ID: 1089350045

View in Genome Browser
Species Human (GRCh38)
Location 11:117816995-117817017
Sequence CTGTGGGCATGGGGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 847
Summary {0: 1, 1: 0, 2: 18, 3: 93, 4: 735}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089350045_1089350061 18 Left 1089350045 11:117816995-117817017 CCCTCCTGCCCCCATGCCCACAG 0: 1
1: 0
2: 18
3: 93
4: 735
Right 1089350061 11:117817036-117817058 GCTCAGAGGCTGGATGGGTTTGG 0: 1
1: 0
2: 3
3: 17
4: 310
1089350045_1089350057 4 Left 1089350045 11:117816995-117817017 CCCTCCTGCCCCCATGCCCACAG 0: 1
1: 0
2: 18
3: 93
4: 735
Right 1089350057 11:117817022-117817044 CTTTCTCTGGAGCTGCTCAGAGG 0: 1
1: 0
2: 3
3: 18
4: 275
1089350045_1089350060 13 Left 1089350045 11:117816995-117817017 CCCTCCTGCCCCCATGCCCACAG 0: 1
1: 0
2: 18
3: 93
4: 735
Right 1089350060 11:117817031-117817053 GAGCTGCTCAGAGGCTGGATGGG 0: 1
1: 0
2: 1
3: 33
4: 289
1089350045_1089350059 12 Left 1089350045 11:117816995-117817017 CCCTCCTGCCCCCATGCCCACAG 0: 1
1: 0
2: 18
3: 93
4: 735
Right 1089350059 11:117817030-117817052 GGAGCTGCTCAGAGGCTGGATGG 0: 1
1: 0
2: 7
3: 72
4: 528
1089350045_1089350062 22 Left 1089350045 11:117816995-117817017 CCCTCCTGCCCCCATGCCCACAG 0: 1
1: 0
2: 18
3: 93
4: 735
Right 1089350062 11:117817040-117817062 AGAGGCTGGATGGGTTTGGATGG 0: 1
1: 1
2: 43
3: 547
4: 2488
1089350045_1089350063 25 Left 1089350045 11:117816995-117817017 CCCTCCTGCCCCCATGCCCACAG 0: 1
1: 0
2: 18
3: 93
4: 735
Right 1089350063 11:117817043-117817065 GGCTGGATGGGTTTGGATGGTGG 0: 1
1: 0
2: 6
3: 32
4: 382
1089350045_1089350058 8 Left 1089350045 11:117816995-117817017 CCCTCCTGCCCCCATGCCCACAG 0: 1
1: 0
2: 18
3: 93
4: 735
Right 1089350058 11:117817026-117817048 CTCTGGAGCTGCTCAGAGGCTGG 0: 1
1: 0
2: 3
3: 48
4: 426
1089350045_1089350054 -9 Left 1089350045 11:117816995-117817017 CCCTCCTGCCCCCATGCCCACAG 0: 1
1: 0
2: 18
3: 93
4: 735
Right 1089350054 11:117817009-117817031 TGCCCACAGGGCTCTTTCTCTGG 0: 1
1: 0
2: 14
3: 55
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089350045 Original CRISPR CTGTGGGCATGGGGGCAGGA GGG (reversed) Intronic
900131844 1:1090580-1090602 CTGTGGGCCTGGGAGCAAGGAGG + Intronic
900296913 1:1956502-1956524 CAGTGGGCCTGGGAGAAGGAGGG - Intronic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
900750076 1:4390163-4390185 CTCCAGGCATGTGGGCAGGATGG + Intergenic
900919151 1:5659764-5659786 CTGAGGGGAAGGGGGCAGGGTGG - Intergenic
901025877 1:6278469-6278491 GCGTGGGCATGGGGGGAGTAGGG + Intronic
901375320 1:8834194-8834216 CTCTGGGGAGGGTGGCAGGAAGG + Intergenic
901421314 1:9153095-9153117 ATGTGGGTGTGGGGGCATGAAGG + Intergenic
901489749 1:9590542-9590564 CTGTGGCCAGCAGGGCAGGAAGG - Intronic
901630008 1:10643387-10643409 TTCTGGGCATGGGGGCAGTGTGG + Intronic
901666150 1:10827525-10827547 CTGGGACCATGGGGGAAGGAGGG - Intergenic
901680509 1:10910153-10910175 CTGGGGGCCCTGGGGCAGGATGG + Intergenic
902380894 1:16051758-16051780 CTGAGGGCATCGTGGCTGGAGGG + Exonic
902444441 1:16452961-16452983 CTGTGGGGAGAGTGGCAGGAGGG + Intronic
902466174 1:16620104-16620126 CTGAGGGTATGGGGGCCAGATGG - Intergenic
902503725 1:16926419-16926441 CTGTGGCCATGGGGACAAGGGGG - Intronic
902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG + Intronic
903019732 1:20385684-20385706 CAGTGGGGAGGGGTGCAGGAAGG + Intergenic
903268571 1:22173766-22173788 CTGTCTGCAGAGGGGCAGGAAGG - Intergenic
903330647 1:22595376-22595398 CGGTGGGGCTGGGGGCAGGCAGG - Intronic
903450913 1:23453029-23453051 CTGTGTGAAAGGGGGCAGGAGGG + Intronic
903580308 1:24365811-24365833 CTGTGGGCCTGGGGGAAGGGAGG - Intronic
904016866 1:27428491-27428513 CTGTGGGAAGGGTGGCAGGAAGG - Intronic
904340396 1:29830409-29830431 CTGGGGACATGGGGGCAGGATGG - Intergenic
904599879 1:31667443-31667465 CTGCAGGCTTGGGGGCAGGGGGG + Intronic
904599881 1:31667451-31667473 TTGGGGGCAGGGGGGCAGCAGGG + Intronic
904790771 1:33019000-33019022 CAGTGGTCTGGGGGGCAGGAAGG - Intronic
904986069 1:34549811-34549833 ATGTGGGCAAAGGGGCATGAAGG - Intergenic
905019066 1:34796020-34796042 CGATGGGCATGGGGGAGGGAGGG - Intronic
905250680 1:36646386-36646408 CTGAGGGGATGGGAGCAGGATGG - Intergenic
905282964 1:36860670-36860692 CTCTGGGTCTGGGGGCAGGGTGG + Intronic
905387591 1:37614977-37614999 CTGGGGGAATGGGGGCAGGGTGG + Intronic
905434302 1:37946401-37946423 CAGAGGGGTTGGGGGCAGGAGGG + Intronic
906033459 1:42737162-42737184 CTGTGGGCATGGGAACTGAAGGG - Intronic
906143510 1:43547091-43547113 CTGGGGGCCTGGGGGTGGGAGGG - Intronic
906146164 1:43561913-43561935 CTGTGAGTATAGGGGCAGGGGGG - Intronic
906521936 1:46472364-46472386 GTGTTGGCAGGGGGGCAGGCGGG - Intergenic
906608282 1:47185876-47185898 GGGTGGGCATGAGGTCAGGAGGG - Intronic
906856723 1:49314376-49314398 CTTGGGGGATGGGGGCTGGAGGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907189114 1:52633788-52633810 CTGTGGGCATGAGGACGGTAAGG - Intronic
907251296 1:53141609-53141631 ATGTGGGCTGGGGGACAGGAAGG - Intronic
907283844 1:53367939-53367961 CAGAGGGCATGGGGGCAGGCAGG - Intergenic
907559722 1:55377573-55377595 CTGTGGGTATGGGAGCTGGGAGG - Intergenic
907592922 1:55693050-55693072 CTTTGGCCATGTGGCCAGGAAGG - Intergenic
908021666 1:59904678-59904700 TTGTGGGGAGGGGAGCAGGAAGG - Intronic
908074178 1:60495983-60496005 CTGTGGGGGTGGGGGGAGGGTGG + Intergenic
909344666 1:74571702-74571724 ATGAGGGCATGGGAGGAGGAAGG - Exonic
910490227 1:87761140-87761162 CTGTGTGCATGGGGGAAAGCAGG - Intergenic
910934486 1:92476208-92476230 CTGTGGGGATGGGAGGGGGAGGG + Intronic
912159807 1:106967888-106967910 ATGTGGGCTTGGGGACAGAAGGG + Intergenic
912245108 1:107953714-107953736 CTGGGAGCATGGGGGCAGCATGG - Intronic
912409168 1:109467562-109467584 TGGTGGGTTTGGGGGCAGGACGG - Intronic
912511780 1:110194778-110194800 GCCTGGGCATGGGGGCAGGGAGG - Intronic
912823537 1:112885908-112885930 GTGTGGGGGTGGGGGCAGGGAGG - Intergenic
912957956 1:114169207-114169229 GAGTGGGGATGGGGACAGGAGGG + Intergenic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
913502858 1:119488027-119488049 CTGAAGGCTTGGGGACAGGAGGG + Intergenic
915081977 1:153358799-153358821 CTGTGGGCAATGGGGCTGGGTGG + Intronic
915082659 1:153362573-153362595 ATGTGAGCATGGGAGCAGAAGGG - Intergenic
915140354 1:153764050-153764072 CTGGGATCGTGGGGGCAGGAGGG + Intronic
915284808 1:154845931-154845953 CTATGGGCTTGGGGGCTGGTAGG - Intronic
915311460 1:155007723-155007745 CTGGGAGCAGGGGGGTAGGAGGG + Intronic
915456092 1:156041849-156041871 GTGAGGGTAGGGGGGCAGGAGGG - Intronic
916742695 1:167660359-167660381 CTGTGGCTATGGGCCCAGGAAGG - Intronic
917034744 1:170735944-170735966 CTCTCAGCATGGGGGCAGGCAGG - Intronic
917243513 1:172974904-172974926 ATGTGGGCCTGTAGGCAGGAGGG - Intergenic
917329617 1:173868266-173868288 CTCTGGGGATGGGGGAAGGGGGG + Intronic
921065606 1:211620433-211620455 CTGTGAGCGTGGGGGAAGTAGGG + Intergenic
921366981 1:214383523-214383545 CTCTGGCCATGGCGGGAGGAAGG + Exonic
922108492 1:222533426-222533448 ATGTGTGTATGGGGGCAGGGTGG + Intronic
922143467 1:222914585-222914607 CTCTGGGGATGGGAGGAGGAAGG - Intronic
922804016 1:228376624-228376646 CTGGGGGTATGGGGACAGGGAGG - Intronic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923362653 1:233226800-233226822 GTGTGGGCATGGGGAGAGGAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923750084 1:236739493-236739515 CGGAGGGCATGAAGGCAGGACGG - Exonic
924213600 1:241795695-241795717 TTCTGGGCAGGGGGGCAGCACGG - Intronic
1062768852 10:84322-84344 CAGAGGGCCTGTGGGCAGGAAGG + Intergenic
1062833790 10:623448-623470 CTGTGGGGCTGAGGGGAGGAGGG + Intronic
