ID: 1089340275

View in Genome Browser
Species Human (GRCh38)
Location 11:117752629-117752651
Sequence TCCAGACCCATTGTTTCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089340275_1089340279 3 Left 1089340275 11:117752629-117752651 CCCGGGGAAACAATGGGTCTGGA 0: 1
1: 0
2: 0
3: 15
4: 157
Right 1089340279 11:117752655-117752677 AGGATGCTGAGGTTTGCTAAAGG 0: 1
1: 0
2: 0
3: 15
4: 243
1089340275_1089340278 -8 Left 1089340275 11:117752629-117752651 CCCGGGGAAACAATGGGTCTGGA 0: 1
1: 0
2: 0
3: 15
4: 157
Right 1089340278 11:117752644-117752666 GGTCTGGAGTCAGGATGCTGAGG 0: 1
1: 0
2: 8
3: 50
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089340275 Original CRISPR TCCAGACCCATTGTTTCCCC GGG (reversed) Intronic
900310457 1:2030906-2030928 CCTCGACCCACTGTTTCCCCTGG - Intergenic
900405985 1:2493170-2493192 GCCAGACCCGTTGTCACCCCTGG - Intronic
902233806 1:15044979-15045001 TCCAGACACTTTGTTTTCCCAGG + Intronic
902300445 1:15498639-15498661 TCCAGACACATTTCTTCCCTTGG - Intronic
903372991 1:22848834-22848856 TCCAGAACCACTGTATCCCCCGG - Intronic
904495056 1:30881870-30881892 CCCAGACCCATTGCTTGTCCAGG + Intronic
907709691 1:56867796-56867818 TCTAGACCCAATTTCTCCCCAGG - Intronic
908018962 1:59879892-59879914 TCTAGACCTTTTTTTTCCCCAGG - Intergenic
911526356 1:98991777-98991799 TACTGACTCATTGCTTCCCCAGG - Intronic
914385615 1:147167042-147167064 TCCTAAGCCATTGTATCCCCTGG + Intronic
914721029 1:150289208-150289230 TCTAGTCCCAATCTTTCCCCTGG + Intergenic
917130866 1:171741570-171741592 TCCTGCCCCATTGTACCCCCTGG + Intronic
921799131 1:219381542-219381564 TCCTGACACATTCTTTCCCTGGG + Intergenic
924355220 1:243166217-243166239 TCCAGGCCCCTTATTCCCCCAGG + Intronic
924738078 1:246777155-246777177 GCCAGAGCCATCTTTTCCCCTGG - Intergenic
1065132578 10:22636918-22636940 CCCAGATCCAGTGATTCCCCAGG + Intronic
1066040426 10:31543738-31543760 TCCAGACCCATTCCTCTCCCAGG - Intergenic
1066688516 10:38003666-38003688 TACAGAAACATTGTTTCCCAAGG - Intergenic
1069710104 10:70482531-70482553 TCCAGACCTTCTCTTTCCCCGGG - Intronic
1071475717 10:86023515-86023537 TCCACACCCACTGCTTCTCCAGG + Intronic
1072335087 10:94390766-94390788 TCCAGCCCTATTGATTCCCAGGG - Intergenic
1072906371 10:99457787-99457809 CTCAGACCTATTGTTGCCCCAGG + Intergenic
1078245798 11:9573020-9573042 CCGAGCCCCATTATTTCCCCGGG - Intergenic
1078341824 11:10502610-10502632 TTCAGACCCCTGGTTTCCACTGG + Intronic
1078854634 11:15197006-15197028 TCCATGCCCATTGTTTACTCAGG + Intronic
1079111982 11:17610233-17610255 TCCAGACCTGTGGCTTCCCCTGG + Exonic
1079197355 11:18341327-18341349 TCCAGTCCCATTATTTTCACAGG + Exonic
1079269444 11:18970080-18970102 TCCAGATCCATTGCTTTTCCAGG - Intergenic
1081423982 11:42904716-42904738 TCAAGTCCCATTATTTCTCCAGG + Intergenic
1082687620 11:56259888-56259910 CCCAGACCTAGTGTCTCCCCAGG - Intergenic
1082865973 11:57900513-57900535 TACACACCCAGTATTTCCCCTGG - Intergenic
1085390314 11:76178911-76178933 CCCAGACCCCATCTTTCCCCAGG - Intergenic
1087493015 11:98851889-98851911 CTCAGTCCCATTGTTTCCCAAGG + Intergenic
1089340275 11:117752629-117752651 TCCAGACCCATTGTTTCCCCGGG - Intronic
1090098989 11:123773823-123773845 TGCAGTCCCATTCTTTCCCAAGG - Intergenic
