ID: 1089351777

View in Genome Browser
Species Human (GRCh38)
Location 11:117825383-117825405
Sequence CCAGGCCAAATGGTGGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089351777_1089351789 30 Left 1089351777 11:117825383-117825405 CCTCCTACCACCATTTGGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 178
Right 1089351789 11:117825436-117825458 TGGAGCATGCAGGATCCTTAAGG 0: 1
1: 0
2: 0
3: 9
4: 162
1089351777_1089351784 10 Left 1089351777 11:117825383-117825405 CCTCCTACCACCATTTGGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 178
Right 1089351784 11:117825416-117825438 GTGTCCTTGCCAGTTTACCATGG 0: 1
1: 0
2: 2
3: 7
4: 112
1089351777_1089351787 20 Left 1089351777 11:117825383-117825405 CCTCCTACCACCATTTGGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 178
Right 1089351787 11:117825426-117825448 CAGTTTACCATGGAGCATGCAGG 0: 1
1: 0
2: 2
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089351777 Original CRISPR CCAGGCCAAATGGTGGTAGG AGG (reversed) Intronic
902388770 1:16090858-16090880 CCAGGACAGATGGAGGAAGGGGG - Intergenic
903914602 1:26754478-26754500 CCTGACCATATGGTGCTAGGGGG + Intronic
904008939 1:27379210-27379232 CCAGGCCAGTTGGTGGAAAGAGG + Exonic
905366634 1:37455148-37455170 CCAGACCACCTGGTGGGAGGCGG + Intergenic
906941933 1:50263054-50263076 CCAGGGCAGATGATAGTAGGAGG + Intergenic
907270141 1:53286273-53286295 CCAGGCAAAATGCTGCTAGCTGG + Intronic
910056143 1:83035133-83035155 CCAGGGAAAATGGGGGTTGGAGG - Intergenic
910373938 1:86549082-86549104 ACAGGTCAGATGGTGGTAGTAGG + Intronic
914457538 1:147850079-147850101 AGAGGTCAAATTGTGGTAGGTGG - Intergenic
915601185 1:156924168-156924190 CCGGGCCAAATGGAGGGACGCGG + Intronic
919470457 1:197972505-197972527 CCAGGACAAATGCTGTTAGAAGG + Intergenic
920269882 1:204754935-204754957 CCATACCAAGTGGTGGGAGGAGG - Intergenic
921124087 1:212161563-212161585 CCAGGATTAGTGGTGGTAGGAGG + Intergenic
921380789 1:214522631-214522653 CTACACCAAATGGTGGTAAGTGG + Intronic
922334383 1:224606828-224606850 CCAGGACCAATGGTGGAGGGAGG + Intronic
923553841 1:234985374-234985396 CAAGGCCCAAGGGTTGTAGGTGG - Intergenic
924099629 1:240590002-240590024 CCAGGACACATGGTGGGAGGTGG + Intronic
1063231134 10:4066829-4066851 CCAGGGCCGCTGGTGGTAGGTGG - Intergenic
1064524416 10:16239102-16239124 CCAGTCTGAATGGTGGAAGGAGG - Intergenic
1066993012 10:42534424-42534446 CCATTCTAAATGGTGGGAGGTGG + Intergenic
1069602504 10:69717036-69717058 CCAGGCCGAATGGCAGGAGGAGG - Intergenic
1072213465 10:93268255-93268277 CCAGGAGAGATGGTGGGAGGAGG - Intergenic
1073242195 10:102066084-102066106 CCAGGCCAGGTGGTGGCAGTGGG - Exonic
1073247030 10:102098377-102098399 CAAGGGCAAATGGTAGCAGGAGG - Intergenic
1075886977 10:125908593-125908615 CCAGGGGAAAGGGTGGGAGGGGG + Intronic
1076737826 10:132466661-132466683 GCAGGCCAGACGGTGGTGGGAGG - Intergenic
1079496577 11:21051378-21051400 TCAGGAGAAATGGTGGGAGGGGG + Intronic