1062976871 10:1690646-1690668 CACTGAGCATGGGGACAGGAAGG - Intronic
1063455845 10:6182313-6182335 CTGGGGGTCTGGGTGCAGGAGGG + Intronic
1063470803 10:6283316-6283338 GTGTGCGTATGGGGGCAGGTGGG + Intergenic
1063519010 10:6724015-6724037 TTGGGGGAACGGGGGCAGGAGGG + Intergenic
1063558667 10:7105746-7105768 CTGTGGGCATGGGGCTGGGCTGG - Intergenic
1064965690 10:21013077-21013099 ATGGGGGCGTGGGGGCAGGGTGG + Intronic
1065838681 10:29682002-29682024 CTGAGGGAGTGGGGACAGGAAGG - Intronic
1066107357 10:32167562-32167584 TGGTTGGCCTGGGGGCAGGAGGG - Intergenic
1066454848 10:35564317-35564339 CTGTGGGCAGGCGGCAAGGAAGG - Intronic
1066519396 10:36198808-36198830 CAGTGGACATAGTGGCAGGAAGG - Intergenic
1066978698 10:42391860-42391882 CTGAAGGCTTGGGGGCAGGAGGG + Intergenic
1067270516 10:44787815-44787837 CTCTGGGCATGGAGGAAGGTAGG - Intergenic
1067937650 10:50624781-50624803 CGGCGGGCATCGGGGCGGGAAGG - Intronic
1067985329 10:51137222-51137244 CTATGGCCGTGGGGGCAGGGTGG + Intronic
1068466951 10:57406398-57406420 CAGGGGGCATGGTGGCAGGCAGG - Intergenic
1068517631 10:58044045-58044067 TTGGGGGCAGGGGGGTAGGAAGG + Intergenic
1069721090 10:70549786-70549808 CTGTTGGCATTGGAGAAGGAAGG + Intronic
1069945075 10:71979890-71979912 GTGGGAGCATGGGGGCTGGAGGG + Intronic
1070311410 10:75276311-75276333 AGGTGGGCCTGGGGGAAGGAAGG + Intergenic
1070328646 10:75403315-75403337 CTGCGGGGATGGCGGCAGGTGGG - Intergenic
1070513380 10:77181100-77181122 CTGTGGGCCTGGGTGATGGAAGG - Intronic
1070718534 10:78740177-78740199 GGGTGGGCATGGGGACAGGATGG - Intergenic
1070763005 10:79036683-79036705 CTGTGGCCATGGTGCCAGAAGGG - Intergenic
1070979760 10:80634599-80634621 CTCTGGGCAGTGGGGCTGGAGGG + Intronic
1071003061 10:80853036-80853058 CTGTGGGAATTGGGCAAGGATGG - Intergenic
1071100463 10:82030730-82030752 TTGGGGGAATGAGGGCAGGAAGG + Intronic
1071213062 10:83366724-83366746 GTCTGGGGATGGGGGCAGGGTGG - Intergenic
1071701841 10:87947001-87947023 CTGTAGGAAAGGGGGCTGGAAGG + Intronic
1072615926 10:97048893-97048915 CGGTGGGCAGGTGGGCAGGCAGG + Intronic
1072628322 10:97128556-97128578 TTGTGGGCATCAGGGCAGGAGGG - Intronic
1073102185 10:101012128-101012150 GAGAGGGCTTGGGGGCAGGAAGG - Intronic
1073323317 10:102628554-102628576 CTTTGAGCTTGGGGGTAGGAGGG + Intronic
1073470393 10:103718485-103718507 CTGGGGGCTGGGGGGCTGGAGGG + Intronic
1073558569 10:104477857-104477879 ATGTGGGCATGTGGGAAGGATGG + Intergenic
1073759241 10:106612390-106612412 CTGCGGGGGTGGGGGCGGGAGGG - Intronic
1073808610 10:107127686-107127708 CTTTGAGCATGAGGGCAGAAGGG - Intronic
1073894490 10:108139130-108139152 TTGTGGGCATGGAGTTAGGAAGG - Intergenic
1074978978 10:118603952-118603974 CTCTGGGCAGGAGGGCAGGCTGG - Intergenic
1075471148 10:122690571-122690593 CTTTGGGCCTGGGGTCAGAAGGG + Intergenic
1075483335 10:122800252-122800274 AGGAGGGCCTGGGGGCAGGAAGG + Intergenic
1075483376 10:122800349-122800371 AGGAGGGCCTGGGGGCAGGAAGG + Intergenic
1075675226 10:124291494-124291516 CTGCGGGGATGGGAACAGGAAGG + Intergenic
1075832119 10:125420141-125420163 GTGTGGGGACAGGGGCAGGAAGG + Intergenic
1076342680 10:129760249-129760271 CTGTGTGTGTGGGGGCAGAAAGG + Intronic
1076379563 10:130015771-130015793 CAGTGGGCCTGGGGCCAGGCGGG + Intergenic
1076399933 10:130175857-130175879 CTGTGGGCATGGTGGCATCGAGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076670847 10:132120424-132120446 CTGTGGTCAGGGGTGGAGGAAGG - Intronic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077035272 11:491437-491459 CACTGGGCATGAGGGCAGGCTGG - Intergenic
1077077745 11:708992-709014 CTGTGGGGAGGGGGGTGGGATGG - Intronic
1077299634 11:1841008-1841030 CTGTGGGCAGGGGAGCCGGGTGG - Intronic
1077339917 11:2021679-2021701 GTGTGGGGGTGGCGGCAGGAAGG - Intergenic
1077420873 11:2449291-2449313 CTGGGGTACTGGGGGCAGGAGGG + Intronic
1077661631 11:4073802-4073824 CTCAGGGCCTGGGGGCAGCAGGG + Intronic
1078147269 11:8730461-8730483 CAGGGGGCATGGCAGCAGGAAGG - Exonic
1078445027 11:11397610-11397632 ATCTGGGCATGGTGGCAGGTGGG - Intronic
1078568384 11:12436693-12436715 TTGGGAGGATGGGGGCAGGAAGG + Intronic
1079004540 11:16782683-16782705 CTGTGGGCTTGGGCCCAGCATGG - Intronic
1079327443 11:19506263-19506285 CTATAGGCATGGGGCTAGGAAGG + Intronic
1079415194 11:20228159-20228181 GATTGGGCAAGGGGGCAGGAGGG - Intergenic
1080035004 11:27700826-27700848 CTGTGGGCGCTGGGGCGGGAGGG + Intronic
1080468522 11:32521783-32521805 CTGTAGGCAAGGGGCCAGCAGGG - Intergenic
1080479966 11:32637585-32637607 GTGTGTGTTTGGGGGCAGGAGGG - Intronic
1081587753 11:44398856-44398878 CTGTGGGAACTGGAGCAGGATGG + Intergenic
1081691316 11:45080439-45080461 CTGTAGGCAGGGGGTGAGGATGG - Intergenic
1083887890 11:65581607-65581629 CTGGGGGACTGGGGGCCGGAGGG - Exonic
1083903387 11:65654746-65654768 GGGTGGGCTTGGGGGCAGGTGGG + Exonic
1083994530 11:66265585-66265607 CTGTGGGCTGGGTGCCAGGATGG + Intronic
1084084304 11:66847845-66847867 CTGTGGGCAGGTGGGCAGGAGGG + Intergenic
1084167465 11:67382549-67382571 CTGGGGAGATGGGGGCAGGGAGG - Intronic
1084192070 11:67503941-67503963 CTGTGGGAAGAGGGGCAGGAGGG - Intronic
1084296503 11:68215936-68215958 CTGGGGGCCTGGGAGCAGGCTGG - Intergenic
1084496660 11:69509129-69509151 CTGATGGTTTGGGGGCAGGAAGG + Intergenic
1084890889 11:72236450-72236472 CTCTGAGCATGTGGACAGGAAGG + Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085073551 11:73571231-73571253 CTGTGGGGAGGGGGGGGGGAGGG - Intronic
1085390939 11:76181857-76181879 CTGTGGGCACCAGGGCAGCAAGG - Intergenic
1085513664 11:77100313-77100335 TTGTGGGCAAGGGAGCAGGCAGG - Intronic
1088269582 11:108020026-108020048 CAGTGGGGGTGGGGGCAGGGTGG - Intronic
1088706849 11:112471567-112471589 CTGTGGTCAAGGAGGCAGTATGG - Intergenic
1089004034 11:115075772-115075794 CTGTGGGTATAGGGTCAAGATGG + Intergenic
1089085778 11:115815708-115815730 CTGGAGGCATGGGAGAAGGAGGG + Intergenic
1089297373 11:117478219-117478241 CTGTGGGCATCAGGGCAGCATGG + Intronic
1089300622 11:117496644-117496666 CTGTGGTCATGGGGACTGCAGGG + Intronic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1089402643 11:118173209-118173231 CTGGGGGGATGGGGGCTGGCAGG - Intronic
1089678314 11:120105385-120105407 CTGTGGGGCAGGGGGCTGGAAGG + Intergenic
1090188065 11:124751344-124751366 ATGAGGGCATGGGGTCGGGAGGG - Intronic
1090205272 11:124880336-124880358 CTGTGGTCAGGGTGGCAGGGTGG + Intronic
1090251648 11:125255872-125255894 CTGTGGGCAAGGGGCTGGGAAGG - Intronic
1090299892 11:125626188-125626210 TTGTGGGGGCGGGGGCAGGAGGG + Intronic
1090933262 11:131318520-131318542 GTGGGGGGATGGGGGAAGGATGG + Intergenic
1091283203 11:134394037-134394059 CGGTGGTGCTGGGGGCAGGAGGG - Intronic
1202822902 11_KI270721v1_random:76868-76890 GTGTGGGGGTGGCGGCAGGAAGG - Intergenic
1091396717 12:157701-157723 AGGTGGGCACTGGGGCAGGAGGG + Intronic
1091642355 12:2246943-2246965 GTGTGTGCATGGGGGAAGAACGG - Intronic
1091795234 12:3294293-3294315 ATGTGGCCCTGGGGGCAGGGGGG - Intergenic
1092016913 12:5167231-5167253 CTGTGGGCAAGGGTGGGGGATGG + Intergenic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092119763 12:6035691-6035713 CAGTGGGCACGGGGTCTGGAGGG - Intronic
1092263187 12:6963170-6963192 CTGTGCGCAGGGTGGCAGGCGGG + Intergenic
1093235566 12:16605442-16605464 GTTTGGGCATGGGGGCGGGGGGG - Intronic
1094680931 12:32666406-32666428 CAGGGGGCGTGGGGGCGGGAGGG + Intergenic
1094719996 12:33053117-33053139 CTGAGGGCAAGGGGCCAGGAGGG - Intergenic
1094763413 12:33561706-33561728 GTGTGGGCATGGTGGGATGATGG - Intergenic
1095205773 12:39439059-39439081 CTGAGTGCATGGGTGTAGGAAGG - Intronic
1095327908 12:40920290-40920312 GTGGGGGCATGGGGGCAGCAAGG - Intronic
1095975127 12:47935140-47935162 CTGAGGGCACGGGGGCAGGAGGG + Intronic
