ID: 1089339214

View in Genome Browser
Species Human (GRCh38)
Location 11:117746249-117746271
Sequence CTTATATAGCACTATGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 2, 1: 1, 2: 13, 3: 43, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089339214_1089339216 21 Left 1089339214 11:117746249-117746271 CCTGGCACATAGTGCTATATAAG 0: 2
1: 1
2: 13
3: 43
4: 170
Right 1089339216 11:117746293-117746315 CAGCATTTTGCAAATGTGTTAGG 0: 1
1: 0
2: 3
3: 28
4: 304
1089339214_1089339217 29 Left 1089339214 11:117746249-117746271 CCTGGCACATAGTGCTATATAAG 0: 2
1: 1
2: 13
3: 43
4: 170
Right 1089339217 11:117746301-117746323 TGCAAATGTGTTAGGTGCCTTGG 0: 1
1: 0
2: 0
3: 17
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089339214 Original CRISPR CTTATATAGCACTATGTGCC AGG (reversed) Intronic
901458804 1:9379103-9379125 CTTAAATGGCACCATGTGCCAGG - Intergenic
901909062 1:12439701-12439723 CTTACTTAGCACTATTTGCCAGG - Intronic
902131813 1:14268238-14268260 CTTACAGAGCACTATGTACCAGG - Intergenic
902508884 1:16954912-16954934 CCTAAATGGCACTGTGTGCCTGG + Intronic
903469558 1:23576408-23576430 TTCATGTAACACTATGTGCCAGG + Intergenic
904334591 1:29788358-29788380 TTTATTGAGCACTATGTACCAGG + Intergenic
904539947 1:31226069-31226091 CTTATCAAGCACTATGTGCCAGG - Intronic
904542911 1:31245599-31245621 CTTATCAAGAACTATGTGCCAGG + Intergenic
905840333 1:41171167-41171189 CTGATATGGCACTATTTCCCAGG + Intronic
906953971 1:50357466-50357488 GTTATGTAGCCCTTTGTGCCAGG - Intergenic
907381516 1:54094706-54094728 TTTATTCAGCACTATGTGCCAGG - Intronic
909580415 1:77227296-77227318 TTTATTAAGCACTATGTACCAGG + Intergenic
909782994 1:79572712-79572734 CTTGTGTAGTACTATTTGCCAGG - Intergenic
910825174 1:91399110-91399132 CTTACTGAGTACTATGTGCCAGG + Intronic
911269337 1:95781396-95781418 ATTTTTGAGCACTATGTGCCTGG + Intergenic
912768154 1:112435374-112435396 CTTATTTACCACTATATCCCAGG + Intronic
916152788 1:161812094-161812116 TTAATAAAGTACTATGTGCCAGG + Intronic
916804898 1:168249927-168249949 CTTATCTAGTACTATGTGCCCGG + Exonic
918003735 1:180522685-180522707 TTTATTGAGCACCATGTGCCAGG - Intergenic
918391438 1:184067470-184067492 CTTACTTAGCACCATGTACCAGG - Intronic
924122176 1:240812236-240812258 TTTATTGAGCATTATGTGCCAGG + Intronic
1063073807 10:2694388-2694410 ATTATCTAGGAATATGTGCCAGG + Intergenic
1067923110 10:50480323-50480345 TTTATTTAGCACTAACTGCCAGG - Intronic
1069059518 10:63880723-63880745 CTTGAATAGCACTATAGGCCAGG - Intergenic
1069560519 10:69426171-69426193 CTTATTTAGCCCTTTGTGTCAGG - Intergenic
1069846019 10:71372220-71372242 CTTATTGAGCACTATGAACCGGG + Intergenic
1070246933 10:74741020-74741042 CTTATATGCTACTGTGTGCCAGG - Intergenic
1071449529 10:85780860-85780882 TTTATAAAACACTATGTGCCAGG - Intronic
1072156881 10:92731581-92731603 TTTATAAAACACTGTGTGCCAGG - Intergenic