1093143538 12:15537828-15537850 TCCAGACCCAATCCTTCCACTGG - Intronic
1096771114 12:53936653-53936675 TTCAGGCCCTTTGTTTCTCCTGG + Intergenic
1097983317 12:65756361-65756383 TCCAGATGAATGGTTTCCCCTGG - Intergenic
1098942274 12:76551622-76551644 TACAGACCCATGGATTGCCCTGG + Intronic
1101334655 12:103785710-103785732 TCCAGACCTAGTGTTTCTGCAGG - Intronic
1102494887 12:113312651-113312673 GCCAGAACCAGTCTTTCCCCAGG + Intronic
1105301829 13:19142260-19142282 ACCAGAAGCATTGGTTCCCCTGG + Intergenic
1105930221 13:25045526-25045548 TCCATAACCTTTTTTTCCCCAGG - Intergenic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106358114 13:29003987-29004009 TCCTCACCCTTTCTTTCCCCTGG - Intronic
1107723144 13:43270559-43270581 TCCAGTGCCAGTGTTTCTCCAGG - Intronic
1107873445 13:44768143-44768165 CCCAAATCCATTGTCTCCCCAGG - Intergenic
1108741726 13:53345607-53345629 TCCAGACCCCTTGGCTACCCAGG + Intergenic
1109624562 13:64958213-64958235 TCCAGACCCACTGCTTCAACTGG - Intergenic
1111416732 13:87956603-87956625 CCCTGACCCATTGCTTCCCTAGG + Intergenic
1112482162 13:99786134-99786156 GCCAGACCTATTGTTTTCCATGG + Intronic
1113014223 13:105809004-105809026 TCCCGAGCCATTCTTTCTCCTGG - Intergenic
1113391179 13:109898836-109898858 TCCAGGAACATTGTTTTCCCAGG - Intergenic
1114166526 14:20224303-20224325 CCCAGGCCCATTGTTTGCACTGG + Exonic
1114277389 14:21159118-21159140 CCCAGAGCCATCTTTTCCCCTGG + Intergenic
1114277978 14:21165120-21165142 CCCAGAGCCATCTTTTCCCCCGG - Intergenic
1115974431 14:38981183-38981205 GACAGAACCATTGTCTCCCCCGG - Intergenic
1118747684 14:68785832-68785854 TTCAGGCCCATTATTTCTCCAGG - Intergenic
1122522346 14:102353736-102353758 TCGAGTCCCCTTGTTTCCTCAGG - Intronic
1123426804 15:20178550-20178572 TCCAGACCCAGTGGTTTCACTGG - Intergenic
1123536036 15:21185077-21185099 TCCAGACCCAGTGGTTTCACTGG - Intergenic
1125000702 15:34767335-34767357 TCCAGAGCACTTTTTTCCCCTGG + Intergenic
1125414166 15:39435156-39435178 TCCACACCCTTTGTTTTCCCTGG + Intergenic
1126377516 15:48010992-48011014 TCCAGAGCCATTGATTCCACAGG - Intergenic
1126845244 15:52753757-52753779 TCCACTCCCATTGCTACCCCAGG - Intergenic
1129161472 15:73750422-73750444 CCCAGACCCATTCTTACCCCCGG + Intronic
1129385381 15:75193352-75193374 TCTAGCCCCATTGGCTCCCCAGG + Intergenic
1132009307 15:98261280-98261302 TCTAGACCCATTAGTTCACCAGG - Intergenic
1133264354 16:4574582-4574604 TCCAAATCCAGTGTTTCCCAAGG - Intronic
1135316777 16:21453710-21453732 TTCAGACTCATTGCTTCCTCCGG - Intergenic
1135442114 16:22485171-22485193 TTCAGACTCATTGCTTCCTCCGG + Intronic
1135720580 16:24814214-24814236 TCCAGCCCCACTCTTTCCTCTGG - Intronic
1138170913 16:54848922-54848944 TCCAGGCCCATTCTCTCCCCTGG + Intergenic
1138595802 16:58028320-58028342 TCCAACCCAAGTGTTTCCCCAGG - Intronic
1143089345 17:4439809-4439831 TCCAGCCCCACTGGGTCCCCTGG + Intronic
1143565320 17:7717291-7717313 TCCAGGCCCGGTTTTTCCCCCGG + Intergenic
1147810029 17:43162028-43162050 TCCAGCCCCATTGATTCCTAAGG + Intergenic
1150847781 17:68677082-68677104 TCCAGACCCAGAGAGTCCCCTGG + Intergenic
1152702336 17:81825260-81825282 TCCAGAGCCGTGGATTCCCCTGG - Exonic
1155302423 18:24442785-24442807 TCCCAACCCACTGCTTCCCCTGG + Intronic
1157827307 18:50823788-50823810 TCCAGCCCCATTGTTTGGCCTGG - Intronic
