic
1190110016 X:47583356-47583378 GGTCAGCAGATCAGCTGGGCCGG + Intronic
1190214332 X:48469779-48469801 GGACAGAAAGACAGATGGGCGGG + Exonic
1192267916 X:69552651-69552673 GGCCAGCAGGACACCCAGGCTGG + Intergenic
1195364941 X:104116496-104116518 GGACAGGAGGACAGGGGAGAGGG + Intronic
1196693955 X:118591071-118591093 GGACAGCAGAACGTCTGGGCTGG - Intronic
1196828237 X:119757847-119757869 GGAGAGCAGGACAGAGAGGGCGG + Intergenic
1197775662 X:130117320-130117342 GGACAGCAGCTCAGGAGGGCTGG + Intergenic
1199546583 X:149012605-149012627 GGACAGCTGGAGAGCAAGGCAGG - Intergenic
1199996513 X:153029843-153029865 GGACTGCTGGGCAGCGGTGCTGG + Intergenic
1200066332 X:153505792-153505814 GGAAGGCAGGAGAGAGGGGCGGG + Intronic
1200075586 X:153549098-153549120 GGGCAGTAGGACGGAGGGGCTGG + Intronic
1202362506 Y:24126591-24126613 GGACTGCTGGACAGCGTGGTGGG + Intergenic
1202508211 Y:25543608-25543630 GGACTGCTGGACAGCGTGGTGGG + Intergenic