1075303187 10:121343699-121343721 ATTATATACCACTATGTCCTAGG - Intergenic
1076249210 10:128971891-128971913 CTTGTATAGCCCTAAGTGCGGGG - Intergenic
1078123814 11:8538222-8538244 CTTAAATAGCATGATGTGTCAGG + Intronic
1078552972 11:12293187-12293209 CTTATCTTCCCCTATGTGCCTGG + Intronic
1079138514 11:17791821-17791843 TTTATGTAGTACTATGTGCCAGG - Intronic
1079170319 11:18087949-18087971 CTAATGTAGCACTATGGGCTAGG + Intronic
1081400877 11:42641363-42641385 CTTATATAGTCTTATGGGCCAGG + Intergenic
1081832435 11:46124856-46124878 ATTATACAGTTCTATGTGCCAGG - Intergenic
1082079674 11:48002509-48002531 CTTATTGAGCACTTTGTGCTAGG + Intronic
1082122719 11:48396705-48396727 CCTACAAAGCACTATGTGCTAGG - Intergenic
1082205768 11:49432277-49432299 CTCATATACCACTGTATGCCAGG + Intergenic
1085011480 11:73144201-73144223 CTTATTAAGCACTACATGCCAGG - Intergenic
1085381411 11:76122516-76122538 CTTATTTATTACTAAGTGCCAGG - Intronic
1086435918 11:86781214-86781236 CTTATATAGCACTATGTAACAGG + Intergenic
1086582792 11:88418590-88418612 CTGTTTTAGCACTCTGTGCCAGG + Intergenic
1086649327 11:89268220-89268242 CTCATATACCACTGTATGCCAGG - Intronic
1088335366 11:108697977-108697999 CTAATTTAGCCTTATGTGCCTGG + Intronic
1088453473 11:110008132-110008154 CTCATGCAGCACTATGTGCTAGG + Intergenic
1088621966 11:111694061-111694083 GTTAACTAGCACTGTGTGCCGGG - Intronic
1089339214 11:117746249-117746271 CTTATATAGCACTATGTGCCAGG - Intronic
1089813279 11:121149022-121149044 CTTAGCTCTCACTATGTGCCAGG + Intronic
1090711747 11:129392549-129392571 CTGGTATAATACTATGTGCCAGG + Intronic
1092899169 12:13042698-13042720 CTTAGAAAACACTAAGTGCCAGG + Intergenic
1093114423 12:15191853-15191875 CTGATAAAGCAGTAAGTGCCAGG - Intronic
1095441224 12:42240034-42240056 TTTTTTGAGCACTATGTGCCAGG + Intronic
1095448667 12:42306600-42306622 CATATTTAGCACTATGTTTCAGG - Intronic
1095909698 12:47413871-47413893 CTTATTAAGCACTATGTACCAGG + Intergenic
1095943894 12:47743131-47743153 CTTATGTATCACTATGTGCCGGG + Intronic
1096135841 12:49199888-49199910 CTCATATAACACTGTGTTCCAGG + Intronic
1096459278 12:51813423-51813445 CTTATTGCGCACTGTGTGCCAGG - Intergenic
1097291039 12:57915128-57915150 ATTATCAAGAACTATGTGCCAGG - Intergenic
1097995624 12:65884911-65884933 CACATATAGCACTATGTGCCAGG - Intronic
1100533385 12:95481565-95481587 CATTTATAGAACTTTGTGCCAGG - Intronic
1100675556 12:96863130-96863152 CAAATATAGACCTATGTGCCAGG - Intronic
1100914018 12:99397751-99397773 CTTAAATGACACTATGTGTCAGG - Intronic
1104062427 12:125279908-125279930 CTTAAATTACACAATGTGCCAGG + Intronic
1104127156 12:125858773-125858795 GTTATCAAACACTATGTGCCAGG - Intergenic
1105003149 12:132704108-132704130 CTTTCATAGCACCACGTGCCAGG + Intronic
1107429030 13:40322191-40322213 TTTATATCATACTATGTGCCAGG - Intergenic