1157937861 18:51893002-51893024 CCCAGACCCATTTTATTCCCTGG - Intergenic
1158745698 18:60197224-60197246 TCCAGTCCCATTATTTTCACAGG + Intergenic
1161124669 19:2549067-2549089 TCCAGACCTAGTGTCCCCCCTGG - Intronic
1161874698 19:6899180-6899202 TCCAGACCGATATTTTCCCCAGG + Intronic
1163243423 19:16077463-16077485 TTCAGACCCATTGTTTATCTCGG - Intronic
1165448413 19:35869120-35869142 TCCAGACCCCTTGTATTCTCTGG + Intronic
1165899056 19:39160144-39160166 TGAAGACCCATTTTCTCCCCAGG + Intronic
1166476709 19:43132931-43132953 GCCTGACCCAGTTTTTCCCCAGG - Intronic
925637120 2:5951245-5951267 TCCAGATCCAATTTTTCTCCTGG + Intergenic
925838709 2:7970353-7970375 TCTAAACCCATTCTTTCTCCAGG + Intergenic
927504286 2:23603124-23603146 TCCTGAGCCCTTGTTTGCCCTGG - Intronic
928221381 2:29406177-29406199 TCAACACCTATTGTTCCCCCAGG + Intronic
928224529 2:29436856-29436878 TCCAGAGCCATTTTCTCCTCTGG - Intronic
928466609 2:31528332-31528354 TCCAGAAGGATTATTTCCCCTGG - Intronic
930151163 2:48061373-48061395 CCCAGTCCCATTCTTTACCCAGG + Intergenic
933612434 2:84451121-84451143 TCGAGACCCATTCTTGCCCTTGG + Intronic
936173959 2:110202551-110202573 TCCAGAGCCAATATTTCTCCAGG + Intronic
938777757 2:134556933-134556955 TCCAGACCCATCCTTTCCTGTGG - Intronic
940460794 2:153960079-153960101 TCCAGAGCCACTATTTTCCCTGG - Intronic
940999910 2:160190838-160190860 TCCACACTCATTGGTTCCCATGG + Intronic
941225752 2:162845739-162845761 TTCTGACTCATTTTTTCCCCTGG - Intergenic
945025151 2:205613513-205613535 TCCAGAGCCTTTATTTCCCATGG + Intronic
1169051179 20:2579180-2579202 TCAAGACTCAATGTATCCCCTGG + Exonic
1170426783 20:16243026-16243048 ACCACCCCCATTGCTTCCCCTGG - Intergenic
1170876314 20:20253618-20253640 TCCAGTCCCACTGTTTGGCCTGG + Intronic
1172528263 20:35614085-35614107 TCCAGACCCATTTTTCCCAGGGG - Intergenic
1173806194 20:45926910-45926932 CCCAGACCTATTGTCTACCCAGG + Intergenic
1178448000 21:32662909-32662931 TCCAGCCCCATTGATTCCTAAGG - Intronic
1179567037 21:42255695-42255717 CCCAAACTCATTGTTTCTCCTGG + Intronic
1181867701 22:25872275-25872297 TCGAGACCCTTTGTTCCACCTGG + Intronic
950112590 3:10429048-10429070 TCCAGCCCCATTCAGTCCCCTGG + Intronic
950519847 3:13491606-13491628 TCCAGACACCTGGTTTCCTCAGG - Intronic
950548233 3:13651717-13651739 TCCAGACCATTTGCTACCCCAGG - Intergenic
952965066 3:38616091-38616113 TACAGACCCAGTCTGTCCCCTGG + Intronic
953617301 3:44502833-44502855 TCCTGCCTCATTGCTTCCCCTGG - Intronic
954157420 3:48694185-48694207 CCCTGCCCCATTTTTTCCCCTGG - Intronic
956845534 3:73178783-73178805 ACCAGACCCATTGCCTGCCCTGG - Intergenic
960270981 3:115674349-115674371 TCCAGTTCCATTGTTTACCATGG - Intronic
962097658 3:132308576-132308598 TCCAGCCCCATTGATTCCTAGGG - Intergenic
962277336 3:134025798-134025820 TCCAGCCCCATTGATTCCTAAGG - Intronic
963074431 3:141333165-141333187 CCCAGACTCATTGTTTGCTCCGG + Intronic
964561128 3:157997825-157997847 TCCAGCCCCATTATTTCACAGGG + Intergenic
967866884 3:194197691-194197713 TTCAGATCCATTGCTTCCACTGG + Intergenic
969420385 4:7090925-7090947 CCCAATCCCATTGTTTACCCAGG + Intergenic
977972667 4:103229611-103229633 TCCAGCCCCATTGATTCCTAGGG - Intergenic
978394491 4:108263944-108263966 TCCTGACCCTGTGTTTCCCTAGG + Intergenic