1095980819 12:47973770-47973792 CTGTGGGGAGTGGGGAAGGAGGG - Intronic
1096109565 12:49020831-49020853 ATCTGGACATGGGGGCAGGAGGG - Exonic
1096124169 12:49107503-49107525 CAGTGTGCATGGAGGTAGGAGGG - Intronic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096532210 12:52249219-52249241 CTCTGGGCATGGGGGGAGGGAGG - Intronic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1096974983 12:55694755-55694777 GTGAGGACCTGGGGGCAGGATGG - Intronic
1097145388 12:56936191-56936213 CTGTGTGCATGGGGTGGGGATGG - Intergenic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1098918022 12:76277156-76277178 CTGTGGGGAGGTGGGGAGGAAGG - Intergenic
1099061752 12:77919473-77919495 CTGTGGACATGGGGCTAGAAAGG + Intronic
1100094014 12:91008982-91009004 CTCTGAGCATGGGGTCAGGCAGG + Intergenic
1100627857 12:96354944-96354966 CTATGGGCAGTGGGGCAGGGAGG - Intronic
1101062208 12:100984061-100984083 GGTTGGGCATGGGGGCTGGAGGG - Intronic
1101717163 12:107320831-107320853 CTCTGGGGATCTGGGCAGGATGG + Intronic
1101872433 12:108577146-108577168 CTGAGGTCCTGGGGGCAGGATGG - Intergenic
1101955536 12:109209056-109209078 TTGAGTGCATGGGGTCAGGATGG + Intronic
1102240088 12:111319989-111320011 CTGCGGGGAGGGGGACAGGACGG - Intronic
1103339952 12:120215934-120215956 CGCTGGGCCTGGGGGCTGGAAGG + Intronic
1103368202 12:120398386-120398408 AAGTGGCCATGGGGGCAGGAGGG - Intergenic
1104102272 12:125624027-125624049 GTGTGGGCCTTGGGGCAGGGTGG - Intronic
1104356279 12:128089795-128089817 ATGTGGGCATGGTGGAGGGAGGG + Intergenic
1104607832 12:130202973-130202995 CTGTGGGCCGCAGGGCAGGAGGG + Intergenic
1104728899 12:131094403-131094425 CTGTGGGCACCGGGGCAGGACGG + Intronic
1104842092 12:131830211-131830233 CTCCGGGCAGGGGGGCAGGTGGG - Intronic
1104920393 12:132287625-132287647 CCATGGCCATCGGGGCAGGACGG + Intronic
1104921230 12:132291799-132291821 CTGAGGGTGTGGGGACAGGAGGG - Intronic
1106149345 13:27083440-27083462 CTGCTGGCATGGGGGCAAGGGGG - Intronic
1106356228 13:28986161-28986183 TTGGGAGGATGGGGGCAGGAAGG + Intronic
1107396426 13:40022831-40022853 CTGTGGGTCTAGGGCCAGGATGG + Intergenic
1108441898 13:50462708-50462730 CTCAGGGAGTGGGGGCAGGAAGG + Intronic
1110136210 13:72070639-72070661 CTGTAGGCAAGCAGGCAGGAAGG + Intergenic
1110803147 13:79723884-79723906 CTGTGGCCATGCTGCCAGGAAGG - Intergenic
1111630004 13:90838416-90838438 TTGAGGGCATGGGGGAAGGTGGG - Intergenic
1112752496 13:102597026-102597048 CGGTGGCCATGGACGCAGGATGG - Exonic
1113514122 13:110878498-110878520 CTCTGGGCTTGGGGGCCGGCGGG - Intergenic
1114183445 14:20383361-20383383 ATTTGGGCAAAGGGGCAGGAAGG + Intronic
1114246890 14:20922537-20922559 GAGAGGGCATGGGGGCAGGTGGG - Intergenic
1114657213 14:24323282-24323304 CTGTGGGCTTGGGCTGAGGAAGG + Intronic
1115503843 14:34075278-34075300 CTGAGGGCTTGGGGGCAGGAGGG - Intronic
1115860557 14:37681624-37681646 CTGAGGGCAGGGGGGATGGATGG - Intronic
1117069945 14:52047404-52047426 GTGTGGGCATGTGGGAGGGATGG + Intronic
1117074787 14:52091046-52091068 CTGTGGGTCTGGGGTCAAGAGGG + Intergenic
1117573571 14:57074170-57074192 CTGTGGGGCGGGGGGCAGGGGGG - Intergenic
1118328243 14:64795952-64795974 CTGTTGGATTTGGGGCAGGAAGG + Intronic
1118588504 14:67380272-67380294 CTGTGGGCATCAGGACAGAAAGG - Intronic
1118961565 14:70538143-70538165 CTGAGGGCTTGGGGGCAGGGCGG - Intergenic
1119199827 14:72744106-72744128 CTGTCTGCATGGGGATAGGAAGG - Intronic
1119298521 14:73552601-73552623 TTGTGGGAATGGGGGCTGGTAGG - Intronic
1119302818 14:73584788-73584810 TTGTGGGAATGGGGGCTGGTAGG - Intergenic
1119419797 14:74501694-74501716 CTGTGGGGGTGGGGGCAGAGAGG + Intronic
1119637256 14:76284514-76284536 ATCTGGGCAAAGGGGCAGGAAGG + Intergenic
1119882858 14:78114806-78114828 CTGAGTGGATGAGGGCAGGAGGG - Intergenic
1120018242 14:79498582-79498604 CTGTGGGCATGAGGAAAGGGAGG - Intronic
1120074615 14:80141306-80141328 CTGTGTTCATGAGGGCAGCATGG - Intergenic
1120492657 14:85196204-85196226 CTGTGGGCAAGGTGGATGGACGG + Intergenic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1120993480 14:90397887-90397909 GGGTGGGGTTGGGGGCAGGAAGG + Intronic
1121004878 14:90483776-90483798 CGCTGGGGATGGGGACAGGAGGG + Intergenic
1121055368 14:90847372-90847394 CTCAGGGAGTGGGGGCAGGAGGG + Intergenic
1121220984 14:92285201-92285223 CCATGGGGATGTGGGCAGGAAGG + Intergenic
1121678196 14:95771456-95771478 CAGTGGGGAAGGGGGCAGGTAGG + Intergenic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122793709 14:104195252-104195274 CTGGGGGCATGGGGTGAGGCAGG + Intergenic
1122920452 14:104877811-104877833 CTGTGGGCAGGGCCGCAGGGTGG - Intronic
1122922948 14:104887442-104887464 CTGAGGCCACCGGGGCAGGACGG + Exonic
1122957304 14:105076693-105076715 CGGAGGGCAGGGGAGCAGGAGGG + Intergenic
1122974693 14:105166275-105166297 CAGTGGGTGTGGGGGCAGGGAGG - Intronic
1124400731 15:29345502-29345524 CTGTGTGCAGGGGGCCAGGTGGG - Intronic
1124849700 15:33324321-33324343 CTGGGGAAATGGGGGAAGGAAGG + Intronic
1125056662 15:35366577-35366599 CTTTGGGGAAGGGAGCAGGAAGG - Intronic
1125715143 15:41815438-41815460 CTGTGGGGATGGGGGCACTGAGG - Intronic
1126699836 15:51357887-51357909 CTGTGCCCATGGGGGCACCATGG - Intronic
1127485290 15:59412805-59412827 CTCTGGGCATCGGGGTAGGAAGG + Intronic
1127497105 15:59523735-59523757 CTGTGGGCTTCGGGGCTGTAGGG + Intergenic
1127778642 15:62291347-62291369 AGATGGGAATGGGGGCAGGAGGG - Intergenic
1127793219 15:62416715-62416737 CTCTGGGCAAAGGGGCAGGGTGG - Intronic
1128525785 15:68411377-68411399 CAGAGGGCATGGGCCCAGGATGG - Intronic
1128526212 15:68414147-68414169 CTTAGGGCAAGTGGGCAGGAGGG + Intronic
1128660502 15:69497543-69497565 GAGAGGGCATGGGGGCAGCAGGG - Intergenic
1128709112 15:69858517-69858539 CTGGGGGCATCGGGCAAGGAGGG + Intergenic
1128719898 15:69940567-69940589 CTGTGGTGGTGGGGGCATGAGGG - Intergenic
1128724983 15:69981900-69981922 CTGTGGGCAGGTGGGCAGGATGG - Intergenic
1128765095 15:70246511-70246533 CTGTGGGTGTTGGAGCAGGACGG + Intergenic
1129184555 15:73897956-73897978 GTGTGTGCTGGGGGGCAGGAAGG - Intergenic
1129200156 15:73993876-73993898 CTGAGGTGGTGGGGGCAGGAGGG - Intronic
1129271549 15:74421761-74421783 CTGGGGGCTAAGGGGCAGGAGGG + Intronic
1129313156 15:74726053-74726075 CTGAGGTCACGGGGGCCGGAAGG + Intergenic
1129692351 15:77721046-77721068 ATGTGAGCATTGAGGCAGGAGGG - Intronic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1129881057 15:79006151-79006173 CTCCGGGCATGGGAGGAGGAGGG + Intronic
1130348459 15:83069249-83069271 CTCTGGGCGTGGGGGCAGGAGGG + Intergenic
1131159333 15:90094346-90094368 CTGTGGGCAGAGGAGCAGGCTGG - Intronic
1131452887 15:92560888-92560910 CTGTGGACCTGGAGGCAGGCAGG + Intergenic
1132603889 16:785687-785709 CCCGGGGCATGTGGGCAGGAAGG + Exonic
1132758420 16:1497129-1497151 CTGTGAGGGTCGGGGCAGGATGG - Intronic
1132846788 16:2004432-2004454 CTGCTGGCATGGGGGCAGCGAGG - Intronic
1132877272 16:2145623-2145645 CTGTAGGCCTGGAGGCAGGGAGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132988329 16:2779595-2779617 TGGTGGGAATGGGGTCAGGAGGG + Intergenic
1133413525 16:5588198-5588220 CTGTGGGAATGGGGGGATGGGGG + Intergenic
1134063011 16:11210394-11210416 TTGTGGGCACGAGGGGAGGAAGG - Intergenic
1134353422 16:13459323-13459345 CTGGTGACATGGGGGGAGGAGGG + Intergenic
1135304193 16:21354724-21354746 CTGTGGGCATGGGGGTGGGGAGG - Intergenic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1136086827 16:27891090-27891112 TTCTGGGGATGGGGGCAGGTTGG - Intronic
1136230843 16:28884365-28884387 CCGTGGACACGGGGGCAGAAGGG + Intronic
1136300934 16:29333861-29333883 CTGTGGGCATGGGGGTGGGGAGG - Intergenic
1136418312 16:30116844-30116866 CTGGGGGCAGGGGAGCAGGGGGG - Intronic