1108754103 13:53478922-53478944 TTTACTGAGCACTATGTGCCAGG + Intergenic
1110480212 13:75965041-75965063 ATTATATAGCACTAATTTCCAGG - Intergenic
1110546679 13:76763951-76763973 TTTATTGAGAACTATGTGCCTGG + Intergenic
1110849738 13:80231664-80231686 TTTATTGAGCACTATGTGCTAGG + Intergenic
1114392137 14:22321102-22321124 CTTATGTAACACTACGTGCCAGG - Intergenic
1114810676 14:25895215-25895237 CTTATAGAGCCCTATGTGCCAGG - Intergenic
1114990568 14:28282372-28282394 CTTATGTAGTACTATGTATCTGG - Intergenic
1115334591 14:32232137-32232159 CTTATATAGCATTAAGTGCCAGG - Intergenic
1115610369 14:35043354-35043376 CTTATGGAGCACAATATGCCAGG - Intergenic
1120716407 14:87845757-87845779 ATTATATAACTCTATGTGCATGG + Intronic
1121199102 14:92102668-92102690 CTTCTACAGCACTATCTGCCAGG + Intronic
1125806954 15:42501759-42501781 TTTATTGAGCACTGTGTGCCAGG + Intronic
1126347212 15:47708917-47708939 CTTATAGAGCACTATGTGGTAGG - Intronic
1130180045 15:81617571-81617593 CTTATATCACACTGTGTTCCAGG - Intergenic
1130345635 15:83042310-83042332 ATTATTAAGCACTACGTGCCAGG + Intronic
1130559353 15:84946371-84946393 CTTATGTGGCACTGTGTGCCAGG + Intergenic
1132123387 15:99197513-99197535 CATATTTAGCACTATGTATCAGG + Intronic
1133273502 16:4623287-4623309 CTTACTGAGCATTATGTGCCAGG - Intronic
1134301685 16:12997226-12997248 CATATATAGCCCTTTGTGCCTGG + Intronic
1136057899 16:27704134-27704156 CATATATACCTCTGTGTGCCAGG - Intronic
1137705488 16:50532966-50532988 CTTACACAGCAGTAGGTGCCCGG - Intergenic
1138015620 16:53425748-53425770 CTAATTTAGGAGTATGTGCCTGG - Intergenic
1138887468 16:61097044-61097066 CTTAAATAGGAATATGTGCTTGG - Intergenic
1138966672 16:62092999-62093021 CTTATTAATCACTATGTGCCAGG - Intergenic
1139735958 16:68988469-68988491 CTTGAGTAGCACTATGTGCATGG - Intronic
1145742760 17:27289938-27289960 CATATATAGTACTCTGTGTCAGG + Intergenic
1151203371 17:72485731-72485753 ATCATATTCCACTATGTGCCAGG - Intergenic
1152972685 18:179345-179367 CTTATATAGTACTATCTGCCAGG - Intronic
1157427006 18:47592726-47592748 CTTTTCTAGATCTATGTGCCAGG + Intergenic
1158331981 18:56372751-56372773 CTTACTGAGCACTATGAGCCAGG + Intergenic
1158589819 18:58769785-58769807 CTTACAGAGCGCTATGAGCCTGG + Intergenic
1160337410 18:78054737-78054759 CTTACCGAGCACTGTGTGCCAGG - Intergenic
1162486766 19:10965368-10965390 ACTGTTTAGCACTATGTGCCAGG - Intronic
1166101662 19:40575254-40575276 GTTACATAGCAATATGTGCCAGG - Intronic
1168556812 19:57350340-57350362 TGTATTTAGCACGATGTGCCAGG + Intergenic
925827719 2:7866289-7866311 ACTATATAGCACCATCTGCCAGG - Intergenic
926897389 2:17708951-17708973 TTTATATAATACTATGTGCTAGG + Intronic
927831522 2:26355111-26355133 CTTATACAGCACTATGTGCCAGG - Intronic
927905557 2:26853395-26853417 CTTTCAAAGCACTCTGTGCCAGG + Intronic
928818853 2:35335452-35335474 CTTATCTAGCTCTATTTGGCAGG - Intergenic
