ID: 1089338994

View in Genome Browser
Species Human (GRCh38)
Location 11:117744949-117744971
Sequence CGTGCTGCCCAGAGGGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 176}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089338988_1089338994 -10 Left 1089338988 11:117744936-117744958 CCAACCCAGAGGACGTGCTGCCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1089338994 11:117744949-117744971 CGTGCTGCCCAGAGGGTAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 176
1089338979_1089338994 18 Left 1089338979 11:117744908-117744930 CCTGTCTCACCCCAGCAGGGAGG 0: 1
1: 0
2: 3
3: 30
4: 309
Right 1089338994 11:117744949-117744971 CGTGCTGCCCAGAGGGTAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 176
1089338976_1089338994 24 Left 1089338976 11:117744902-117744924 CCAGGGCCTGTCTCACCCCAGCA 0: 1
1: 0
2: 10
3: 56
4: 395
Right 1089338994 11:117744949-117744971 CGTGCTGCCCAGAGGGTAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 176
1089338985_1089338994 8 Left 1089338985 11:117744918-117744940 CCCAGCAGGGAGGGCGGGCCAAC 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1089338994 11:117744949-117744971 CGTGCTGCCCAGAGGGTAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 176
1089338984_1089338994 9 Left 1089338984 11:117744917-117744939 CCCCAGCAGGGAGGGCGGGCCAA 0: 1
1: 0
2: 1
3: 13
4: 236
Right 1089338994 11:117744949-117744971 CGTGCTGCCCAGAGGGTAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 176
1089338986_1089338994 7 Left 1089338986 11:117744919-117744941 CCAGCAGGGAGGGCGGGCCAACC 0: 1
1: 0
2: 1
3: 18
4: 178
Right 1089338994 11:117744949-117744971 CGTGCTGCCCAGAGGGTAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089338994 Original CRISPR CGTGCTGCCCAGAGGGTAGG TGG Intronic
900227151 1:1538635-1538657 TGTGCTGGGCACAGGGTAGGGGG - Intronic
900488678 1:2935571-2935593 CGTGCAGCCCAGGGAGTAAGTGG - Intergenic
901190998 1:7409621-7409643 CCAGCTGCCCACGGGGTAGGAGG + Intronic
901429166 1:9201984-9202006 GGTCCTTCGCAGAGGGTAGGTGG + Intergenic
901742373 1:11350699-11350721 CGGGCTGCCCTGTTGGTAGGTGG + Intergenic
902310489 1:15578224-15578246 CATTCTGCCTAGAGGGTACGAGG + Intronic
904592025 1:31620219-31620241 CCTGCACCCCAGAGGGCAGGGGG + Intronic
904846970 1:33427146-33427168 CGTGCTGCCAAGAGGTTGTGTGG + Intronic
905907877 1:41631647-41631669 GATGCTGCCCTGGGGGTAGGAGG - Intronic
906567947 1:46813890-46813912 CCTGCTAAGCAGAGGGTAGGAGG - Exonic
906943394 1:50275493-50275515 GGGGCTGCCCCGAGGGAAGGGGG + Intergenic
909433418 1:75615541-75615563 CCCACTGCCCAGAGGCTAGGAGG + Intergenic
915653195 1:157334746-157334768 GATGCTGAGCAGAGGGTAGGGGG - Intergenic
915684369 1:157616754-157616776 GATGCTGAGCAGAGGGTAGGGGG + Intergenic
917297861 1:173540487-173540509 GGTGGTGGGCAGAGGGTAGGGGG + Intronic
920164231 1:204024382-204024404 TGAGATGCCCAGAGGGCAGGTGG - Intergenic
920307521 1:205028618-205028640 CCTGCTACCCAGAGCGGAGGAGG - Intergenic
922616732 1:226965223-226965245 GGCCCTGCCCAGAGGGGAGGAGG - Exonic
1064266924 10:13832716-13832738 CCTGCAGGCCAGGGGGTAGGTGG + Intronic
