ID: 1089338116

View in Genome Browser
Species Human (GRCh38)
Location 11:117739607-117739629
Sequence TACCCACTAGAACCCCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089338112_1089338116 11 Left 1089338112 11:117739573-117739595 CCACGCAGTGCCCTCAAACCGAA 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1089338116 11:117739607-117739629 TACCCACTAGAACCCCACAGTGG 0: 1
1: 0
2: 1
3: 8
4: 74
1089338114_1089338116 0 Left 1089338114 11:117739584-117739606 CCTCAAACCGAAGTCAAGCTATT 0: 1
1: 0
2: 1
3: 5
4: 67
Right 1089338116 11:117739607-117739629 TACCCACTAGAACCCCACAGTGG 0: 1
1: 0
2: 1
3: 8
4: 74
1089338115_1089338116 -7 Left 1089338115 11:117739591-117739613 CCGAAGTCAAGCTATTTACCCAC 0: 1
1: 0
2: 1
3: 19
4: 255
Right 1089338116 11:117739607-117739629 TACCCACTAGAACCCCACAGTGG 0: 1
1: 0
2: 1
3: 8
4: 74
1089338113_1089338116 1 Left 1089338113 11:117739583-117739605 CCCTCAAACCGAAGTCAAGCTAT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1089338116 11:117739607-117739629 TACCCACTAGAACCCCACAGTGG 0: 1
1: 0
2: 1
3: 8
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089338116 Original CRISPR TACCCACTAGAACCCCACAG TGG Intronic
907828074 1:58037736-58037758 TACCAACTAAAGCCCCACAGAGG - Intronic
912630889 1:111245867-111245889 TACCCACTACAACCCCTTTGAGG + Intergenic
919688834 1:200510265-200510287 TACCCATTAGTGCCCCAGAGTGG + Intergenic
922169751 1:223144288-223144310 TGCCCACCCGAACCCCACTGTGG + Intergenic
1065249550 10:23796757-23796779 TACCCACTAGGACCTTACACAGG + Intronic
1065618471 10:27553528-27553550 AACCCACTAGAAATCTACAGGGG - Intergenic
1067892963 10:50151944-50151966 TTCTCATTAGAACCCCACTGAGG - Intergenic
1067968265 10:50939766-50939788 TACCCACTAGAACATTACTGTGG - Intergenic
1070178376 10:73992039-73992061 TCCCCACGTGAACCACACAGCGG - Intergenic
1070720777 10:78755452-78755474 TCCCCACTAACACACCACAGTGG + Intergenic
1073323106 10:102627642-102627664 TGCCCACCAGAACTCCCCAGCGG - Intronic
1073680980 10:105703193-105703215 TACCCGTTAGAACCCCACTGAGG + Intergenic
1076496298 10:130899864-130899886 GACCCACTGGGACCCCACCGAGG + Intergenic
1077962056 11:7086152-7086174 TTCCCACTAGCACTACACAGGGG + Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1079002185 11:16767308-16767330 TTCCCACATGAACCCCACACTGG - Intergenic
1081019226 11:37922636-37922658 TAGCTACTAGTACCCAACAGAGG + Intergenic
1085604212 11:77882690-77882712 CCACCACTAGAACCCCAAAGGGG + Intronic
1085814882 11:79727355-79727377 TACCCGCTAGTACCCTGCAGTGG - Intergenic
1088673511 11:112167506-112167528 GCCCCACTAGAGCCCCTCAGAGG - Intronic
1089338116 11:117739607-117739629 TACCCACTAGAACCCCACAGTGG + Intronic
1100195679 12:92241779-92241801 TTCCCACTAGAACCCTTCACTGG + Intergenic
1101499840 12:105292934-105292956 TGCCAACTAGAACTCCAAAGTGG - Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102879794 12:116475500-116475522 TAGTTACTAGAACCCCACAGTGG + Intergenic
1109928879 13:69185682-69185704 TCTCCACTAGAAACACACAGAGG + Intergenic
1113355803 13:109578848-109578870 CACCCACTGGACCCCCGCAGTGG + Intergenic
1116082944 14:40199391-40199413 TTCCCACCAGAACCACAGAGAGG - Intergenic
1116163163 14:41296217-41296239 TACCACGAAGAACCCCACAGGGG - Intergenic
1116596505 14:46855082-46855104 TTCCCACTTGAAGACCACAGTGG + Exonic
1118445495 14:65847485-65847507 CACCCAGTAGAACCACACAGAGG + Intergenic
1118792611 14:69108995-69109017 TACCCACTTGAAGACAACAGTGG + Intronic
1118908792 14:70044150-70044172 TCCTCACAAGAAGCCCACAGTGG + Intergenic