930584549 2:53253927-53253949 CTTGGATCTCACTATGTGCCAGG + Intergenic
930767579 2:55099859-55099881 CTTACACAGCCCTATGTGCCAGG - Intronic
931851700 2:66258026-66258048 CTTAGATTGCATTATGTGCTGGG - Intergenic
932162076 2:69469804-69469826 CTGATGTAGGACTGTGTGCCAGG + Exonic
934929889 2:98413618-98413640 CTTAAATAATACTGTGTGCCTGG + Intergenic
935036503 2:99380521-99380543 CTGATATAGCAGGATGTTCCCGG + Intronic
936652212 2:114440633-114440655 CTTAGATAGCACTTTGTACTAGG - Intergenic
937005832 2:118513076-118513098 CTTACATAACACTACATGCCAGG + Intergenic
937992150 2:127670369-127670391 ATTATATAGCCTTTTGTGCCTGG - Intronic
938672337 2:133598227-133598249 CTTATGTGGCACAGTGTGCCAGG - Intergenic
939977940 2:148741307-148741329 CTTATATAGTACTATGGGCAAGG - Intronic
940722459 2:157297338-157297360 TTTATTGAGCACTCTGTGCCAGG + Intronic
941469495 2:165866817-165866839 CTTATATAGCATTATGGCCAGGG + Intronic
941914252 2:170799098-170799120 CTTACATAGGACTGTGTGCCAGG + Intergenic
942973324 2:181983419-181983441 CTTATATGATACCATGTGCCAGG - Intronic
944240073 2:197477711-197477733 CTTACATAGCACTAGATGCCAGG + Intergenic
944823033 2:203450571-203450593 CTTATTGAGAACTATTTGCCAGG + Intronic
947083343 2:226422959-226422981 CTTAGTGATCACTATGTGCCAGG - Intergenic
1170021526 20:11841594-11841616 CTTGAATAGTGCTATGTGCCAGG + Intergenic
1171144153 20:22767051-22767073 CTGACATAGGACTATGTGCCAGG + Intergenic
1173027089 20:39318375-39318397 TTTATATAGAGCTATGTGCCAGG - Intergenic
1173659924 20:44726167-44726189 CTGATATAGTACCATGTGCCAGG - Intronic
1173833124 20:46105551-46105573 CTTATTTAGCATTAAGTGGCAGG - Intergenic
1173913459 20:46688538-46688560 TTTATTGGGCACTATGTGCCAGG + Intronic
1174024952 20:47566374-47566396 ATTATATAGCGCTATCTGTCTGG + Intronic
1175499909 20:59442241-59442263 CTTTCAAAGCACTATGTTCCAGG + Intergenic
1178718966 21:34991500-34991522 CATAGCTATCACTATGTGCCCGG + Intronic
1183384376 22:37506489-37506511 CTTACTGAGCACTGTGTGCCGGG + Intronic
1183601430 22:38842731-38842753 CTTATAGGGCACTCTGTTCCCGG + Intronic
951000375 3:17552560-17552582 CTTATTTAGTACTATGTCCTAGG - Intronic
952793481 3:37218463-37218485 CTCATATTGCACTATTGGCCTGG - Intergenic
953819478 3:46192469-46192491 CTTACATGGTACTATGTGCCAGG + Intronic
955234294 3:57125874-57125896 CTTATCAAGGACTATGTGTCAGG - Intronic
955704080 3:61710321-61710343 TTGATATTTCACTATGTGCCAGG + Intronic
957163288 3:76637467-76637489 CTTATATCCCACCAAGTGCCTGG + Intronic
957367637 3:79246946-79246968 CTTATAAAGCACTTTATGCCTGG + Intronic
957894506 3:86403851-86403873 CTTATTGAGCACTATGTACTAGG + Intergenic
959353159 3:105294121-105294143 GTTATTGAGCAGTATGTGCCAGG - Intergenic
959976765 3:112469665-112469687 TTTATATAACACCATGTGCCAGG - Intronic
962458039 3:135583322-135583344 TTTATTGAGCACTTTGTGCCAGG - Intergenic
962499309 3:135973786-135973808 CTAATTTATCACTATGTGCCAGG + Intronic