1079662892 11:23063763-23063785 CCAGGCTAGCTGGGGGTAGGAGG - Intergenic
1081539494 11:44020775-44020797 TCAGGGGAAATGGTGGGAGGGGG - Intergenic
1083722769 11:64611634-64611656 CTAGGGAAAATGGTTGTAGGGGG - Intronic
1086108035 11:83168718-83168740 CCAGGACAAATGGGGGGAGGAGG + Exonic
1087803127 11:102525687-102525709 CTCGGCCAAAGGGTGGTGGGAGG + Intronic
1089351777 11:117825383-117825405 CCAGGCCAAATGGTGGTAGGAGG - Intronic
1091180556 11:133600568-133600590 CCAGGCCAGGTGGTGGTATACGG + Intergenic
1091763452 12:3102975-3102997 CCAGGCCACTTGCTGTTAGGTGG + Intronic
1092894503 12:12999869-12999891 CCAGTCCAAATGCTGGGCGGTGG + Intronic
1096541893 12:52312666-52312688 CCAGGCAAAATGGTGATGGCTGG + Intergenic
1096555405 12:52400667-52400689 CCAGGCAAGCTGGTGGCAGGGGG + Intronic
1096575630 12:52551056-52551078 CCAGACCAAATGCTGGAAGACGG - Intronic
1098200125 12:68045490-68045512 CCAGGCCTATTGGTGGGTGGGGG - Intergenic
1101075898 12:101129597-101129619 CCAGGGGAAACGGTGGAAGGAGG + Intergenic
1101881554 12:108629288-108629310 CCAGGCAAACTGGGGGTGGGGGG + Intronic
1104724823 12:131069396-131069418 CGAAGCCACATGGTGGTTGGAGG - Intronic
1104802486 12:131564088-131564110 CGAAGCCACATGGTGGTTGGAGG + Intergenic
1106926059 13:34614335-34614357 CCTGGCCAAATGGTGGGGGTAGG + Intergenic
1108735506 13:53279422-53279444 CCAGACACAATGGTGGTACGGGG + Intergenic
1111898014 13:94165487-94165509 TCAGGGGAAATGGTGGGAGGGGG + Intronic
1113614549 13:111671237-111671259 CCAGGCCAAGAGCTGGCAGGAGG + Intronic
1113620017 13:111756151-111756173 CCAGGCCAAGAGCTGGCAGGAGG + Intergenic
1114267651 14:21082128-21082150 CCAGCCCAACTGGTGCTAAGAGG + Intronic
1114522561 14:23348298-23348320 CCAGGCCAGCTGGGGGCAGGGGG + Exonic
1118502193 14:66372073-66372095 CCTGGCCAGGTGGTGATAGGTGG - Intergenic
1119634662 14:76264181-76264203 CCAGGCCAAACAGTGGCAGCAGG + Intergenic
1122866740 14:104609164-104609186 CCAGGACAGATGGTGGGAGAGGG - Intergenic
1122982855 14:105199412-105199434 CCAGGCCAGATGGTGGGGTGAGG - Intergenic
1202871135 14_GL000225v1_random:165416-165438 CCAGGGGAAAGGGTGGGAGGGGG - Intergenic
1125830979 15:42716999-42717021 CTTGGCCAAATCCTGGTAGGAGG - Exonic
1127861108 15:62994882-62994904 CCCGGGCAAATGGTGTTAAGGGG + Intergenic
1127869629 15:63060583-63060605 CCAGACCAAAATGTGGAAGGAGG - Intronic
1128738129 15:70065135-70065157 CCAGGCCACAGGGTGGTAGCCGG - Intronic
1129669042 15:77596996-77597018 CCAGGACAAAAGGAGGTGGGAGG - Intergenic
1130024647 15:80260767-80260789 GCAGGGCAAAGGGTGGGAGGAGG - Intergenic
1131060491 15:89400861-89400883 CTGGGCCAAATGGTGGTTGCTGG + Intergenic
1131713593 15:95083630-95083652 CCAAACCAAATGGTGTTTGGAGG - Intergenic
1133778277 16:8915437-8915459 CGCGGCAAAATGGTGGTATGTGG - Exonic
1136153985 16:28370332-28370354 CTAGGCAAGATGGTGGGAGGAGG - Intergenic
1136209105 16:28744932-28744954 CTAGGCAAGATGGTGGGAGGAGG + Intergenic