1119770438 14:77217412-77217434 TCCCCAGTAGAATCCCACAAGGG + Intronic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1125613348 15:40987938-40987960 TAGCGACTGGAACCCCACTGTGG - Exonic
1126550148 15:49919747-49919769 TACTCTCTAGTACCTCACAGTGG + Intronic
1128462866 15:67884587-67884609 TTCCCTCCAGAACCCCACAGCGG + Intergenic
1130167052 15:81472395-81472417 TACTCACAGGAACCCAACAGGGG - Intergenic
1136109369 16:28055031-28055053 CACCAACTAAAATCCCACAGAGG - Intronic
1145740002 17:27265858-27265880 GAATCACTTGAACCCCACAGGGG - Intergenic
1146214648 17:30969596-30969618 GACCCACTTGAAACACACAGAGG - Intronic
1147129307 17:38397252-38397274 TCCCCACTGGAACCACAGAGAGG - Intronic
1148706539 17:49638499-49638521 AAATCACTTGAACCCCACAGTGG + Intronic
1151316774 17:73327589-73327611 GTCACACCAGAACCCCACAGGGG + Intergenic
1156595431 18:38542887-38542909 AACCCACAATATCCCCACAGTGG + Intergenic
1163841813 19:19615996-19616018 TACCCACTAGAGCCCTGTAGTGG - Intronic
1165183881 19:34000075-34000097 TACCATCTGCAACCCCACAGAGG + Intergenic
1165423139 19:35732231-35732253 GACCCACCACATCCCCACAGTGG + Exonic
937229496 2:120389299-120389321 TAGCCCTGAGAACCCCACAGGGG - Intergenic
938382268 2:130843372-130843394 TGCCCTCTTGAACCCTACAGAGG + Intronic
941703728 2:168635123-168635145 CACCCATTAGCACCCCACTGAGG + Intronic
948674698 2:239590017-239590039 GACCCACAAGGTCCCCACAGAGG + Intergenic
1169697969 20:8412367-8412389 CACCCTCTGGAACCCCACAGTGG - Intronic
1171115985 20:22525244-22525266 TATTCATTAGAACACCACAGGGG - Intergenic
1171204791 20:23270393-23270415 CACCCACCATAACACCACAGTGG - Intergenic
1172611367 20:36255303-36255325 TGTCCAGTAGAACCCCCCAGGGG + Intronic
1175912718 20:62412462-62412484 TCCCCAAATGAACCCCACAGAGG - Intronic
1175963378 20:62648170-62648192 AACCCACAACAACCCCGCAGGGG - Intronic
1182433441 22:30314847-30314869 AACCCACAAAAAACCCACAGAGG + Intronic
1184365709 22:44049867-44049889 TCCCCACCAGAGCCACACAGAGG - Intronic
957742838 3:84295381-84295403 TCTCTACTAGGACCCCACAGAGG - Intergenic
961691836 3:128675552-128675574 TCCCAAATAGAACCCCCCAGAGG + Intronic
963361212 3:144274246-144274268 TCCCCACTAAAACTCAACAGTGG - Intergenic
967895246 3:194390111-194390133 TACTCAATGGAACCCCAGAGAGG + Intergenic
970466241 4:16325905-16325927 TACCCTGGAGAACCCCACAAAGG + Intergenic
972731986 4:41803677-41803699 TCCACCCTAGAACACCACAGAGG - Intergenic
974300444 4:60059146-60059168 TAACCAATAGAATACCACAGTGG + Intergenic
975923208 4:79417875-79417897 TACCCACTAGAACCTCGCTAAGG - Intergenic
979687681 4:123528410-123528432 TACCTCCTCTAACCCCACAGTGG - Intergenic
998169430 5:139863880-139863902 TCCCCACCCCAACCCCACAGGGG - Intronic
1001483615 5:172104867-172104889 TACCCACTAAAAACCCTAAGGGG + Intronic
1002759444 6:190386-190408 AAACCACTAGAAGCCCTCAGAGG - Intergenic
1005664287 6:28034942-28034964 TACCCAATACAAACCTACAGAGG + Intergenic
1005976501 6:30804125-30804147 TTCACACAAGAACCCCAGAGGGG - Intergenic
1015086174 6:129294462-129294484 TACCCACTGGAACCTCACTTGGG + Intronic
1024626081 7:51209426-51209448 AACCCTCCAGAACCCCACAGCGG + Intronic
1028664053 7:93320106-93320128 TACTCACAAGAAACCCACAATGG - Intronic
1032299258 7:130671201-130671223 TACCACCTAGAACCACCCAGTGG - Intronic
1047850121 8:128848107-128848129 AACCAGGTAGAACCCCACAGAGG - Intergenic
1050168002 9:2786564-2786586 TACCCTCTAGAGCCACACAGAGG - Intronic
1059732819 9:117073713-117073735 TACCCAAGAGCACCCCCCAGTGG - Intronic
1201774179 Y:17646028-17646050 TAGCGACCAGAGCCCCACAGAGG - Intergenic
1201827378 Y:18259961-18259983 TAGCGACCAGAGCCCCACAGAGG + Intergenic