1136714060 16:32262820-32262842 CTGTGAGGATGGGGCCAGAAGGG + Intergenic
1136753844 16:32666599-32666621 CTGTGAGGATGGGGCCAGAAGGG - Intergenic
1136814269 16:33203766-33203788 CTGTGAGGATGGGGCCAGAAGGG + Intronic
1136820745 16:33313846-33313868 CTGTGAGGATGGGGCCAGAAGGG + Intergenic
1136827308 16:33370385-33370407 CTGTGAGGATGGGGCCAGAAGGG + Intergenic
1136832374 16:33469156-33469178 CTGTGAGGATGGGGCCAGAAGGG + Intergenic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1137537264 16:49336832-49336854 CTGTGAGGATGGCGGCAGCAAGG - Intergenic
1137563110 16:49515743-49515765 CTGTGGGGATGCGTGCATGAGGG - Intronic
1137913480 16:52403245-52403267 CTGTGGGGAAGGGGGCACGGCGG + Intergenic
1138539454 16:57679590-57679612 GTGTGGGGCTGTGGGCAGGAGGG - Intronic
1138884440 16:61058935-61058957 CTGTGGGCATGTGGATATGAAGG + Intergenic
1138955131 16:61962331-61962353 CAGCAGGCATGGGGTCAGGATGG + Intronic
1139291972 16:65867591-65867613 GTGTGGGGGTGGGGGCTGGAGGG - Intergenic
1139361493 16:66402575-66402597 CAGTGGGGATGGGGGCATGGGGG + Intronic
1140110070 16:71996590-71996612 AGAAGGGCATGGGGGCAGGAAGG - Intronic
1140266966 16:73429255-73429277 CCTTGGGCATGGGGGAAGGCTGG - Intergenic
1140670164 16:77269868-77269890 CTGGTGGCATGGGCTCAGGAGGG + Intronic
1141240256 16:82259314-82259336 CTTTGAGCAAGGGGGCAAGAGGG + Intergenic
1141376849 16:83539176-83539198 CTGTGGGCAAGGGTGGGGGATGG + Intronic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141630277 16:85283934-85283956 CTGAGGACATGTGGGCAGGAGGG - Intergenic
1141768216 16:86072543-86072565 GTGGGGGCAGGGGGGCAGGCAGG - Intergenic
1142062596 16:88040462-88040484 CTGTAGGCATGGGGACGGGGAGG - Intronic
1142062634 16:88040590-88040612 CTGTGGGCATGGGGGTGGGGAGG - Intronic
1142074244 16:88108223-88108245 CTGTGGGGATGCGGGGAGGGGGG + Intronic
1142100387 16:88267748-88267770 CTGGGGGCAGGGGGTCAGCAGGG + Intergenic
1142125887 16:88410091-88410113 ATGTGGGGGTGGGGGAAGGAAGG + Intergenic
1142248986 16:88982592-88982614 CTCTTGCCATGGGGGCGGGAGGG - Intergenic
1142403334 16:89872665-89872687 TTGGGGACATGGGGACAGGAGGG - Intergenic
1202992845 16_KI270728v1_random:26740-26762 CTGTGAGGATGGGGCCAGAAGGG + Intergenic
1203055996 16_KI270728v1_random:926949-926971 CTGTGAGGATGGGGCCAGAAGGG - Intergenic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1142720910 17:1775203-1775225 CTGTAGGGATAGGGGCAGGGTGG + Intronic
1143401693 17:6649764-6649786 GGGTGGAGATGGGGGCAGGAAGG + Intronic
1143728272 17:8865243-8865265 CTGGGGGGATGGGGGCACAAGGG - Intronic
1144216298 17:13058468-13058490 CTGTGGGCTTGGAGGCACCATGG + Intergenic
1144465192 17:15491326-15491348 AACTGGGGATGGGGGCAGGATGG + Intronic
1144586095 17:16488740-16488762 CTGTGGCCAGGGGTGCAGGCAGG - Intronic
1144756254 17:17682072-17682094 GTGGGGGCATGGGGGCGCGAGGG + Intronic
1145006753 17:19342745-19342767 CTGTGGGTAGGGGGGCAGAGAGG + Intronic
1145997281 17:29111903-29111925 CTGTGGGAAAGGGGCCAGGGTGG + Intronic
1146183516 17:30710959-30710981 ATGTGTGCCTGGGGGCAGGAGGG + Intergenic
1146791623 17:35753822-35753844 CTGTGGCCATGGGGGTGGTAGGG - Intronic
1146821170 17:35984524-35984546 CTGAGGGCATGGAGGAGGGAAGG + Intronic
1147039546 17:37707845-37707867 ATTTGGGCATGGGGGCGGGTAGG + Intronic
1147191373 17:38739984-38740006 CTGTGGGCTTGGCAGCAGGGGGG - Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147592828 17:41695910-41695932 GTGTGGGGATGGGGGCAGGAGGG - Intergenic
1147624835 17:41893255-41893277 CTGTGGACATGGGGCGTGGAGGG - Intronic
1147746886 17:42700235-42700257 CTGTGTGCTTTGGGGCTGGAAGG - Intergenic
1147836264 17:43334185-43334207 CTGTGGGCATGGCTGCGGGTGGG + Intergenic
1147865235 17:43547452-43547474 CTGTGGCCATGGGGGCACAAAGG + Intronic
1147924666 17:43938971-43938993 CTGTGGGCCTGCGGGCAGGGAGG + Intergenic
1147948769 17:44095509-44095531 CTGTGGGAATGGGGGTGGGGTGG + Intronic
1148347029 17:46910167-46910189 CTGTGGGCAAATGAGCAGGAAGG + Intergenic
1148633245 17:49128341-49128363 CTGAAGGCTTGCGGGCAGGAGGG + Intergenic
1148683032 17:49485635-49485657 CTGTCTGCCTGTGGGCAGGAAGG + Intergenic
1148760472 17:49997182-49997204 CTGCGGCGTTGGGGGCAGGAAGG + Intergenic
1149138542 17:53400776-53400798 CTTTGGGTTTGGGGGAAGGAAGG - Intergenic
1149309893 17:55383549-55383571 CTGGGGGGAGGGGGGCACGAGGG + Intergenic
1149656417 17:58311715-58311737 AGGTGGGCCTGGGGGCAGGGGGG + Exonic
1150292932 17:63992131-63992153 CTGTGGGCATGGGAGAAGAGGGG + Intergenic
1151166639 17:72209451-72209473 CCATGGCCCTGGGGGCAGGATGG + Intergenic
1151417762 17:73977628-73977650 CTGTGGGGATGAGAACAGGAAGG + Intergenic
1151518451 17:74612418-74612440 AAGTGGGCATGAGGGCAGGGAGG + Exonic
1151555682 17:74845621-74845643 CTCTGGGTTTGGGGGCAGGCTGG + Intronic
1151733058 17:75922242-75922264 CTGTGGACATTGAGGCAGGAAGG - Intronic
1151855087 17:76715306-76715328 CTGTGGGCGTGGGGGTAAGGAGG + Exonic
1151929943 17:77225974-77225996 CAGTGGACATGAGGGCTGGAGGG - Intergenic
1151960779 17:77404584-77404606 CAGTGGGCTTGGGGGCTGGGAGG + Intronic
1152032468 17:77852932-77852954 CTCTGGGCTTGGGGGCACGGAGG - Intergenic
1152192993 17:78899755-78899777 CTGGGGACATGCGGGTAGGATGG - Intronic
1152449233 17:80365886-80365908 CTGTGGGCATGTGAGCAGGCAGG - Intronic
1152460393 17:80439274-80439296 CTGTGGTGTTTGGGGCAGGAAGG + Intergenic
1152621251 17:81366022-81366044 CTGTGGCCATGAAGGCGGGAGGG - Intergenic
1152677714 17:81650365-81650387 GGGTGGGCAGTGGGGCAGGAGGG - Intergenic
1152754556 17:82081844-82081866 CTGTGGGGGAGGGGGCAGGTGGG + Intronic
1153756336 18:8287370-8287392 ATGTGGCCATGGTGTCAGGAGGG + Intronic
1154028337 18:10727197-10727219 GGGAAGGCATGGGGGCAGGAAGG + Intronic
1154325866 18:13389930-13389952 CTGTGAGCAAGTGGGGAGGAAGG - Intronic
1154342461 18:13515276-13515298 CTGTAGGCATGAGGGAAGGAAGG + Intronic
1155878863 18:31119112-31119134 AGGTGGGCATGAGGGAAGGAAGG + Intergenic
1156118484 18:33816006-33816028 ATGAGGCCATAGGGGCAGGATGG - Intergenic
1156458297 18:37307002-37307024 CTTTAGGCATGGGGGCAGGTGGG + Intronic
1157548638 18:48565425-48565447 CTTGGGGCATGTGGGAAGGAAGG + Intronic
1157581898 18:48778545-48778567 CTCTGGGCATGTTGGCAGAAGGG + Intronic
1158243691 18:55406733-55406755 TTGTGGGGATGGGGGGAGGCGGG - Intronic
1158864086 18:61620352-61620374 CTGAAGGCTTGGGGACAGGAGGG - Intergenic
1159554657 18:69932772-69932794 GTGTGTGCATGTGGGAAGGAGGG - Intronic
1160172734 18:76568171-76568193 AGGTGGACCTGGGGGCAGGACGG - Intergenic
1160767888 19:816517-816539 CTGGGGGCATGGGTGGAGGATGG - Intronic
1160782005 19:881833-881855 TTCTGGGCATGGGAGCAGGGCGG - Intronic
1160881579 19:1323266-1323288 CTGTGACCCCGGGGGCAGGATGG - Intergenic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1160982031 19:1820604-1820626 CTGAGGCCATGGGGGCACAAGGG + Intronic
1161237059 19:3203578-3203600 CTGTGGACACTGGGGCTGGATGG - Intronic
1161480285 19:4506954-4506976 CTGTGGACACGGGGGCTAGATGG + Intronic
1161644454 19:5444536-5444558 CTGTGGGGATGGGGGTGGCAGGG - Intergenic
1161766948 19:6213454-6213476 GGCTGGGCATGGGAGCAGGAAGG - Intronic
1162469344 19:10863079-10863101 CTGTGGGCTGGGGGGCAGTGCGG + Intronic
1162779320 19:12998440-12998462 CTGTGGGCGAGGGGGAAGGGCGG + Intronic
1162818220 19:13208611-13208633 CCGGTGGCTTGGGGGCAGGATGG + Intronic
1162917618 19:13882752-13882774 CTGCGGACATGGGGGCTGGGTGG + Exonic
1162923653 19:13918833-13918855 CTCTGGGGTTGGGGGCAGGCTGG + Intronic
1162975274 19:14204802-14204824 ATGTGTGCCTGGGGGCAGGAGGG - Intronic
1163126621 19:15247683-15247705 CTGTGGGAATCTGGGCATGAAGG + Intronic
1163547361 19:17948168-17948190 CAGTGCGCATGGGGGCGGGGCGG + Intergenic