1142595679 17:1028781-1028803 CCAGGCCAGATGCTGGCCGGCGG - Intronic
1143538391 17:7555471-7555493 CCAGGCCACACGGTGGCATGTGG + Intronic
1144161230 17:12560915-12560937 TCAGGGGAAATGGTGGGAGGGGG - Intergenic
1144809298 17:17988524-17988546 CAAGGCCTATGGGTGGTAGGAGG + Intronic
1146460248 17:33040534-33040556 CCAGGACAGATGGTGGTAGGTGG + Intronic
1152632901 17:81418514-81418536 CCCGGCCCACTGGTGGTAGAGGG - Intronic
1152779424 17:82219693-82219715 CCAGGCCAAAGGGTGCAAAGAGG + Intergenic
1153626983 18:7030843-7030865 CCACCCCAAATGCTGGCAGGAGG + Intronic
1153963967 18:10164392-10164414 GCAGACCATATGGTGGCAGGTGG + Intergenic
1161419572 19:4169093-4169115 CCAGGACATAGGGTGGTGGGGGG - Intronic
1161426337 19:4205519-4205541 CCTGGGCAAATGGCAGTAGGAGG + Intronic
1161647359 19:5461807-5461829 CAAGCTCAAATGGTGATAGGAGG - Intergenic
1162479369 19:10919767-10919789 CCAGGGCAGATGGTGGGCGGGGG + Intronic
1166359752 19:42248214-42248236 CTGGGCAAAGTGGTGGTAGGGGG - Exonic
1166370238 19:42296215-42296237 CCAGGCCACATGGGGGCAGCAGG - Intergenic
925313673 2:2906161-2906183 CCATGCTAAAAGGTGGTAGAAGG + Intergenic
929407104 2:41655360-41655382 TCAGGGGAAATGGTGGGAGGGGG - Intergenic
931173156 2:59826343-59826365 CCAGGCCACATGCTGGAAGCTGG + Intergenic
931555258 2:63496633-63496655 CTAGGACCAATGGTGGTGGGAGG + Intronic
931721356 2:65069751-65069773 CCAGACCCCATGGTGGCAGGAGG - Exonic
931920087 2:67005760-67005782 CAAGGCCTGAGGGTGGTAGGAGG - Intergenic
931941634 2:67258000-67258022 CCAGGACAAATGCAGGTAGCAGG + Intergenic
932145308 2:69310596-69310618 CCAGTCCAAGTGGTGGCAGGTGG + Intergenic
932731755 2:74226768-74226790 CCAGGCCAGATGGTGTGGGGTGG - Intronic
933415016 2:81976602-81976624 CCATGTCAACAGGTGGTAGGGGG - Intergenic
934662555 2:96150862-96150884 CGAGGCCCAAAGGTGTTAGGGGG + Intergenic
936386250 2:112032274-112032296 CCAGGCCATATGGTCAGAGGTGG + Intergenic
938828615 2:135032050-135032072 CCAGCAGAAATGGTGGTATGAGG - Intronic
939069577 2:137522851-137522873 CCAGCACAAATGGTGGTAACTGG - Intronic
941419303 2:165262366-165262388 TCAGGGGAAATGGTGGGAGGGGG - Intronic
942064052 2:172253611-172253633 ACAACCCAAATGGTGGCAGGAGG + Intergenic
943699748 2:190976832-190976854 CCAGGCCAAAGGAAGGTAAGTGG - Exonic
944328818 2:198440868-198440890 CCAGTCTGATTGGTGGTAGGAGG + Intronic
947983456 2:234428987-234429009 TGAGGCCAAATGGTGGGAGGTGG + Intergenic
1169869740 20:10237899-10237921 TCAGGAGAAATGGTGGTATGGGG - Intronic
1171199376 20:23228720-23228742 CCAGGCTAAGTGCTTGTAGGAGG - Intergenic
1174042389 20:47709170-47709192 CCAGCCCAAATTGTGGCAGGTGG + Intronic
1174611499 20:51801735-51801757 CCGGGCCAAGTGGGGGGAGGGGG - Intronic
1180060364 21:45381914-45381936 CCAGGCCGAAAGGTGGTGGGTGG + Intergenic
1181266992 22:21636172-21636194 CCAGGCCCAACAGTTGTAGGAGG + Intronic
1181415160 22:22754053-22754075 CCAGATCAAATGGGAGTAGGGGG - Intronic
1181938021 22:26452809-26452831 CCACACCAGGTGGTGGTAGGCGG - Exonic