1064268698 10:13846658-13846680 GGGCCTGCCCAGAGAGTAGGTGG + Intronic
1066026189 10:31362387-31362409 CTCGCTTCCCAGAGTGTAGGGGG + Intronic
1069914868 10:71781268-71781290 CCTGCTGCCCAGAGCTTATGAGG + Intronic
1076474399 10:130742370-130742392 TGTGCTGGCCACAGGGCAGGAGG + Intergenic
1076756880 10:132577194-132577216 CGTGGTGCCCTGAGTGCAGGTGG + Intronic
1081569371 11:44280061-44280083 CTTTCTCCCCAGTGGGTAGGAGG - Intronic
1083665436 11:64271668-64271690 TGTGCTGCCCAGAGGTTGGGGGG + Exonic
1084289512 11:68152775-68152797 CGTGCTGCAGAGAGGGGAAGGGG - Intergenic
1085402941 11:76245455-76245477 GCTGAAGCCCAGAGGGTAGGAGG + Intergenic
1088572761 11:111239584-111239606 CCAGCTGGCCAAAGGGTAGGAGG - Intergenic
1089338994 11:117744949-117744971 CGTGCTGCCCAGAGGGTAGGTGG + Intronic
1090629466 11:128633523-128633545 CAGGCTGCCCAGAGCATAGGAGG - Intergenic
1090718499 11:129451753-129451775 CTGGCTGCCCAGAGGTCAGGAGG - Exonic
1091589720 12:1836054-1836076 CGTGCTGCCCAGAGGCTCCCAGG + Exonic
1095976508 12:47943870-47943892 CCTGCTTCCCAGAGGGCATGGGG - Intergenic
1103929468 12:124441806-124441828 CGTGATGCCCACATGATAGGGGG - Intronic
1107834499 13:44402747-44402769 TGTGCTTCCGAGAGGGTTGGAGG - Intergenic
1108573751 13:51773622-51773644 TGTGCTGCTCAGAGGGAATGAGG - Intronic
1115718242 14:36129326-36129348 CAGGCTGCCCCCAGGGTAGGAGG - Intergenic
1119433584 14:74583939-74583961 TGTGTTGCTCAGAGGGCAGGAGG - Intronic
1121625706 14:95384213-95384235 GGTGCTGCCCAGAGGGTGAGTGG - Intergenic
1122800279 14:104225870-104225892 CGGGCTGCTCAGAGTGAAGGTGG + Intergenic
1122800303 14:104225975-104225997 CGGGCTGCTCAGAGTGAAGGTGG + Intergenic
1122943046 14:104991606-104991628 GATGCTGCGCAGAAGGTAGGCGG + Exonic
1123070921 14:105642153-105642175 CCTGAGGCCCAGAGGGCAGGAGG + Intergenic
1123090586 14:105740437-105740459 CCTGAGGCCCAGAGGGCAGGAGG + Intergenic
1123096216 14:105768187-105768209 CCTGAGGCCCAGAGGGCAGGAGG + Intergenic
1124157008 15:27234850-27234872 CCTGCTGCCCAGATGGTGAGAGG + Intronic
1125920416 15:43522160-43522182 CGTGCTGCCCAATGGGAAGGAGG + Exonic
1126735670 15:51729886-51729908 AGTGTTGAACAGAGGGTAGGTGG - Intronic
1127758327 15:62113954-62113976 TGTCCTGCCCTGAGGGCAGGTGG - Intergenic
1128455253 15:67828180-67828202 CCTGCCGCGCACAGGGTAGGTGG - Intronic
1130076155 15:80692347-80692369 CGTGCTGCCCAGGGGATAAGAGG - Intronic
1132147417 15:99436993-99437015 GGTGCTGGACAGAGGGGAGGAGG - Intergenic
1133271707 16:4613738-4613760 TGTGCTGCCCAGAGGCTACCTGG - Intronic
1133388834 16:5392798-5392820 CCTGCTGCCCACAGGGTCAGGGG - Intergenic
1133416314 16:5609820-5609842 GGAGCTGCGGAGAGGGTAGGTGG + Intergenic
1134063439 16:11212381-11212403 CGCACTGCCCAGAGGGCAGAAGG + Intergenic
1136153713 16:28368314-28368336 CGGGCTACCTAGAGGGCAGGGGG - Intergenic
1136209379 16:28746956-28746978 CGGGCTACCTAGAGGGCAGGGGG + Intergenic
1136347349 16:29684681-29684703 GGTGGTGCCCAGAGGGTGGTAGG - Intronic
1137564503 16:49524782-49524804 CCTGCTGCCCAGATGGCAGCCGG - Intronic
1137765488 16:50974692-50974714 AGTGCTGCCCAGAGGATGGAAGG + Intergenic