978742533 4:112153639-112153661 CCCATACCCAGTGTTTCCCCCGG + Intronic
981902832 4:149887044-149887066 TCCAGCCCCAATCTTTCCCAAGG + Intergenic
985866344 5:2517305-2517327 CCCAGCCCCATGGTTTCCACGGG + Intergenic
991257482 5:64631023-64631045 TCCAGCCACATTGTTTCTCAGGG - Intergenic
992265042 5:75009937-75009959 ACCACACCTATTGCTTCCCCAGG - Intergenic
995387225 5:111601383-111601405 TCCAGACCCAGTTTTTCCTCAGG + Intergenic
998265938 5:140667937-140667959 TCCAGACCCAATCTTTGTCCAGG + Intronic
1000277643 5:159752916-159752938 ACCACACCCATGGCTTCCCCTGG + Intergenic
1001021964 5:168190627-168190649 TCCAGGCCAATTGGGTCCCCGGG - Intronic
1001138009 5:169118546-169118568 TCAAGACCCATTGTTAACCCAGG + Intronic
1001343034 5:170864543-170864565 TCCAGACCCATTAATTCCTTTGG - Intronic
1004690421 6:17987950-17987972 GCGGGACGCATTGTTTCCCCAGG + Intergenic
1008147633 6:47911093-47911115 TCCATTCCCAGTTTTTCCCCTGG + Intronic
1009798799 6:68505921-68505943 TCCAGAACCATTGTTTCAAAAGG + Intergenic
1013004900 6:106063183-106063205 TCCAAGCTCATTATTTCCCCTGG - Intergenic
1013374786 6:109503925-109503947 CCCAGCACCAGTGTTTCCCCAGG + Intronic
1014338121 6:120165143-120165165 TCCAGATCCATTCTTTCTCATGG + Intergenic
1016048649 6:139506491-139506513 CCCAGACCCATTGTTTCAACTGG + Intergenic
1016599007 6:145835308-145835330 TCCATAGACATTGTTTCCCACGG - Intergenic
1016747568 6:147597687-147597709 TCAAGAGCCATTGTTTTCCAAGG + Intronic
1017529373 6:155273612-155273634 TCCAGATACAGTGTTTTCCCTGG + Intronic
1020411262 7:7894425-7894447 TCCAAACCCAATATTTCCCTGGG + Intronic
1024346030 7:48314664-48314686 CCCAGCCCCATTGGTTTCCCAGG + Intronic
1026125729 7:67577808-67577830 TCAAGACCCCTTCTTTCCCTGGG - Intergenic
1029705749 7:102274876-102274898 TCCTGCCCCTTTGCTTCCCCAGG + Intronic
1032847682 7:135765783-135765805 TTCAGAGCCATTATCTCCCCAGG - Intergenic
1032968528 7:137131418-137131440 TCCATAACCATTGTTGCCTCTGG + Intergenic
1035811820 8:2497966-2497988 TCCACACCCACAGTTTCCCCTGG - Intergenic
1036721009 8:11175253-11175275 TCCAGCCCCACTGTTTGGCCTGG - Intronic
1038319111 8:26512528-26512550 TCCAGTCCCATTGTCAGCCCAGG - Intronic
1038587618 8:28804318-28804340 GCAAGACCCCTAGTTTCCCCAGG - Intronic
1038922582 8:32101250-32101272 TCCAGACTCACACTTTCCCCAGG + Intronic
1044348013 8:91129195-91129217 TCCAGACTCATTCTGTCACCAGG - Intronic
1044917621 8:97132318-97132340 TCCAGCTCCATTGTGTCACCTGG + Intronic
1050490568 9:6184256-6184278 TCCAGATCCATTCTCTGCCCTGG + Intergenic
1057897902 9:98924427-98924449 TCAAGCCCCAGTGTCTCCCCAGG + Intergenic
1059741206 9:117151736-117151758 TCCACACACTTTGGTTCCCCTGG + Intronic
1186350361 X:8732852-8732874 TCCACACGCCTTGTTTCCTCAGG + Intergenic
1187479960 X:19646365-19646387 TACAGATCCATTGGTTCCCAAGG + Intronic
1190739838 X:53281508-53281530 TCCAGACCCATGGAGCCCCCCGG - Intronic
1191666898 X:63712813-63712835 TCCATAACCATGGTTTCCTCAGG - Intronic
1192220914 X:69196791-69196813 TCCAGACCCATGATTGCCCCAGG + Intergenic
1194995940 X:100591510-100591532 TCCAGACACACTGTCTCGCCTGG - Intronic
1195304971 X:103573074-103573096 TCCAGTAACACTGTTTCCCCAGG - Intergenic
1199059150 X:143332747-143332769 TCCATACTCAGTGTTTACCCAGG + Intergenic
1200873287 Y:8126002-8126024 GCCTGACCCATAGTTTCCCCAGG + Intergenic