ID: 1089346751

View in Genome Browser
Species Human (GRCh38)
Location 11:117796182-117796204
Sequence GTACGCAGCGCCCCAGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 70}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089346740_1089346751 17 Left 1089346740 11:117796142-117796164 CCTCTTCCAACCTCCCGATCCCG 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1089346751 11:117796182-117796204 GTACGCAGCGCCCCAGCCGCAGG 0: 1
1: 0
2: 1
3: 2
4: 70
1089346749_1089346751 -3 Left 1089346749 11:117796162-117796184 CCGGCTGCCTCGCGGATCAGGTA 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1089346751 11:117796182-117796204 GTACGCAGCGCCCCAGCCGCAGG 0: 1
1: 0
2: 1
3: 2
4: 70
1089346748_1089346751 -2 Left 1089346748 11:117796161-117796183 CCCGGCTGCCTCGCGGATCAGGT 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1089346751 11:117796182-117796204 GTACGCAGCGCCCCAGCCGCAGG 0: 1
1: 0
2: 1
3: 2
4: 70
1089346743_1089346751 7 Left 1089346743 11:117796152-117796174 CCTCCCGATCCCGGCTGCCTCGC 0: 1
1: 0
2: 2
3: 14
4: 220
Right 1089346751 11:117796182-117796204 GTACGCAGCGCCCCAGCCGCAGG 0: 1
1: 0
2: 1
3: 2
4: 70
1089346745_1089346751 4 Left 1089346745 11:117796155-117796177 CCCGATCCCGGCTGCCTCGCGGA 0: 1
1: 0
2: 0
3: 8
4: 58
Right 1089346751 11:117796182-117796204 GTACGCAGCGCCCCAGCCGCAGG 0: 1
1: 0
2: 1
3: 2
4: 70
1089346739_1089346751 18 Left 1089346739 11:117796141-117796163 CCCTCTTCCAACCTCCCGATCCC 0: 1
1: 0
2: 2
3: 29
4: 407
Right 1089346751 11:117796182-117796204 GTACGCAGCGCCCCAGCCGCAGG 0: 1
1: 0
2: 1
3: 2
4: 70
1089346742_1089346751 11 Left 1089346742 11:117796148-117796170 CCAACCTCCCGATCCCGGCTGCC 0: 1
1: 0
2: 0
3: 21
4: 201
Right 1089346751 11:117796182-117796204 GTACGCAGCGCCCCAGCCGCAGG 0: 1
1: 0
2: 1
3: 2
4: 70
1089346750_1089346751 -10 Left 1089346750 11:117796169-117796191 CCTCGCGGATCAGGTACGCAGCG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1089346751 11:117796182-117796204 GTACGCAGCGCCCCAGCCGCAGG 0: 1
1: 0
2: 1
3: 2
4: 70
1089346746_1089346751 3 Left 1089346746 11:117796156-117796178 CCGATCCCGGCTGCCTCGCGGAT 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1089346751 11:117796182-117796204 GTACGCAGCGCCCCAGCCGCAGG 0: 1
1: 0
2: 1
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089346751 Original CRISPR GTACGCAGCGCCCCAGCCGC AGG Intronic
900141906 1:1142151-1142173 GAGCGCAGGGCCCCAGCCGAGGG - Intergenic
900397057 1:2457354-2457376 GCATGCAGCCCCCCAGCCCCTGG - Intronic
902313906 1:15603358-15603380 CGCCGCAGCACCCCAGCCGCAGG + Intergenic
903457324 1:23496692-23496714 GTAGGCAGTGTCCCAGCCACAGG - Intergenic
1073181773 10:101587915-101587937 GTGCTCAGCGCCGCAGCTGCGGG + Exonic
1073577513 10:104639010-104639032 GTTCCCAGCGCCCCTGCCGGAGG - Intergenic
1076878800 10:133230266-133230288 GCGCGCCGCGCCCCAGCCCCGGG + Exonic
1077543608 11:3159325-3159347 GTCCACAGCACCCCAGCCTCAGG + Intronic
1083684820 11:64369818-64369840 GTACGCTGCCCCCGAGCTGCTGG + Exonic
1083727915 11:64637938-64637960 GTGCCCAGCGCCCAAGCCCCAGG + Intronic
1084115925 11:67042959-67042981 CTAGGCAGCCCCCCAGCCTCAGG + Intronic
1089078855 11:115760098-115760120 GCGCCCAGCGCCCCCGCCGCGGG + Intergenic
1089346751 11:117796182-117796204 GTACGCAGCGCCCCAGCCGCAGG + Intronic
1089684393 11:120137695-120137717 GTACGCAGGGCTCCAGCTGGGGG - Exonic
1103762743 12:123263524-123263546 GTAAGCAGCACCCCAGCTACCGG + Intronic
1104601922 12:130160811-130160833 GTGCGCAGCGTCCCCACCGCGGG + Intergenic
1116186634 14:41607058-41607080 GAACACAGCGCCCCGCCCGCTGG - Intergenic
1116821884 14:49634542-49634564 GTGCGCAGCACCGCAGCCTCTGG + Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1125609508 15:40961002-40961024 CTAAGCCGGGCCCCAGCCGCTGG - Intergenic