1138527268 16:57616346-57616368 GGTGCTGCCCACAAGGTCGGGGG - Intronic
1140409769 16:74734614-74734636 CCTGCTGCCCAGAGGGTGGGCGG + Intronic
1141242303 16:82275102-82275124 GGTCCTGCCAATAGGGTAGGTGG + Intergenic
1141324170 16:83039858-83039880 GGTGCTGACCATAGGGTAGGTGG - Intronic
1141376237 16:83533411-83533433 CCTGCTGCCCACAGAGGAGGAGG - Intronic
1141560810 16:84866635-84866657 CAGGCTGCCCAGAGGTTAGCAGG - Intronic
1141940725 16:87274232-87274254 CCTGCAGCCCGGGGGGTAGGGGG + Intronic
1142099074 16:88261992-88262014 CGTCCTGCACAGATGGTGGGAGG - Intergenic
1142142542 16:88478999-88479021 TGGGCTCCCCAGTGGGTAGGTGG + Intronic
1142380705 16:89730392-89730414 CTTGCTGCCCAGAAGGTCTGGGG + Intronic
1142434295 16:90047213-90047235 CGAGCTGCCCAGGGGACAGGGGG + Intergenic
1143014019 17:3882287-3882309 CTTGCTGCTCAGAGGGAAGCAGG + Exonic
1143099766 17:4498759-4498781 CGTGCTGCCCTGGGGGTGGGGGG - Intergenic
1144485019 17:15657078-15657100 GGTGGTGACCATAGGGTAGGTGG - Intronic
1145971654 17:28959807-28959829 AGTGGTACCCACAGGGTAGGTGG + Exonic
1147424989 17:40342113-40342135 GGTGGTGCCCGGAGGGGAGGGGG + Intronic
1150127503 17:62647884-62647906 CGTGCTGCCCGCTGGGTAGTTGG - Intronic
1151825564 17:76522106-76522128 CCTGCTGCCCTGTGGGTGGGTGG + Intergenic
1152386873 17:79980011-79980033 TGGGCTGCCCAGAGGGTCTGGGG - Intronic
1152884570 17:82842062-82842084 CGTGCTGCCCAGATGCAAGGCGG + Intronic
1157453048 18:47802119-47802141 CTTCCTGCCCAGAGGCTAGAAGG - Intergenic
1158867875 18:61655458-61655480 CGTTCGGCCCAGAGGATATGGGG - Intergenic
1160371819 18:78378489-78378511 TGTGCTGCTCAGAAGGTAGCCGG + Intergenic
1160455652 18:78997165-78997187 CATGCTGCCCAGAGGGGGGAGGG - Exonic
1160773978 19:846407-846429 CGGGCTGCCATGAGGGGAGGAGG + Intronic
1162295501 19:9810828-9810850 GGTGCTGCTCAGAGGGTCTGGGG + Exonic
1162810745 19:13163201-13163223 CTTGCGGCCCAGCGGGAAGGCGG + Intergenic
1163235315 19:16026258-16026280 TGTGCTGCCCAGAGGCTTCGAGG + Intergenic
1163290691 19:16377355-16377377 TGTGCAGTCCAGAGGGTAGGAGG - Intronic
1164180402 19:22813398-22813420 TGTGCTGCCCCTAGGGTTGGAGG + Intergenic
1165775838 19:38403798-38403820 GGGGCGGCCCAGAGGGTACGAGG + Intronic
1166000904 19:39876927-39876949 CGTGCTGGCCGGATGGCAGGAGG + Exonic
1166003685 19:39893180-39893202 CGTGCTGGCCGGATGGCAGGAGG + Exonic
1168102107 19:54146779-54146801 AGTGCTGCCCTGAGGGCAGGTGG + Intronic
925412603 2:3648550-3648572 GGTGCTGCCCACAGAGTGGGTGG + Intergenic
925921648 2:8642453-8642475 CTTGCAGCACAGATGGTAGGAGG - Intergenic
926041216 2:9674716-9674738 CATGCTTCCCAGAAGGGAGGAGG + Intergenic
929031328 2:37652295-37652317 CGTTCTGCCCAGAAGGAAGAAGG + Intronic
929201659 2:39243630-39243652 GGTGCTGCCCAGGGAGTGGGCGG - Intergenic
937616441 2:123928209-123928231 TGTCCAGCCAAGAGGGTAGGGGG - Intergenic
938245784 2:129776781-129776803 GGTGCTGTTCAGAGGGCAGGGGG - Intergenic
941744453 2:169071644-169071666 CCTGCTTCCCTGAGGGCAGGAGG - Intronic
942248235 2:174026338-174026360 CTGGCTGCCCACAGGGTTGGTGG - Intergenic
942850175 2:180474920-180474942 CCAGCTGCCCTGAGGCTAGGGGG - Intergenic