963354225 3:144189905-144189927 ATTATATACTACTATGTGCCAGG - Intergenic
964571405 3:158110557-158110579 CTTATATTGCAAGATGAGCCAGG - Intronic
965608770 3:170523085-170523107 CTTATTTAGTGCTATGTGCTCGG + Intronic
966017152 3:175154559-175154581 CTTACATAGCACTATGTACTAGG - Intronic
966121506 3:176526529-176526551 TTTATTGAGCAGTATGTGCCAGG + Intergenic
966747806 3:183295116-183295138 CTTAGATAACACCAAGTGCCTGG - Intronic
967592733 3:191297743-191297765 TTTAACTAACACTATGTGCCAGG - Intronic
969829688 4:9784927-9784949 TTTATTAAGCACTATGTGCCAGG - Intronic
972146100 4:36027644-36027666 TTAATATGGCACTATTTGCCTGG + Intronic
972968802 4:44547059-44547081 TTTATTGAGCACTATGTGCCAGG + Intergenic
973332744 4:48925911-48925933 CTTATGTATTACTATGTGCCAGG - Intergenic
974558280 4:63481397-63481419 TTGATATAGCATTATGTGCCAGG - Intergenic
976590164 4:86841962-86841984 TTTATTGAGCACTATGTGCTAGG + Intronic
976743784 4:88383415-88383437 TATATATAGTACCATGTGCCAGG + Intronic
976902292 4:90193288-90193310 TTTATTGAACACTATGTGCCAGG - Intronic
977125163 4:93156175-93156197 CTCATATAACACTGTGTTCCAGG - Intronic
977955138 4:103018057-103018079 CATATATTACACTATGTTCCAGG + Intronic
981623348 4:146729006-146729028 ATAATATATCCCTATGTGCCTGG - Intronic
982008124 4:151082449-151082471 CTTACATAGCTCTATGTGTTGGG + Intergenic
982502616 4:156175930-156175952 CTAACATAGCACTACATGCCTGG - Intergenic
983085319 4:163436055-163436077 CCTATAAAGCACTATGTACCAGG - Intergenic
983283893 4:165715177-165715199 CTTATAGAGCAGTATCTTCCAGG - Intergenic
984034103 4:174644660-174644682 TTTATATATGACTATGTTCCAGG + Intronic
984359515 4:178710719-178710741 CTGAGATATCACTATGTGCCAGG - Intergenic
984672464 4:182506459-182506481 CTTTTTAAGCACCATGTGCCAGG - Intronic
988327051 5:29783089-29783111 CATAGATAGCACTATGTGTCAGG + Intergenic
990171914 5:53060973-53060995 ACTATATAGCACTATCTGGCCGG - Exonic
992037042 5:72790110-72790132 CTTAAATACCACTATGTGAAAGG + Intergenic
992400857 5:76410002-76410024 CTTGTTTAGCACTATGTGCCAGG - Intronic
996096977 5:119409294-119409316 CTCATTTAGTACCATGTGCCTGG + Intergenic
996402382 5:123076314-123076336 CTTACATAGTACTATATGCTGGG + Intergenic
998613777 5:143717743-143717765 TTGATATACCACTCTGTGCCAGG - Intergenic
1004486519 6:16071592-16071614 TTGATAGAGTACTATGTGCCAGG + Intergenic
1004529921 6:16444348-16444370 CTAGTATAACACTATGTTCCAGG - Intronic
1005267664 6:24129308-24129330 TTTTTAAAGCACTACGTGCCAGG - Intronic
1005324768 6:24688750-24688772 TCTACATAGCACTATGTGTCAGG + Intronic
1007748090 6:44055471-44055493 AACACATAGCACTATGTGCCAGG - Intergenic
1009337475 6:62510187-62510209 ATTATTGATCACTATGTGCCAGG + Intergenic
1010473509 6:76259344-76259366 CTTATGTAACACTATGTGCCAGG + Intergenic
1010811546 6:80306096-80306118 CTTGCTGAGCACTATGTGCCAGG - Intronic