1163634837 19:18433112-18433134 CTGCGGGCATGGGGACAGCGTGG - Intronic
1164308918 19:24029617-24029639 TTCTGGGCCTGAGGGCAGGAAGG + Intergenic
1164610232 19:29626733-29626755 CTCAGGGCATGGGCCCAGGATGG + Intergenic
1164906935 19:31975406-31975428 ATGAGTGCATGAGGGCAGGAGGG + Intergenic
1165014888 19:32873690-32873712 CGGTGGGGAAGGGAGCAGGATGG - Intergenic
1165037197 19:33042278-33042300 CTGTGGCCAAGGGGGCAGGTGGG - Intronic
1165868515 19:38953861-38953883 GTGTGGGCAAGGGTGCAGGTAGG + Intronic
1166106995 19:40602422-40602444 CTGCGGGGTAGGGGGCAGGAAGG - Intronic
1166829465 19:45630095-45630117 TGGTGGGCATGGGGGGAGGATGG - Intronic
1166960043 19:46491809-46491831 CTCTGGGCAGTGGGGCAGGCGGG - Exonic
1166995089 19:46716361-46716383 CGGTGGCCATGGGGGGAGGCCGG + Exonic
1167096442 19:47377220-47377242 ATCTGGGCATGGGGGCGGGGTGG - Intronic
1167483561 19:49747114-49747136 GAGTGGGCATGTGGACAGGACGG + Intronic
1167854832 19:52229079-52229101 CTGTGGCCATCAGGGCTGGAGGG + Exonic
1168691076 19:58377969-58377991 GTGTGGGGAGGTGGGCAGGATGG - Intronic
925154495 2:1639200-1639222 CTGTGGGCCTGTGGCGAGGATGG - Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925485818 2:4329544-4329566 CTGTGGTCATGGGTGCATAAAGG - Intergenic
926587149 2:14699366-14699388 CTGAGTGCATGGAGGAAGGAGGG - Intergenic
926687987 2:15712929-15712951 CAGTGGGCAGGGGAGAAGGAAGG - Intronic
926756991 2:16244359-16244381 CCGTGGGCCTGGTGGGAGGAGGG + Intergenic
927072835 2:19548270-19548292 CTGCAGGGATGGGGGCAGGGAGG - Intergenic
927863762 2:26576206-26576228 GTGGGGGCAGGTGGGCAGGAGGG - Intronic
927955533 2:27204979-27205001 CTGTTGCCAAGAGGGCAGGAAGG - Intronic
928024320 2:27727629-27727651 CTGTGGGGATGGGGCCACGACGG + Intergenic
928082072 2:28320483-28320505 CTGTGCACATCAGGGCAGGACGG + Intronic
928103289 2:28452039-28452061 CTGTGGCCGTGGGAGCAGGCGGG + Intergenic
928239764 2:29576380-29576402 CAGTGTGCATGGTGGTAGGAAGG - Intronic
928712008 2:34017865-34017887 ATGTGGGCATGTGGGCATGTGGG - Intergenic
929265267 2:39912047-39912069 CTGTGGGCTTGGGAGTAAGATGG + Intergenic
929964570 2:46524642-46524664 CTGTGGGCAAGGGGCCAGTCAGG + Intronic
930022153 2:47008017-47008039 CCGTGGGGATGGGGACAGGAAGG + Intronic
930107739 2:47653341-47653363 CTTTGGGGATCTGGGCAGGAGGG - Intergenic
931020325 2:58037430-58037452 CTATGGGAAAGGGGGCAGGTGGG + Intronic
931750683 2:65327237-65327259 CTGAGGGGATGGGAGCAGGAAGG + Intronic
932485487 2:72081959-72081981 GTGTGGGGGTGGGGGCAGCAGGG - Intergenic
932576792 2:72966784-72966806 CTGTGGGCCTGGCAGCAAGAAGG - Intronic
933779307 2:85790543-85790565 ATGTGGCCATGGAGACAGGAAGG - Intergenic
934548183 2:95236050-95236072 CTGTGGGCAAGGAGTCAGGCTGG + Intronic
934710504 2:96511120-96511142 TTGTGGGGAGGGGGGCAGGAAGG + Intergenic
936384090 2:112013119-112013141 ATGTGGGCATGGGGCCAGGGGGG - Intronic
937144933 2:119636682-119636704 ATGTGGGCCTGGGAACAGGAAGG + Intronic
937247050 2:120500299-120500321 CACTGGGCATGGGGCCAGGAGGG - Intergenic
937263177 2:120599275-120599297 ATGTGGGCGTGAAGGCAGGAGGG + Intergenic
937612257 2:123876161-123876183 CAGTTAGGATGGGGGCAGGATGG + Intergenic
937918099 2:127109219-127109241 TTGAGGGCATTGGTGCAGGAAGG - Intergenic
938187486 2:129244531-129244553 CTGTTGGCTTGGGGGCATCAAGG + Intergenic
940153043 2:150624016-150624038 ATGTGGGGATTGGAGCAGGAAGG - Intergenic
941685300 2:168441713-168441735 ATGTGGGCTTGGGGACAGCAGGG - Intergenic
943116334 2:183676298-183676320 ATGGGGGTTTGGGGGCAGGAGGG + Intergenic
943470953 2:188292693-188292715 ATGTGGGCATGGGGGTGGGGAGG + Intronic
945219582 2:207469978-207470000 CTCTGGCCATGGGGAAAGGAAGG - Intergenic
946311673 2:218885422-218885444 CTGTGGACATGAGGACAGGAGGG + Intronic
946766997 2:223050166-223050188 ATGTGGGAATCGGGGCAGCAGGG + Intergenic
946816889 2:223588034-223588056 CAGTGGGTTTGGGGGCTGGAAGG - Intergenic
947352566 2:229261659-229261681 CTGTGTCCATGGGAGCAGGAGGG - Intronic
947466330 2:230350732-230350754 TTGGGAGTATGGGGGCAGGATGG + Intronic
947493140 2:230612905-230612927 CTGTGGGCAGCTGAGCAGGAAGG - Intergenic
947514005 2:230785373-230785395 GCGTGGGCAGGGGGGCAGGGGGG + Intronic
948267376 2:236644887-236644909 CTGTGGTCATGGGGGCAAGATGG - Intergenic
948608645 2:239152757-239152779 CTGTAGGCATGGAGGCAAGGAGG + Intronic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
948768148 2:240233798-240233820 CTGTGGGCAGGGCCGGAGGAGGG - Intergenic
948779497 2:240310165-240310187 CTCTGTGCTTGGGGACAGGAGGG - Intergenic
948784527 2:240345413-240345435 CTTTGGGCATCTTGGCAGGAAGG + Intergenic
948822326 2:240556305-240556327 CTCTGGGCATGGGAACATGATGG - Intronic
949027593 2:241773787-241773809 CTCTGGGGGTGGGTGCAGGAGGG - Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168910568 20:1443656-1443678 GTGTGCACAAGGGGGCAGGAGGG + Exonic
1169060529 20:2657549-2657571 CAGTGGGGATGGGGGCAGGGAGG + Intronic
1169064988 20:2690122-2690144 CTGTGGGCACTGGGGTAGGGAGG + Intergenic
1169204125 20:3730596-3730618 ATGTGGGGGTGGGGGAAGGAGGG + Intergenic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1170290141 20:14760197-14760219 CTGTCGGGCTGGGGGCAGGGTGG + Intronic
1171896566 20:30814446-30814468 CCGTGGCCAACGGGGCAGGAAGG + Intergenic
1172501794 20:35432936-35432958 CTGTGAGTATGGGGGTAGCAGGG + Intergenic
1172801276 20:37578028-37578050 GTGTGGGGTTGGGGGAAGGAAGG - Intergenic
1172997869 20:39084004-39084026 CAGTGGGGCTGGGGGCAGGGTGG + Intergenic
1173669196 20:44786046-44786068 CTGTCCTCAAGGGGGCAGGAAGG + Intronic
1174097553 20:48101402-48101424 CTGTGGGCAAAGGGGCATCAGGG - Intergenic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175793074 20:61754472-61754494 CAGTGGGCAGGGGGACAGCAGGG - Intronic
1175825925 20:61936481-61936503 CTGTGGGCAGGGGAGGCGGAGGG - Intronic
1175873417 20:62218871-62218893 CCCTGGGCCTGGGGGCAGGAGGG + Intronic
1176062176 20:63177259-63177281 CTGCGCGCGTGGGTGCAGGAGGG + Intergenic
1176119250 20:63446582-63446604 CTGTGGGGCTGGGGGCAGATGGG + Intronic
1176212472 20:63931689-63931711 GGGTGGGCGTGGAGGCAGGAGGG - Exonic
1176251165 20:64120697-64120719 GAGTGGACATGGGGGCAGGCAGG + Intergenic
1176292718 21:5054782-5054804 CAGTGGACATGGGTGCAGGTGGG + Intergenic
1177139304 21:17341434-17341456 AAGTGGCCATGGTGGCAGGATGG - Intergenic
1177166769 21:17612637-17612659 CTGTGGGTATCGGGGGAGGGTGG - Intronic
1177702230 21:24653947-24653969 CTCTGGGGATGGGGTCTGGAAGG + Intergenic
1178356423 21:31913478-31913500 GTGTGGGAATAGGGGCAGGGTGG + Intronic
1179182402 21:39057139-39057161 CTAAGGGCATGGGGGCAGGAGGG - Intergenic
1179335719 21:40451060-40451082 CAGTGGAGTTGGGGGCAGGAAGG + Intronic
1179458154 21:41513861-41513883 ATGTGGCCATGGGTGCAGGCAGG + Intronic
1179539166 21:42073046-42073068 GTGTGCGCATGTGTGCAGGACGG + Intronic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179805200 21:43832852-43832874 CTGTGGGCAACGGGGAAGGCAGG + Intergenic
1179864542 21:44208868-44208890 CAGTGGACATGGGTGCAGGTGGG - Intergenic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180792838 22:18586120-18586142 CAGTTGGCATGAGGGCAGGAAGG + Intergenic
1180815706 22:18787942-18787964 CTTTGGGCAGGTGGGCAGCAGGG - Intergenic
1180960957 22:19762150-19762172 CTGTGTGCCTGGGGACAGCAAGG - Intronic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181201894 22:21222277-21222299 CTTTGGGCAGGTGGGCAGCAGGG - Intronic
1181228898 22:21409199-21409221 CAGTTGGCATGAGGGCAGGAAGG - Intergenic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181249753 22:21525666-21525688 CAGTTGGCATGAGGGCAGGAAGG + Intergenic
1181323318 22:22025475-22025497 CAGTGGCCAGGAGGGCAGGAGGG - Intergenic
1181486899 22:23237285-23237307 CTGTGCTCATGGAGGCAGGCTGG + Intronic