946413358 2:219526721-219526743 GGTGCTGGCCAGAAGGAAGGTGG + Intronic
947463585 2:230323170-230323192 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947472421 2:230411733-230411755 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
948752177 2:240139203-240139225 CGTGCTCCCCAGGGGGAAGTGGG + Exonic
948873468 2:240815450-240815472 CGGGAGGCCCAGAGGGAAGGGGG + Intronic
1168880057 20:1198827-1198849 GGAGGTGCCCAGAGGGAAGGTGG - Intergenic
1172098637 20:32472962-32472984 CCTGCTGCCCAGAGGCTGGCTGG - Intronic
1175737927 20:61400026-61400048 CGTGCTGCCCAGCTGTAAGGGGG - Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1178830347 21:36051131-36051153 TGAGCTGGCCAGAGGGTAGAAGG - Intronic
1179522585 21:41954460-41954482 CGTGCTTCTCAGAGGCAAGGAGG + Intergenic
1179635157 21:42704043-42704065 CGTGCTGCCGTGAGGGCTGGCGG - Intronic
1179824844 21:43957866-43957888 AGTGCTGCCAAGAGTGGAGGGGG + Intronic
1180185415 21:46136872-46136894 TGTGGGGCCCGGAGGGTAGGTGG - Intronic
1180840265 22:18955806-18955828 GGCGCTGCCCAGAGGGGAGGTGG + Intergenic
1181061607 22:20284560-20284582 GGGGCTGCCCAGAGGGGAGGTGG - Intergenic
1181311347 22:21946526-21946548 CGTGGTGACCAGATGGCAGGAGG + Intronic
1181461887 22:23090546-23090568 GCTGGTGCCAAGAGGGTAGGAGG - Intronic
1183859302 22:40657873-40657895 CGTGGTGCCCACAGGGAAAGTGG + Intergenic
1185170402 22:49290514-49290536 CGTGCTCACTAGAGGGGAGGTGG + Intergenic
1185371738 22:50464177-50464199 TGGGCTGGCCGGAGGGTAGGTGG - Intronic
950307638 3:11928675-11928697 CGTGCTCACCAGAAGGCAGGTGG - Intergenic
950487010 3:13279865-13279887 AGGGCTGCCCAGAGGCTAGGTGG - Intergenic
950897843 3:16469612-16469634 CGTGCTCCACAGAGGGAAGGGGG + Intronic
952155223 3:30636444-30636466 CCTGGTGCCCAGAGGCTATGTGG + Intronic
953175997 3:40552521-40552543 AGGGTTGCCCATAGGGTAGGAGG + Intronic
954867952 3:53745605-53745627 CGTGCTGCGGAGAGGGCAGAGGG - Exonic
956075225 3:65497978-65498000 CGGGCTGCTCAGAGGATAGCTGG - Intronic
956250378 3:67229007-67229029 TGTGCTCCCCAGTGGGTAGGTGG + Intergenic
958145290 3:89615443-89615465 AGAGCTGCTCAGAAGGTAGGAGG - Intergenic
961329494 3:126130339-126130361 CTTGCTGCCTAGAGGGGAAGGGG - Intronic
961560235 3:127723597-127723619 AGTGCTGCTGAGAGGGTAGTGGG - Intronic
961568887 3:127784391-127784413 GGTGCTGCTCAGAGGCTAAGTGG + Intronic
961621262 3:128226853-128226875 TGTGGTGCACAGAGGGTAGCTGG + Intronic
961652797 3:128425724-128425746 CCTGCTGCCCACAGGACAGGAGG - Intergenic
966886594 3:184380565-184380587 CGGGCGGCCCGGAGGGTGGGCGG + Intronic
967493737 3:190120806-190120828 CGCGCTTCCCCGAGGGAAGGTGG - Exonic
968647243 4:1747006-1747028 CGTGCTGCCCATAGGGCAGCTGG - Intergenic
969518936 4:7664690-7664712 CGTGGTGGCCAGAAGGGAGGTGG - Intronic
972466959 4:39366443-39366465 GGTGCTGCCCCGAGGGCAGGCGG + Intergenic
973606061 4:52588800-52588822 CGTCCTGCCCACGGGGTTGGTGG - Intergenic
975656413 4:76645447-76645469 CGTGCTGCCCAGGTGGGACGTGG - Intronic
976806439 4:89052461-89052483 AGTGCTACCCAGGGGGTGGGGGG - Intronic
977304845 4:95310264-95310286 GGTGGTTCACAGAGGGTAGGGGG + Intronic