1011060322 6:83258639-83258661 TATATCTAGCACTATGTGTCAGG + Intronic
1013872167 6:114778068-114778090 CATATATAGCATTATGTATCTGG + Intergenic
1014940090 6:127428117-127428139 CATTTATATCACTATGTGTCCGG + Intergenic
1014989845 6:128061051-128061073 CTTATACATCACTATATGCCAGG - Intronic
1017265258 6:152437841-152437863 CTTATATGGTACTATGTTCTAGG - Intronic
1017681831 6:156872239-156872261 TTTATTGAGCACTAAGTGCCAGG - Intronic
1018894801 6:168006335-168006357 CTTTTAAAGCACAATTTGCCCGG - Intronic
1020386465 7:7609590-7609612 TTTATAGAGCACCATGTGACAGG - Intergenic
1021934383 7:25615478-25615500 TCTATAAAGCACTAAGTGCCAGG - Intergenic
1023472726 7:40542139-40542161 GTTATTTAGCACTATGTGTCAGG + Intronic
1024736725 7:52312996-52313018 CATATATAGCACCATGCCCCAGG - Intergenic
1024975662 7:55111868-55111890 CTTCTACATCACTGTGTGCCAGG + Intronic
1028110717 7:86937787-86937809 TTTATTGAGCACTATGTGACAGG + Intronic
1028456635 7:91044922-91044944 CTGACATAGTGCTATGTGCCAGG + Intronic
1029878024 7:103773942-103773964 CTTATTTAGCACTGTGAGCTAGG + Intronic
1030956610 7:115860707-115860729 CACATCTAACACTATGTGCCAGG + Intergenic
1032008616 7:128325675-128325697 CTTATTTAGCACTTTGTGTTAGG - Intronic
1038843983 8:31211989-31212011 ATTATATAGCATTATGTGCCAGG - Intergenic
1040978676 8:53222180-53222202 CTTGGATATCACTATGTGCTAGG - Intergenic
1042460312 8:69058157-69058179 AATATTTAGCACTTTGTGCCAGG + Intergenic
1044719486 8:95132144-95132166 CTTGTAAAGCACTGTGTGCCAGG + Intergenic
1046878396 8:119280680-119280702 ATTATATATTACTATGTGCTAGG - Intergenic
1055138941 9:72853345-72853367 ATTATTGAGCACTATGTGCCAGG - Intergenic
1055958249 9:81794395-81794417 CTCTTATAGCACTCTGTGCTTGG + Intergenic
1056159992 9:83879575-83879597 CTTATCTAGTACTATGTGCCAGG - Intronic
1056360234 9:85850243-85850265 CTTATCTAGTACTATGTGCCAGG + Intergenic
1056555238 9:87682700-87682722 TTTATAGAGTACTGTGTGCCAGG + Intronic
1057053639 9:91945254-91945276 CTTATATAGCTGTGTGTGCCTGG + Intronic
1058372342 9:104284442-104284464 TATATATACCACTATGTGCCAGG - Intergenic
1058534051 9:105936881-105936903 TTTTTATAGCACTAACTGCCTGG - Intergenic
1058584920 9:106497095-106497117 ATTGTATAGAACTATGTGCGTGG - Intergenic
1059250478 9:112883547-112883569 CTTAAACAGCCCTATGTGCCAGG - Intronic
1190939812 X:55029338-55029360 CTTACAGAGCCCTCTGTGCCAGG + Intronic
1192349052 X:70340271-70340293 CTTCTATAGCATTATGGGCTAGG - Intronic
1194907964 X:99602494-99602516 CTTACACAGCAATATGTCCCAGG + Intergenic
1195724671 X:107902233-107902255 TTTACATAACACTATATGCCTGG - Intronic
1197160950 X:123321290-123321312 CATTTATAGCAATTTGTGCCTGG - Intronic
1198155133 X:133952346-133952368 CTTATATGGCACCATGTGCTAGG - Intronic
1199463787 X:148113316-148113338 CTTATATAGCACTATGTGCCAGG + Intergenic
1200226195 X:154419243-154419265 CTTCTAAACCCCTATGTGCCAGG - Intronic