1181631196 22:24152344-24152366 CTGTGGGCATCTGGACAGGATGG + Intronic
1181699855 22:24614691-24614713 CTTTGGGCAGGTGGGCAGCAGGG + Intronic
1181863501 22:25837341-25837363 GTGTGGCCAGGGAGGCAGGAGGG + Intronic
1181897177 22:26120528-26120550 CTATGGGCAAGGGGGAAAGAAGG + Intergenic
1181953418 22:26571153-26571175 CAGTGGGGTTGGGGGCAGAAAGG - Intronic
1182155028 22:28063526-28063548 CGGTGGGCAGTGGGGCAGGGTGG - Intronic
1182422859 22:30257020-30257042 CTCTGGACATGGTGGCTGGAAGG - Intergenic
1182428146 22:30285689-30285711 CTGAGGGCAGGTGGGCAGGAGGG + Intronic
1182497303 22:30718646-30718668 CTGTGGCCCCAGGGGCAGGAAGG - Intronic
1182939551 22:34262256-34262278 CTGTGGGCATAGGGAGTGGAGGG + Intergenic
1183005061 22:34894517-34894539 CAGTGAGGATGGGGTCAGGAAGG + Intergenic
1183353214 22:37344892-37344914 CTCTGGGCATGGAGGCGGCATGG - Intergenic
1183590295 22:38775899-38775921 CTGTGGGGGACGGGGCAGGAGGG + Intronic
1183781807 22:40003594-40003616 GTGTGGGGGTGGGGGCAGGCAGG - Intronic
1183786118 22:40030123-40030145 CTGCAGGGATGGGGCCAGGAAGG - Exonic
1184148959 22:42627609-42627631 CTGTGGGCATGATCGCGGGAGGG - Exonic
1184291183 22:43498892-43498914 CTGTGGGAATGAGGAAAGGAAGG - Intronic
1184351096 22:43944809-43944831 CTGTGGGTGTGTGGGCCGGACGG + Intronic
1184387026 22:44182179-44182201 CTGAGGCCCTGGGGCCAGGAAGG + Intronic
1184414586 22:44344880-44344902 CTGTTGGCCTGGGGGAGGGAGGG - Intergenic
1184751381 22:46488357-46488379 CTGCGGGCTTAGGAGCAGGAAGG - Intronic
1184866488 22:47204483-47204505 CTGTGTGCCTGTGGGGAGGAGGG - Intergenic
1185332818 22:50259268-50259290 CTGTGGACATGAGAGCTGGAGGG + Intronic
1203225017 22_KI270731v1_random:73151-73173 CTTTGGGCAGGTGGGCAGCAGGG + Intergenic
1203265811 22_KI270734v1_random:13633-13655 CTTTGGGCAGGTGGGCAGCAGGG - Intergenic
949891205 3:8734664-8734686 GTGTGGGCCTGGAGGCAGCAGGG - Intronic
950188028 3:10957416-10957438 CAGCGGGCCTGTGGGCAGGAGGG - Intergenic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
950548907 3:13654928-13654950 CAGTGGGCATGGGAGCAGGGAGG - Intergenic
950675853 3:14554030-14554052 GTGTGTGCATGGGGAGAGGAAGG + Intergenic
950831572 3:15879914-15879936 CTGGGGGGCTGGGGGCAGGGAGG - Intergenic
950916081 3:16646629-16646651 CCGTGGGGATGGGGCCAAGAGGG + Intronic
952729706 3:36626015-36626037 CCGTGGCCATGCAGGCAGGATGG + Intergenic
952887074 3:38018481-38018503 CTGTGAGCAGATGGGCAGGAAGG - Intronic
952980177 3:38727833-38727855 CTGAGGGCAGGGGGCCAGGCTGG + Intronic
954456612 3:50603082-50603104 CTGTGGGCAACCGTGCAGGACGG + Intergenic
954618249 3:51981261-51981283 CTTTGGGCCTGGGAGCTGGAGGG + Intronic
954917970 3:54164685-54164707 CAGTGGGGATGGGGGAAGGATGG + Intronic
955225364 3:57056049-57056071 CTGTGAGCATGGTGACAGTAGGG - Intronic
955391393 3:58524773-58524795 CTGAGGGCCTCGAGGCAGGACGG - Intronic
955503653 3:59609690-59609712 ATGGGGGCATGGGGACTGGAAGG + Intergenic
955543075 3:59998752-59998774 CTGTAGGGAAGGGGACAGGAAGG - Intronic
956289382 3:67646053-67646075 CTGTGGGCACGGGGAAGGGAGGG + Intronic
956295174 3:67704518-67704540 TTCTACGCATGGGGGCAGGAAGG - Intergenic
956894195 3:73642959-73642981 TTGTGGCCATGGGGACAGGGAGG - Intergenic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
957530469 3:81434411-81434433 CGGTTGTCATGGGAGCAGGAAGG + Intergenic
959295306 3:104528131-104528153 TTGTGGGATGGGGGGCAGGAGGG - Intergenic
959956231 3:112240984-112241006 GTGGGGGGATGGGGGCAGGTGGG + Intronic
960337967 3:116441624-116441646 CTATGGGTATGAGGGTAGGAGGG + Intronic
960900884 3:122553336-122553358 ATCTGGGCATGGGGGAAGGAAGG - Intronic
961010127 3:123430032-123430054 CTGAGGGCATGGGGGAATGGAGG - Intronic
961455647 3:127022640-127022662 CTGTAGGAAGGGGGGCAGGGTGG + Intronic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961829520 3:129616280-129616302 GTGTGTGCATGTGGGCATGAGGG + Intergenic
962385051 3:134926137-134926159 GTGTGGGGATGGGGGCACGCAGG + Intronic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
967982391 3:195073478-195073500 TTGTGGGCATGAGGGGGGGAGGG - Intronic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968486703 4:866405-866427 CTGTGGGCAGACGGGAAGGATGG + Exonic
968502940 4:959548-959570 CTGGGGGCGTGGGAGCAGGAGGG + Exonic
968592528 4:1466134-1466156 GTGTGGGCAGTGGGGCGGGAGGG - Intergenic
968603107 4:1519642-1519664 CTGTGGGCAGGGGCGCCGCAGGG - Intergenic
968622907 4:1611700-1611722 CGGTGGGCAAGGGGCCAGCATGG + Intergenic
968649336 4:1754200-1754222 CTGGGGGCATGTGGGGAGGAGGG + Intergenic
968690438 4:1987281-1987303 CTGGGGGCCAGAGGGCAGGACGG - Intronic
968690525 4:1987621-1987643 CGCTGGGCATGGAGACAGGAAGG - Intronic
968690544 4:1987701-1987723 GTGTGGGCACGGAGACAGGAGGG - Intronic
968730950 4:2268938-2268960 GGGTGGGCGTGGGGGCAGGCAGG + Intergenic
968756234 4:2417835-2417857 CAATGGGGGTGGGGGCAGGACGG + Intronic
969409992 4:7021868-7021890 CTGTGAGCCTGAGGGCAGCAGGG + Intronic
969832169 4:9806664-9806686 CTGTGTGCATGGGGGGTGGGAGG + Intronic
970219678 4:13797840-13797862 CTATGGACATGGGGGATGGAGGG + Intergenic
970820471 4:20205837-20205859 TTGTGGGCCAGGGGTCAGGAGGG + Intergenic
972198517 4:36683342-36683364 CTGCGGGAATTGGGGAAGGAAGG + Intergenic
972572911 4:40327107-40327129 CTGAGGGCAGGTGGGCAGGTGGG + Intergenic
972687011 4:41361161-41361183 CTGCGCGCGTGAGGGCAGGAAGG + Intronic
972861959 4:43180208-43180230 CATTGTGCATGAGGGCAGGAAGG - Intergenic
973584536 4:52377245-52377267 CTGAGGGCGCGGGGCCAGGATGG + Intergenic
973822746 4:54677243-54677265 GAGTGGGGATGGGGGCGGGAGGG - Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
974960058 4:68687334-68687356 CTGGGGGCATGGGGGTAAGCAGG + Intergenic
977179505 4:93856942-93856964 CTGTGGGAATGGGTGCCGGTGGG - Intergenic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
978189734 4:105896831-105896853 CTTTGGGCCTGGGGGTAGAAAGG + Intronic
978829387 4:113066179-113066201 TTGTGGGGCTGGGGGGAGGAGGG - Intronic
979488526 4:121297014-121297036 GGCTGGGCATGGGAGCAGGAGGG + Intergenic
979558092 4:122073775-122073797 CTTTAGGCATGGGGACAGGGAGG - Intergenic
979558693 4:122078582-122078604 CTTTAGGGATGGGGACAGGAAGG - Intergenic
980115964 4:128679186-128679208 CAGTGGGCATGGTGGAAGGTGGG + Intergenic
982899650 4:160981838-160981860 CTGTGGGCATTGGGGGTGGAGGG + Intergenic
982909678 4:161124020-161124042 GTGGGGACATGGGGGTAGGAAGG + Intergenic
983574924 4:169250684-169250706 TAGTGGGGATGGGGGTAGGAGGG + Intronic
984985830 4:185328871-185328893 CTGAAGGCTTGGGGGCAGGAGGG + Intronic
985110291 4:186541062-186541084 CTGAGGGAATGGAGGCAGGGTGG - Intronic
985445365 4:190018712-190018734 CCGTGGCCAACGGGGCAGGAAGG - Intergenic
985624462 5:977740-977762 GTGGGGGCATGGGGACAGGGCGG - Intergenic
985789036 5:1915576-1915598 CTCAGCACATGGGGGCAGGAGGG - Intergenic
986056180 5:4139084-4139106 CAGTGGTCATCAGGGCAGGAGGG - Intergenic
986353740 5:6904108-6904130 CTGGGGACATGGGGTCTGGATGG + Intergenic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
986589824 5:9357033-9357055 CTGTGTGAATGGGCTCAGGAAGG - Intronic
986841926 5:11707331-11707353 CTGTGTGCATGAGAGGAGGATGG - Intronic
987104268 5:14621907-14621929 CTGGGGGGTCGGGGGCAGGAAGG + Intergenic
988075541 5:26349352-26349374 CAGTGGGCCTGGAAGCAGGAAGG - Intergenic
988434226 5:31154594-31154616 GAATGGGAATGGGGGCAGGAAGG - Intergenic
988483500 5:31649015-31649037 CTCTGGGTTGGGGGGCAGGAGGG - Intronic
992166362 5:74055925-74055947 CTGGGGGCATGGGGGAAGGAGGG - Intergenic
992657110 5:78921894-78921916 CTGTGTTCTTGGGGGAAGGAAGG + Intronic
994305517 5:98199261-98199283 ATGTGTGCATGGGGGCAGGGTGG + Intergenic
994926250 5:106120721-106120743 CTGTGAACCTGGAGGCAGGAGGG - Intergenic