997625260 5:135326951-135326973 GGTCCTGCTCAGAGGGTGGGTGG + Intronic
999890601 5:155974885-155974907 AGTACTGCCCAGAGGATGGGGGG - Intronic
1002053800 5:176586809-176586831 CGTGCTGCCCAACCGGGAGGTGG + Exonic
1002533545 5:179863715-179863737 CGTGCTGACCACCGAGTAGGAGG + Exonic
1002850443 6:990689-990711 GGTCCTGGTCAGAGGGTAGGAGG + Intergenic
1003148078 6:3525842-3525864 TGGGCTGCCCAGAGGACAGGAGG - Intergenic
1003503834 6:6724326-6724348 CCTGCTGGCCAGAGGGGATGCGG - Intergenic
1006146842 6:31964393-31964415 GGGGCTGCCCAGAGGGCAGAGGG + Intronic
1006506697 6:34493651-34493673 AGTGCTCCCCAATGGGTAGGAGG + Intronic
1007679207 6:43622804-43622826 ACTGCAGCCCAGAGGGCAGGTGG + Exonic
1010141541 6:72620413-72620435 TCTGCTGCCCAGAGGCTTGGGGG + Intergenic
1010244244 6:73648564-73648586 CATGCAGCCCAGTGGGTAGATGG - Intronic
1015926023 6:138311393-138311415 CGTGCCGCCCCTAGGGGAGGTGG + Exonic
1018800861 6:167221488-167221510 TGGGCAGCCCAGAGGGCAGGTGG - Intergenic
1019578383 7:1748567-1748589 CGTGCTGCCTGGAGGGGTGGTGG - Intergenic
1019971831 7:4547780-4547802 CGTCCAGCCCAGAGAGCAGGGGG - Intergenic
1022905306 7:34849895-34849917 GGTGCTGGCCAGTGGGAAGGAGG - Intronic
1023802200 7:43844820-43844842 AGTGCTGCCCAGTGGGATGGGGG + Intergenic
1025782116 7:64611148-64611170 GGTGCTGCCCACAGGGGAGATGG + Intergenic
1027234038 7:76287275-76287297 CTTGGTGCCCGGATGGTAGGTGG + Exonic
1030873169 7:114782322-114782344 CATGCTGCCCTGAGAGCAGGAGG - Intergenic
1031973415 7:128079376-128079398 CTGGCTGGCCAGAGGGGAGGAGG - Intronic
1032128467 7:129211271-129211293 AGAGCCCCCCAGAGGGTAGGAGG - Intronic
1034068079 7:148155864-148155886 CCTGTGGCCCAGAGGGTATGTGG + Intronic
1034270308 7:149800447-149800469 CCTGCTGTCCTGTGGGTAGGGGG + Intergenic
1034551154 7:151821513-151821535 CGGGCTGCCCAGGTGGTAGAAGG + Intronic
1035716036 8:1755609-1755631 CGGTCTGCCCAGAGGGCTGGGGG + Intergenic
1037344383 8:17882493-17882515 CTTGATGCCCAGTGGGTAAGCGG + Intronic
1046268302 8:111859663-111859685 GCTGCTGCCCGGAGGGTTGGGGG + Intergenic
1046909626 8:119611552-119611574 TGTGCTTCCCCTAGGGTAGGTGG - Intronic
1047731707 8:127734153-127734175 GGTGCTGCCCAGAGAGGGGGCGG + Intergenic
1048119560 8:131564036-131564058 CGTGGAGCCCAGAGGGTTTGGGG - Intergenic
1048277516 8:133078017-133078039 AGTGCTGCCCTGAGGGCAGTTGG + Intronic
1049344960 8:142133948-142133970 GGAGCTGCCCAGAGGGCTGGGGG + Intergenic
1049469136 8:142767603-142767625 TGTTTTGCCCAGAGGGCAGGAGG - Intronic
1049544134 8:143221674-143221696 CGCGCTCCCCAGACGGCAGGCGG - Intergenic
1056492289 9:87119773-87119795 GGTGCTGCCCAGAGCGTGGAGGG - Intergenic
1056839684 9:89988342-89988364 AGCGCTCCCCAGAGGGTTGGTGG - Intergenic
1060333692 9:122700841-122700863 AGTGCTTGCCAGAGGCTAGGAGG - Intergenic
1061169132 9:128941833-128941855 GCTGCTGCCCACAGGGCAGGAGG - Exonic
1061858462 9:133455820-133455842 AGAGCAGCCCAGAGGCTAGGGGG - Intronic
1062264388 9:135680007-135680029 AGTGCTGACCTGGGGGTAGGGGG - Intergenic
1062712344 9:137983358-137983380 TGTCCTGTCCAGAGGGAAGGTGG + Intronic
1189796566 X:44651447-44651469 GGGGCTGCCCAGAGGGGAGCTGG + Intergenic