ID: 1089346991

View in Genome Browser
Species Human (GRCh38)
Location 11:117797005-117797027
Sequence CGCCGCCCAGCCGCCCGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 6, 3: 37, 4: 335}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089346976_1089346991 18 Left 1089346976 11:117796964-117796986 CCGCCTCGCCGCCAGCCGCGCCA 0: 1
1: 0
2: 5
3: 47
4: 1133
Right 1089346991 11:117797005-117797027 CGCCGCCCAGCCGCCCGCGCAGG 0: 1
1: 0
2: 6
3: 37
4: 335
1089346975_1089346991 19 Left 1089346975 11:117796963-117796985 CCCGCCTCGCCGCCAGCCGCGCC 0: 1
1: 2
2: 6
3: 68
4: 620
Right 1089346991 11:117797005-117797027 CGCCGCCCAGCCGCCCGCGCAGG 0: 1
1: 0
2: 6
3: 37
4: 335
1089346974_1089346991 20 Left 1089346974 11:117796962-117796984 CCCCGCCTCGCCGCCAGCCGCGC 0: 1
1: 0
2: 1
3: 81
4: 474
Right 1089346991 11:117797005-117797027 CGCCGCCCAGCCGCCCGCGCAGG 0: 1
1: 0
2: 6
3: 37
4: 335
1089346972_1089346991 30 Left 1089346972 11:117796952-117796974 CCGCCGGGCACCCCGCCTCGCCG 0: 1
1: 0
2: 3
3: 23
4: 252
Right 1089346991 11:117797005-117797027 CGCCGCCCAGCCGCCCGCGCAGG 0: 1
1: 0
2: 6
3: 37
4: 335
1089346979_1089346991 10 Left 1089346979 11:117796972-117796994 CCGCCAGCCGCGCCACCCTGGCC 0: 1
1: 0
2: 0
3: 58
4: 728
Right 1089346991 11:117797005-117797027 CGCCGCCCAGCCGCCCGCGCAGG 0: 1
1: 0
2: 6
3: 37
4: 335
1089346973_1089346991 27 Left 1089346973 11:117796955-117796977 CCGGGCACCCCGCCTCGCCGCCA 0: 1
1: 0
2: 2
3: 38
4: 323
Right 1089346991 11:117797005-117797027 CGCCGCCCAGCCGCCCGCGCAGG 0: 1
1: 0
2: 6
3: 37
4: 335
1089346981_1089346991 3 Left 1089346981 11:117796979-117797001 CCGCGCCACCCTGGCCCCGCCGC 0: 1
1: 0
2: 2
3: 103
4: 771
Right 1089346991 11:117797005-117797027 CGCCGCCCAGCCGCCCGCGCAGG 0: 1
1: 0
2: 6
3: 37
4: 335
1089346983_1089346991 -5 Left 1089346983 11:117796987-117797009 CCCTGGCCCCGCCGCCTCCGCCG 0: 1
1: 1
2: 23
3: 191
4: 1053
Right 1089346991 11:117797005-117797027 CGCCGCCCAGCCGCCCGCGCAGG 0: 1
1: 0
2: 6
3: 37
4: 335
1089346977_1089346991 15 Left 1089346977 11:117796967-117796989 CCTCGCCGCCAGCCGCGCCACCC 0: 1
1: 0
2: 3
3: 98
4: 1477
Right 1089346991 11:117797005-117797027 CGCCGCCCAGCCGCCCGCGCAGG 0: 1
1: 0
2: 6
3: 37
4: 335
1089346984_1089346991 -6 Left 1089346984 11:117796988-117797010 CCTGGCCCCGCCGCCTCCGCCGC 0: 1
1: 17
2: 100
3: 676
4: 2278
Right 1089346991 11:117797005-117797027 CGCCGCCCAGCCGCCCGCGCAGG 0: 1
1: 0
2: 6
3: 37
4: 335
1089346980_1089346991 7 Left 1089346980 11:117796975-117796997 CCAGCCGCGCCACCCTGGCCCCG 0: 1
1: 0
2: 3
3: 51
4: 493
Right 1089346991 11:117797005-117797027 CGCCGCCCAGCCGCCCGCGCAGG 0: 1
1: 0
2: 6
3: 37
4: 335
1089346982_1089346991 -2 Left 1089346982 11:117796984-117797006 CCACCCTGGCCCCGCCGCCTCCG 0: 1
1: 1
2: 13
3: 156
4: 1150
Right 1089346991 11:117797005-117797027 CGCCGCCCAGCCGCCCGCGCAGG 0: 1
1: 0
2: 6
3: 37
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089346991 Original CRISPR CGCCGCCCAGCCGCCCGCGC AGG Intronic