995866199 5:116693831-116693853 CATTGTGCATGGGGGGAGGAGGG + Intergenic
996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG + Intronic
996640240 5:125743150-125743172 CTGGGGACTTGGGGGAAGGATGG + Intergenic
997602596 5:135150566-135150588 CTGTGGCCATGGGCACAGGCTGG + Intronic
998191658 5:140030477-140030499 CTGTGGGCATAGGTGAAGCAGGG + Intronic
998226778 5:140333218-140333240 CTGTGGGCCTGGGGCCATGGGGG + Exonic
998369870 5:141654038-141654060 CTGGGGGATTGGGGGCTGGATGG + Exonic
998487280 5:142513782-142513804 CTCTGGCCAAGGGGACAGGAAGG - Intergenic
998545485 5:143023863-143023885 GTGTGGGGAGGAGGGCAGGAAGG - Intronic
999122298 5:149218784-149218806 CTGTGGGGATGGGGGAAGAGAGG - Intronic
999269768 5:150289960-150289982 GTGTGGGCCTGGGGGTGGGATGG + Intronic
999467608 5:151822461-151822483 CTGTGGGCGGGGGGTCAGGAGGG - Intergenic
1001028585 5:168245149-168245171 CTGTGAGGGTGGGAGCAGGAGGG - Intronic
1001603849 5:172946311-172946333 CTGTGGGGATGGGGCCTGGGAGG - Intronic
1001925440 5:175632914-175632936 GTGTGGGCATGGGCCCAGGAAGG - Intergenic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1002854817 6:1027332-1027354 CTGGGGAACTGGGGGCAGGAAGG + Intergenic
1004090335 6:12494366-12494388 CTGTAGGCAAGGTGGCATGAAGG - Intergenic
1004427763 6:15517677-15517699 CTGCGGACACTGGGGCAGGACGG + Intronic
1006323268 6:33333589-33333611 CTGGGGGAGTGGGGGAAGGAAGG + Intergenic
1006339336 6:33438026-33438048 CTGGGGGCATGGGTTCGGGAGGG + Exonic
1006382037 6:33704607-33704629 TGGTGGGGATGGTGGCAGGACGG - Intronic
1006633539 6:35446292-35446314 CAGTGGGCATGGGTGCAGTTGGG - Intergenic
1006638269 6:35475319-35475341 CTGCAGGTATGGGGGCAGCAGGG - Exonic
1006639034 6:35479568-35479590 CTCTGGGCATGGGGGCCTGGGGG + Intronic
1006676918 6:35771258-35771280 GTGTGGGCAGGGTGGCAGCACGG + Intergenic
1006808867 6:36806947-36806969 CTATGTGGATGGGGCCAGGATGG - Intronic
1006917310 6:37602931-37602953 CAGTGAGCATGTGGGAAGGAGGG - Intergenic
1007231017 6:40347857-40347879 CTGTGGGGAGGAGGGGAGGAGGG - Intergenic
1007737392 6:43990210-43990232 GTGAGGGCATGGGGGCTGCAGGG + Intergenic
1007761324 6:44135223-44135245 ATGTGGGCATGGGGGCATGAGGG + Intronic
1007790575 6:44306082-44306104 CTGTGGACATGGGGAGAGGCAGG + Intronic
1007896133 6:45361028-45361050 CTCAGGAGATGGGGGCAGGAGGG + Intronic
1008485726 6:52033341-52033363 TTGTGGGTGTGGGGGCAGGATGG - Intronic
1008696861 6:54048501-54048523 CAGTGGGCATGTGGTCATGAAGG + Intronic
1009424553 6:63500081-63500103 CTGAGGGGATTGGAGCAGGATGG - Intergenic
1010562106 6:77363124-77363146 GGGTGGGGGTGGGGGCAGGATGG + Intergenic
1011290510 6:85772229-85772251 GTGTTTGCATGGAGGCAGGACGG + Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1015692213 6:135937742-135937764 CAGAGGTCATTGGGGCAGGATGG - Intronic
1015945156 6:138492212-138492234 ATGTGGGGATGGGAGCAGGAGGG + Intronic
1017399828 6:154047307-154047329 CTGAGGGCCTGGGTGCAAGATGG + Intronic
1018873860 6:167803429-167803451 CTGTGGGCCTGGAGGCAGAGGGG + Intergenic
1019211242 6:170407151-170407173 CCGTGGCCATGGTGGCAGCAGGG - Intergenic
1019621194 7:1992861-1992883 TTGTGGGCCTGGGGCCAGAACGG + Intronic
1019876622 7:3817685-3817707 CCTTGGGCATGGGGGAGGGAGGG - Intronic
1019918243 7:4147101-4147123 CTGTGGGAATGAGGACGGGAGGG + Intronic
1020144792 7:5634195-5634217 CTGTGACCATGGGGGAAGAACGG + Intronic
1020198144 7:6058650-6058672 CCCAGGGCATGGGGGCAAGACGG + Intronic
1020269965 7:6589182-6589204 CTCTGGGCATGTGGACAGGAGGG + Exonic
1020618987 7:10496151-10496173 CTGGTGGCATGGGCTCAGGAGGG - Intergenic
1021949676 7:25762468-25762490 ATGTGGGCATAGGGTCAGGTTGG - Intergenic
1022477836 7:30723370-30723392 CTGTAGGCTTGGGGGCAGCCAGG + Intronic
1022515871 7:30974690-30974712 CTGTGGGGCTGGGGGAAGGTGGG + Intronic
1022798609 7:33753437-33753459 CAGTGGGCAAAGAGGCAGGAGGG - Intergenic
1023689539 7:42772193-42772215 CAGTGGGAATGGAGGCAGCAAGG - Intergenic
1023805351 7:43869262-43869284 CTGGGGGCCTGGGGGCCGGGGGG - Intronic
1023875226 7:44283081-44283103 CTGTGGAGGTGGGTGCAGGAAGG - Intronic
1024948525 7:54834883-54834905 CGGTGAGCATGAGGACAGGACGG - Intergenic
1025022037 7:55487877-55487899 CTGTAGGCCTGGGGGAAGGAAGG - Intronic
1026589683 7:71684139-71684161 CCCTGGGCCTGGGTGCAGGAGGG - Intronic
1026826052 7:73582263-73582285 CTGTGGGCAGTGGGGTAGGGAGG + Intergenic
1026883098 7:73919885-73919907 CAGTGGGGAGGGGGGGAGGAGGG - Intergenic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1026979806 7:74519626-74519648 CTGGGGGCAAGGGGGCAGGAAGG - Exonic
1027348442 7:77286348-77286370 TTTGGGTCATGGGGGCAGGATGG - Intronic
1027960434 7:84939662-84939684 CTGTGGCCCTGGGGGTAGGTGGG + Intergenic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1032076935 7:128840525-128840547 CTGAGGAGATGGGGGCAGGGTGG - Intronic
1032089171 7:128902723-128902745 CAGTGGGCCTGAGGGCAGGGAGG + Intronic
1032389841 7:131548809-131548831 CTGGGGGCATATGGGCAGGAAGG - Intronic
1032477513 7:132222462-132222484 GTGGGGGGAGGGGGGCAGGAGGG - Intronic
1033097324 7:138442572-138442594 CTGGGGGGCTGGGGGCAGGGAGG - Intergenic
1033530022 7:142252487-142252509 GTGTGGGCATTGTGCCAGGAAGG - Exonic
1034271770 7:149806566-149806588 CTGTGAGGGTAGGGGCAGGAGGG + Intergenic
1034686048 7:152972398-152972420 CTGAGAGCATAGAGGCAGGAAGG + Intergenic
1034836006 7:154352000-154352022 CAGTGGGCAGGAGGACAGGAAGG - Intronic
1035021667 7:155804237-155804259 CTGCGGGCAGGCGGGCAGGCGGG - Intronic
1035248569 7:157581379-157581401 CTGTGGGCCTGGGGTGGGGAGGG + Intronic
1035397706 7:158546146-158546168 GTGTGAGCATGAGGACAGGAAGG + Intronic
1035479102 7:159167668-159167690 CTGAGGGGCTGTGGGCAGGATGG + Intergenic
1035588687 8:796741-796763 GTGCGGGCATGGGGCCATGAAGG - Intergenic
1035597620 8:871171-871193 CTGTGGGAAGGGGTGCAGGCTGG - Intergenic
1035624493 8:1060804-1060826 CTGTGGGCCTGGGAGGAGGCAGG + Intergenic
1035690678 8:1557551-1557573 CTGGCGGCATGAAGGCAGGACGG - Intronic
1035898492 8:3431845-3431867 CTGTGGGCGTGGTGGCAGGCTGG - Intronic
1035920111 8:3667520-3667542 CTGTTGGGATGAGGTCAGGAAGG + Intronic
1036217442 8:6892397-6892419 CTGAGGGCAGGAGTGCAGGATGG - Intergenic
1036373991 8:8184429-8184451 CAGTGGCCATCGAGGCAGGATGG + Intergenic
1036401627 8:8413837-8413859 CTGGGTGCCTGGGGGGAGGAGGG + Intergenic
1036644352 8:10602441-10602463 CTGTGGACACGGGGGCAGGAGGG + Intergenic
1036778306 8:11628606-11628628 CTGTGGGAATGATTGCAGGAAGG + Intergenic
1036786106 8:11688623-11688645 GTGTGTGCATGGGGACAGGAGGG + Intronic
1036876912 8:12481210-12481232 CAGTGGCCATCGAGGCAGGATGG - Intergenic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037806536 8:22060723-22060745 CAGTGGGGTTGTGGGCAGGAAGG + Intronic
1037834832 8:22209715-22209737 CGTGGGGCATGGGGCCAGGAGGG - Intronic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037880770 8:22572441-22572463 TTGTGGGTATGTGGGCAGGCCGG + Exonic
1038480222 8:27896702-27896724 TTGGGGCCATGGTGGCAGGAGGG - Intronic
1038692264 8:29774177-29774199 CTGTGGGCATTGGGGGAGGGAGG - Intergenic
1039581395 8:38669712-38669734 CAGTGAGCATGGGCTCAGGAAGG - Intergenic
1039617298 8:38966297-38966319 CTTTGGGGATGGGGGGATGAGGG + Intronic
1040348306 8:46533794-46533816 CTCTGGGCATGGGAACATGATGG - Intergenic
1040447519 8:47510939-47510961 GTGTGTACAAGGGGGCAGGAGGG + Intronic
1040912533 8:52534744-52534766 GTGTGTGCAGAGGGGCAGGAAGG + Intronic
1041406227 8:57502188-57502210 GTGTGGGGTTGGGGGCAGGCAGG + Intergenic
1041499870 8:58528950-58528972 CTGTGAGAATGGAAGCAGGATGG - Intergenic
1041776488 8:61528720-61528742 CTGTGGGTGAAGGGGCAGGAAGG - Intronic
1042373481 8:68019423-68019445 CTGTCGGCAAGGTGGGAGGAAGG + Intronic