949984878 3:9532851-9532873 CCAGGTGAAAAAGTGGTAGGTGG - Intronic
950063678 3:10093612-10093634 CCAGGCAAAAGGGAGGAAGGAGG + Intronic
951624212 3:24642483-24642505 CAGGGCCAAATGGTGGAAAGTGG - Intergenic
953477560 3:43218653-43218675 CCTGGCCAACTGGGGGTGGGAGG - Intergenic
953621003 3:44532721-44532743 CGAGAGCAAATGGGGGTAGGGGG + Intergenic
954763115 3:52891427-52891449 CCAGGGCCCATGGTAGTAGGTGG - Intronic
956597858 3:70987909-70987931 CCACCCCAAATGGAGGAAGGAGG - Intronic
960582952 3:119295741-119295763 CAAGGTCAGATGGGGGTAGGGGG + Intronic
961628040 3:128277053-128277075 CCAGGCCAGAGGGTGAGAGGGGG - Intronic
961676948 3:128573495-128573517 CCATGTCAAATGGTAGTGGGTGG + Exonic
966229419 3:177634961-177634983 TCAGGGGAAATGGTGGGAGGGGG - Intergenic
966754904 3:183360272-183360294 CCAGGCCAGATTGGGGTAGAAGG + Intronic
966974573 3:185072806-185072828 CCAATCCCAATGGAGGTAGGAGG - Intergenic
966974963 3:185075251-185075273 CCAATCCCAATGGAGGTAGGAGG + Intergenic
968644079 4:1729997-1730019 CCAGGCCATATAGAGATAGGAGG - Intronic
969117570 4:4881210-4881232 CCAGGACAACCAGTGGTAGGAGG - Intergenic
972013237 4:34210874-34210896 CCAGGCCACATGGTCATAGAAGG + Intergenic
975493370 4:75012490-75012512 CTAGTCCAGATGGTGGTCGGTGG - Exonic
977226520 4:94398416-94398438 CCAGGCCAACTAGTGGATGGTGG - Intergenic
978891460 4:113832783-113832805 CCAGGGGTGATGGTGGTAGGGGG + Intergenic
980241087 4:130176620-130176642 CTAGGCCAAATTGAAGTAGGTGG - Intergenic
981012756 4:139942395-139942417 CCAGGCCACATGTTTGTAGCAGG - Intronic
986729369 5:10623848-10623870 CCAGGCCAAGTGGAGGAAGCAGG - Intronic
987098387 5:14570366-14570388 TCAGGCTCCATGGTGGTAGGTGG - Intergenic
988037698 5:25849966-25849988 CCTGGCAAAATGGAGTTAGGTGG + Intergenic
988232056 5:28492025-28492047 CCAGGGCAAAAGGTAGGAGGAGG + Intergenic
997715791 5:136041719-136041741 CCAGGAGAAATGGAGGTTGGGGG - Intronic
998951827 5:147400608-147400630 CCAGCCCAACTGGTGGCAGGAGG + Intronic
999450911 5:151677449-151677471 ACTGACCAAATGGTGGTGGGAGG + Intronic
1002630635 5:180573528-180573550 CCAGGCAGAATGGTGGAGGGGGG + Intronic
1002715690 5:181225267-181225289 CCAAGCCATATCGTGGTAGGTGG - Intronic
1004281247 6:14281373-14281395 CCTGGAGAAATGGGGGTAGGGGG - Intergenic
1005982421 6:30846478-30846500 CCATGCCAGGTGGGGGTAGGTGG + Intergenic
1006386490 6:33733876-33733898 CCAGACCTAATGCCGGTAGGGGG - Intronic
1006475037 6:34247958-34247980 CCAGGTCAAATCCTGGGAGGAGG + Intronic
1006504061 6:34476713-34476735 CCAGGCCAGCTGGTGCAAGGGGG - Intronic
1006979632 6:38136598-38136620 CTAGGCCACAGGGTGGGAGGTGG + Intronic
1007755396 6:44096077-44096099 CCAGGCCAAACTGTGGAGGGAGG - Intergenic
1011156102 6:84334748-84334770 TCAGGGGAAAGGGTGGTAGGGGG - Intergenic
1015197098 6:130536351-130536373 CCAATCCCAATGGTGGTAGAAGG + Intergenic
1015518420 6:134107845-134107867 CCAGGCTGATTGGTTGTAGGAGG - Intergenic
1015780771 6:136863259-136863281 ACAGGCCAAATGGGGGTACTTGG - Intronic