1127974980 15:63990567-63990589 GAACGCAGGGCCCCAGCCAAGGG + Intronic
1128156159 15:65393274-65393296 GGACCCAGCGCCCCACCCCCTGG - Intronic
1132728968 16:1351449-1351471 GCAGGCAGCGCACCAGCCCCAGG + Exonic
1139256446 16:65547479-65547501 GTAAGCAGGGCCCGAGCCCCAGG + Intergenic
1139466048 16:67154768-67154790 GCACGAAGCGCCGCAGCAGCTGG + Exonic
1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG + Intronic
1142157618 16:88539789-88539811 TCACGCAGCCCCCCAGCCACAGG - Intergenic
1142863499 17:2777166-2777188 GTGTGCAGCGCCCCGCCCGCGGG - Intronic
1143106806 17:4534236-4534258 GTCCGCCCAGCCCCAGCCGCAGG - Intronic
1144427620 17:15158584-15158606 GAACGCAGCCCGCCAGCCTCAGG + Intergenic
1145976409 17:28986596-28986618 TTACGCAGTGCCCCAGCCTGGGG + Intronic
1151816310 17:76473123-76473145 GTGCTCAGCGCCCCAGAAGCAGG + Intronic
1165040513 19:33064813-33064835 GCCCGCGGCCCCCCAGCCGCTGG - Exonic
930762322 2:55050077-55050099 GTGCCCACCGCCCCTGCCGCCGG - Exonic
931515299 2:63047709-63047731 GGATGCAGCGCCCTTGCCGCGGG - Intergenic
935396943 2:102619480-102619502 GGGCGCGGCGCCCAAGCCGCAGG - Intergenic
940453687 2:153871729-153871751 GTGCGCACCGCCCCAGCCCGGGG + Intergenic
947632388 2:231662510-231662532 GGAAGCCGCGCCCCAGACGCGGG - Intergenic
1173005450 20:39136685-39136707 ATAAACAGGGCCCCAGCCGCAGG + Intergenic
1176014884 20:62926049-62926071 CTACGCAGCCCCCGAGCCCCGGG + Intronic
1176017853 20:62945812-62945834 GGACGCAGAGCCCCAGCAGGTGG + Exonic
1178536497 21:33414311-33414333 GTACGCAAAGCCCAAGCTGCAGG - Intronic
1180947463 22:19704554-19704576 GTGCGCAGCCCTCCTGCCGCCGG - Intergenic
1182475602 22:30574808-30574830 CAACGCTGCGCCCCCGCCGCCGG + Intergenic
1183315643 22:37135548-37135570 GTCCCCAGCCCCCCAGACGCAGG - Intronic
1183328502 22:37207047-37207069 GTTCGGAGCGCCGCCGCCGCTGG + Exonic
1184407729 22:44309392-44309414 GTAGGCAGCGGCCCAGCAGAAGG + Intronic
1185366582 22:50439618-50439640 GGAGGCAGCGCCCCTGCCCCGGG - Intronic
955015287 3:55064101-55064123 GTGCGCAGCTCAGCAGCCGCAGG + Intronic
963133105 3:141876516-141876538 TCAGGCAGCGCCCCGGCCGCTGG + Intronic
967904279 3:194487513-194487535 GGACTCTGCGCCCCGGCCGCAGG + Intronic
968601880 4:1513373-1513395 GTGCGCGGCGCCGGAGCCGCTGG + Intergenic
969032975 4:4228113-4228135 GACCCCAGCCCCCCAGCCGCAGG + Intergenic
969625321 4:8301985-8302007 GTGTGCAGTGCCCCAGCCACAGG + Intronic
982291737 4:153788963-153788985 CTTCTCCGCGCCCCAGCCGCCGG - Exonic
995462821 5:112420257-112420279 GCACACTGCGCCCAAGCCGCGGG + Intergenic
1005832386 6:29681111-29681133 GGCCGGAGCGCTCCAGCCGCTGG - Intergenic
1018003822 6:159602368-159602390 GCACCCAGCGCTCCAGCCCCAGG - Intergenic
1021992595 7:26152436-26152458 GGTCCCGGCGCCCCAGCCGCCGG - Exonic
1023057417 7:36301159-36301181 GGACTCAGCTCCCCAGCCTCTGG - Exonic
1024089045 7:45920707-45920729 GCACGCAGCGCACCTGGCGCGGG + Exonic
1025608193 7:63054399-63054421 GTCCGCCGCGGCGCAGCCGCCGG + Intergenic
1029333280 7:99878196-99878218 TTAAGAAGCGCCCCAGCGGCCGG - Intronic
1029640687 7:101817204-101817226 GTACGCTGCCTCCCCGCCGCCGG + Intronic
1035168519 7:157005469-157005491 GCACGGAGCGCCCCGGCCGGCGG - Exonic
1040964579 8:53071346-53071368 GTACCCAGCGCCCCCACCGCAGG + Intergenic
1050537930 9:6645929-6645951 GTACGGAGCGTCCCGGCCCCCGG - Intergenic
1053477429 9:38392644-38392666 GTAGGCAGCGCCCCAGGCGCAGG + Exonic
1056126231 9:83538383-83538405 GCCCGCCGCGCCCCGGCCGCTGG - Exonic
1060217367 9:121746456-121746478 GTCCGCAGAGCCCCAGCTCCTGG - Intronic
1060700710 9:125747271-125747293 GTCCTCATCGCCTCAGCCGCGGG + Intergenic
1061518954 9:131106130-131106152 GGAGGCAGGGCCCCAGCCACAGG - Intronic
1062447528 9:136601928-136601950 GTGGGCAGCCCCCCAGCCGAGGG + Intergenic
1062689618 9:137834525-137834547 GTACGCACCGCCCCGGCCCCTGG + Intronic