1042654974 8:71085861-71085883 CTGAAGACATGGGGGCAGGTGGG + Intergenic
1043362410 8:79490271-79490293 CTGTGGGCAGTGGGGGAGAAAGG + Intergenic
1043567200 8:81561624-81561646 CTGTGTGCATGGGGGAAGGAGGG + Intergenic
1044085126 8:87934639-87934661 TTGTGGGCATGGGGGTGGGGTGG + Intergenic
1044419108 8:91971021-91971043 TAGTGGGCATGGTGGCTGGAAGG - Intronic
1045151134 8:99409394-99409416 CTGTGAGTATTGGGGCTGGAGGG + Intronic
1047179370 8:122572528-122572550 GTGTGTGCATGGGGGCAGGAAGG + Intergenic
1047349746 8:124062264-124062286 ATGTCAGCATGGAGGCAGGAAGG - Intronic
1047425201 8:124739077-124739099 TTGGGGGCAGGGGGGCAGGGGGG + Intergenic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047861663 8:128973565-128973587 CTGTGGGCCTGGTGGTAGGCTGG - Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048800307 8:138188687-138188709 CAGTGGGCAGGGCTGCAGGAAGG - Intronic
1048892953 8:138964266-138964288 CGGAGGGCAAAGGGGCAGGAGGG - Intergenic
1048916826 8:139192609-139192631 CTGGGAGCATGGGGTAAGGAGGG + Intergenic
1048987676 8:139743739-139743761 CTGTGGGGTGGGGGGCAGGCAGG + Intronic
1049204117 8:141355447-141355469 CTGTGTGGCTGGGAGCAGGAGGG - Intergenic
1049218244 8:141417560-141417582 CTGTGGGCTGGGGGTCCGGAGGG - Intronic
1049435818 8:142585756-142585778 CTGTGGAGACGGGTGCAGGAGGG - Intergenic
1049664355 8:143836422-143836444 CTGTGGGCGTGGGGAAAGGGAGG + Intronic
1049693482 8:143972867-143972889 CTGTGGGCTAGGGGTCAGGGTGG - Intronic
1049709940 8:144058939-144058961 CTGTGGGATTTGGGGCCGGAGGG - Intronic
1049710059 8:144059386-144059408 GGGTGGGCATGGCGGCAGGCAGG + Intronic
1049865589 8:144933607-144933629 CTGTGGGCAGGAGGGGAGGTTGG - Intronic
1050143254 9:2538637-2538659 CTGTGGGGAGGTGGGGAGGAGGG - Intergenic
1050350254 9:4734384-4734406 GTGTGGGCATGGGAGCAGGAGGG - Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1053307553 9:36995127-36995149 GTGTGGCTTTGGGGGCAGGAAGG - Intronic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1057443863 9:95100018-95100040 CTGTGGACATGGTGGCAGCAGGG - Exonic
1057545937 9:96020757-96020779 CTGTGGGGATGGGGAGTGGACGG + Intergenic
1057674404 9:97127332-97127354 AGGAGGGCCTGGGGGCAGGAGGG + Intergenic
1057704137 9:97385880-97385902 CTGGGGGCCTGGTGGCTGGATGG + Intergenic
1058777598 9:108300354-108300376 CGGTGGGCATGGAGGCATGATGG - Intergenic
1058938595 9:109792040-109792062 ATGTGGGAATGGGGGCTGGGGGG + Intronic
1059336011 9:113568873-113568895 GAGTGGGGATGGGGGCAGGATGG + Intronic
1059415018 9:114156907-114156929 CTGGTGTCCTGGGGGCAGGATGG - Intronic
1059841506 9:118222632-118222654 CTGAGGGCATAGTGGCAGCATGG + Intergenic
1060395933 9:123316561-123316583 CTGTGGGGATGGGGGTTGGAAGG + Intergenic
1060783525 9:126431336-126431358 ATGATGGCTTGGGGGCAGGAAGG + Intronic
1061016928 9:127986738-127986760 CTGTGGGCATCAGGGCTGCAGGG - Intergenic
1061042495 9:128148288-128148310 ATCTGGGCTTGGGGGCAGCAGGG - Intergenic
1061135351 9:128730392-128730414 CTCTGGGCAGCGGGGCAGGCTGG + Exonic
1061284281 9:129613367-129613389 CTGTAGGCAAGGGGGGTGGAGGG + Intronic
1061332525 9:129904716-129904738 CTGTGGGAAAGAAGGCAGGAAGG - Intronic
1061498578 9:130989749-130989771 CGTTGGGCATGGAAGCAGGAAGG - Intergenic
1061499270 9:130992871-130992893 CAGTGGGCAAGGGGACAGGATGG + Intergenic
1061814860 9:133188582-133188604 CTGGGGGCCTGGCGGCTGGAAGG + Intergenic
1061921976 9:133787478-133787500 TTTTGGGCATGAGGGCAGGGAGG + Intronic
1061962814 9:133997040-133997062 CTCAGGGCCTGGGTGCAGGAAGG - Intergenic
1062017275 9:134297149-134297171 CTGTGTGCCTGGAGCCAGGACGG + Intergenic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062264062 9:135678799-135678821 CTGGAGGGATGGGGGCAGGGTGG - Intergenic
1062296859 9:135835232-135835254 CTGTGTGTGTGGGGGCGGGAGGG - Intronic
1062365691 9:136207969-136207991 CTGTGGACCTGGGGGTTGGAAGG - Exonic
1062402914 9:136380262-136380284 CTGGGGGGTTGGGGGCAGGGTGG + Intronic
1062446723 9:136598339-136598361 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1062446736 9:136598380-136598402 CTGGGGGAGTGTGGGCAGGAGGG + Intergenic
1062446738 9:136598388-136598410 GTGTGGGCAGGAGGGCAGCAGGG + Intergenic
1062446751 9:136598437-136598459 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1062446765 9:136598486-136598508 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1062446779 9:136598535-136598557 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1062446792 9:136598584-136598606 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1062446798 9:136598609-136598631 GTGTGGGCATGAGGGCAGCAGGG + Intergenic
1062446811 9:136598650-136598672 CTGGGGGAGTGTGGGCAGGAGGG + Intergenic
1062446813 9:136598658-136598680 GTGTGGGCAGGAGGGCAGCAGGG + Intergenic
1062446827 9:136598707-136598729 GTGTGGGCAGGAGGGCAGCAGGG + Intergenic
1062446841 9:136598756-136598778 GTGTGGGCAGGAGGGCAGCAGGG + Intergenic
1062475530 9:136724969-136724991 CTGTGGCCCTGGGGGCAGGTGGG + Intergenic
1062745275 9:138208018-138208040 CTGAGTGCATGGGTCCAGGAAGG + Intergenic
1203785007 EBV:122705-122727 ATGTGGGCATTGGTGCAGGTTGG + Intergenic
1203376599 Un_KI270442v1:382416-382438 CCGTGGCCAACGGGGCAGGAAGG - Intergenic
1185701486 X:2234159-2234181 CTGTGTGCATGGGTGAAGGCAGG - Intronic
1185701497 X:2234235-2234257 CTGTGTGCATGGATGCAGGCAGG - Intronic
1185701508 X:2234311-2234333 CTGTGTGCATGGGTGAAGGCAGG - Intronic
1185791069 X:2928671-2928693 CTGGGGGGTTGGGGGCGGGACGG + Intronic
1186559482 X:10595658-10595680 CTGAGGGTATGGGGGAAGGGAGG + Intronic
1189006456 X:36999931-36999953 CAGTTTGCATGGGGACAGGAAGG - Intergenic
1189280311 X:39816387-39816409 CTGTGGGCCTAGAGGCAGGCAGG + Intergenic
1189613707 X:42763898-42763920 CTAAAGGCTTGGGGGCAGGAGGG - Intergenic
1189625767 X:42895262-42895284 CTGGGAGACTGGGGGCAGGACGG + Intergenic
1190014721 X:46817133-46817155 CTGTGGACAGGAAGGCAGGAAGG + Intergenic
1190287392 X:48970538-48970560 GTGTGGGGATGGGGCCAAGAAGG + Exonic
1190363053 X:49667025-49667047 CTGTGGGACTGGTGGCAGAATGG + Intergenic
1190455126 X:50619489-50619511 CTGTGGGCCCGGGGGCAAGCAGG - Intronic
1190729165 X:53213568-53213590 CTATGGGTATAGGGGCAGTAAGG - Intronic
1191684888 X:63879531-63879553 CTGTGGTCATGGTGGCAGGTTGG - Intergenic
1192264701 X:69530396-69530418 CTGTAGGGATATGGGCAGGAGGG - Exonic
1192452634 X:71253478-71253500 GTGTGGGCACGGGGCCAGGGCGG - Intronic
1192573056 X:72222031-72222053 CTGGAGGCTTGAGGGCAGGAGGG - Intronic
1194110270 X:89824827-89824849 CTGTGGGCATGTGGGGATGGAGG + Intergenic
1194937759 X:99971190-99971212 CTGTGGGGATGGGGGAGGGATGG + Intergenic
1195614144 X:106899722-106899744 CTGTGTGCATGTGGGGAGGAGGG - Intronic
1195683082 X:107563255-107563277 CCTTGGGTGTGGGGGCAGGAGGG + Intronic
1195937450 X:110139313-110139335 CTGTGGGGATGGGTGCAGGGAGG + Intronic
1196535677 X:116840833-116840855 ATGAAGGCATGGTGGCAGGAGGG + Intergenic
1197487853 X:127075476-127075498 CTGTGTGCTTGGGGGAGGGAGGG - Intergenic
1198637948 X:138720650-138720672 CCGTGGGCAGGAGGGCAGGAGGG + Intronic
1199473400 X:148220038-148220060 CTTTGGGAATGGGGGTAGGGAGG - Intergenic
1199680804 X:150223384-150223406 CTGGGGCTATGGGGGCAGGGAGG - Intergenic
1199844226 X:151679095-151679117 CTGTGGGTCTGGGGGCACAAGGG + Intergenic
1199999166 X:153048409-153048431 ATGTGTGCATGTGGGCAGGGTGG - Intergenic
1200058632 X:153474327-153474349 CTGGTGGCCTGGGGGCAGGATGG - Intronic
1200119114 X:153782066-153782088 CTGTGGGCTTCAGGGCAGGGTGG + Intronic
1200462931 Y:3479568-3479590 CTGTGGGCATGTGGGGATGGAGG + Intergenic
1200745485 Y:6900268-6900290 CTGTGGGCAGGCGGGCAAGGAGG + Intergenic
1201636571 Y:16129028-16129050 CTGAAGGCTTGGAGGCAGGAAGG - Intergenic