1017966518 6:159271384-159271406 CCAGCCCACATAGTAGTAGGGGG - Exonic
1018952185 6:168386466-168386488 CCAGGCCAAATGTTAGCAGAAGG - Intergenic
1019477160 7:1249575-1249597 CCAGGCCAATGGCTGGTGGGGGG - Intergenic
1023765222 7:43504363-43504385 TGAGGCCAAAGGGTGGTAGTAGG - Intronic
1023908089 7:44536327-44536349 CCAGGCCAAGCTGTGGGAGGAGG - Exonic
1024851982 7:53729569-53729591 GCAGGGCAAATGGTGGGAGGAGG - Intergenic
1024893262 7:54227025-54227047 CCAGCCCTAATGGTGGTGGCAGG - Intergenic
1024900656 7:54315362-54315384 CCAGCCCTAATGGTGGTGGCAGG + Intergenic
1026848405 7:73710274-73710296 CCTGGCCAACTGGCGGTATGAGG - Intronic
1029115183 7:98233095-98233117 ACAGGGCAAAGGGTGGAAGGAGG - Intronic
1029606354 7:101601628-101601650 CCAGGACAATGGGTGGCAGGGGG - Intergenic
1029810617 7:103044066-103044088 CCACACAAAATGTTGGTAGGGGG + Intronic
1030928261 7:115485309-115485331 TGAGGCCACATGGTGGTAAGTGG + Intergenic
1037845527 8:22278645-22278667 CCAGGCCACAGGCTGGTTGGGGG + Intronic
1037859868 8:22397611-22397633 CCAGGCCTCAGGGTGGAAGGAGG - Intronic
1039174882 8:34792627-34792649 CCAGGACAAAGGGGGCTAGGAGG - Intergenic
1043391758 8:79798713-79798735 CCAGGCCATGTGGTGGTCAGGGG - Intergenic
1045762874 8:105631035-105631057 TTAGGTCAAATGCTGGTAGGTGG - Intronic
1048513261 8:135081130-135081152 CAAGGCCAGCTGGTGGGAGGTGG + Intergenic
1049241611 8:141540259-141540281 CCAGGCCACAGGGTGTTAGTGGG - Intergenic
1053386546 9:37695668-37695690 CCAGGCAACAAGGTGGTAGGTGG - Intronic
1055379556 9:75690998-75691020 CAAGGCCAAATGGAAGTTGGAGG + Intergenic
1055711831 9:79071741-79071763 TCAGGGTAAATGGTGGGAGGGGG + Intergenic
1056601539 9:88050809-88050831 TCAGGACACATGGTGGTAGCTGG - Intergenic
1056616628 9:88173235-88173257 CCAGGTCAAAAGCTGGTAAGTGG + Intergenic
1058907293 9:109492161-109492183 CCAGGCCCAATGGTGGCTGGCGG + Intronic
1059299209 9:113298917-113298939 CCAGGACAAAGGGAGGGAGGAGG - Exonic
1059749500 9:117234643-117234665 CCAGTCTAAATGGAGGTTGGGGG + Intronic
1060237491 9:121875926-121875948 CCAGGCAAAATAGAGATAGGTGG - Intronic
1060367597 9:123034240-123034262 TCAGGCCAAGTGAGGGTAGGGGG - Intronic
1062353000 9:136148328-136148350 CCAGGCCACACGGTGGCAGATGG + Intergenic
1203733320 Un_GL000216v2:111171-111193 CCAGGGGAAAGGGTGGGAGGGGG + Intergenic
1187242466 X:17526261-17526283 CCAGGCCAGGTGGTTGTAGCTGG + Intronic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1192214913 X:69151276-69151298 CCAATCCAAATGGTGATATGAGG - Intergenic
1192548849 X:72037604-72037626 CCAGGACTGATGCTGGTAGGTGG + Intergenic
1193753620 X:85379188-85379210 CCAAACCAAATTTTGGTAGGAGG + Exonic
1195994062 X:110713650-110713672 CAAGGACAAATGGTAGTAAGTGG - Intronic
1196406445 X:115367477-115367499 TCTCGTCAAATGGTGGTAGGAGG - Intergenic
1199520091 X:148725351-148725373 CCAGACCAAATCCTGGTAAGAGG - Intronic
1202627690 Y:56877254-56877276 CCAGGGGAAAGGGTGGGAGGGGG - Intergenic