ID: 1089352319

View in Genome Browser
Species Human (GRCh38)
Location 11:117828615-117828637
Sequence TGTCGTGGCACCTGAGGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089352312_1089352319 11 Left 1089352312 11:117828581-117828603 CCTCTCAGAGGGGTGGGAATGGT 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1089352319 11:117828615-117828637 TGTCGTGGCACCTGAGGCACCGG 0: 1
1: 0
2: 1
3: 4
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089352319 Original CRISPR TGTCGTGGCACCTGAGGCAC CGG Intronic
900170061 1:1262888-1262910 TGTGGTGGCACCTGGGGCTTCGG - Intronic
900340473 1:2186412-2186434 TGTCCTGGCACCTGGGGCTTGGG - Intronic
900432054 1:2607105-2607127 TGTCGTGGCACGTGAGCCACAGG - Intronic
900970349 1:5989196-5989218 TGTGGTGGCTCCTGGGGCTCTGG - Intronic
911189901 1:94937754-94937776 TGTGTTGGAACCTGAGGCACTGG - Intergenic
917605926 1:176629440-176629462 TGTCTTGGTATCTGAGGCTCTGG - Intronic
919804027 1:201370031-201370053 TGATGAGGCACCTGAGGCTCAGG - Intronic
923593056 1:235337705-235337727 TGTAGTCCCAGCTGAGGCACGGG + Intronic
1067288320 10:44923642-44923664 TGTGGTGGCACCTGAGTGAGGGG + Intronic
1067872540 10:49975251-49975273 TGTGGTGGAAGCAGAGGCACAGG - Intergenic
1069551142 10:69365288-69365310 AGCCCTGGCACCTGAGGGACAGG - Intronic
1069712709 10:70500265-70500287 TGTGGAGGCACCTGAGCAACAGG - Intronic
1070137926 10:73711070-73711092 TGTGGTGGAAGCAGAGGCACAGG + Intergenic
1071097853 10:81999842-81999864 TGTAGTGGGAGCTGAGACACAGG + Intronic
1072626015 10:97112443-97112465 GGTCCTGGGACCTGAGGCCCAGG - Intronic
1074115582 10:110455512-110455534 TGTCTTGGCACCTGGGTAACCGG + Intergenic
1076457323 10:130609386-130609408 TTTGGTGGCACCTGAGGCTGGGG - Intergenic
1076511317 10:131015705-131015727 TGGAGGGGCAGCTGAGGCACTGG + Intergenic
1076721018 10:132393276-132393298 TGTCGTGTCGTCTGAGGCAGGGG - Intergenic
1076763208 10:132615951-132615973 GGGCCTGGCACCTGAGGCCCTGG + Intronic
1078739845 11:14056131-14056153 GGGGGAGGCACCTGAGGCACTGG - Intronic
1078883643 11:15478381-15478403 TGTTGTGACACCTGAGGGCCTGG + Intergenic
1078926237 11:15878001-15878023 TGTCTTGCCAGCAGAGGCACTGG - Intergenic
1080760866 11:35247677-35247699 TGGCCTGCCACCTAAGGCACTGG - Intergenic
1083741281 11:64712871-64712893 TGTGTGGGCTCCTGAGGCACGGG - Intronic
1085013418 11:73157147-73157169 TGTAGTGGCAGCTGGGGCAATGG - Intergenic
1089352319 11:117828615-117828637 TGTCGTGGCACCTGAGGCACCGG + Intronic
1089370317 11:117950865-117950887 TGTGGTGGCACCTGGGGAACAGG + Intergenic
1090597373 11:128334564-128334586 TGTTGTGGCTACTGAGTCACCGG + Intergenic
1091253032 11:134159891-134159913 TGAGGTGGCACCTGTGGCACAGG - Exonic
1091485199 12:879903-879925 TGACTTGGCAGCTGAGTCACAGG - Exonic
1091591845 12:1847021-1847043 TGTCCTGGGACCTAAGGAACAGG + Intronic
1098497911 12:71157979-71158001 TGTCATAGCTCCTGGGGCACTGG + Intronic
1100405916 12:94272790-94272812 TTGGGTGGCACCGGAGGCACAGG + Intronic
1104013139 12:124946364-124946386 TGCCCTGGCGCCTGAGACACTGG + Intergenic
1104757951 12:131280603-131280625 TTTCCAGGTACCTGAGGCACGGG - Intergenic
1104776384 12:131392465-131392487 TGCCCTGGCACCTGAGACAGCGG - Intergenic
1105419594 13:20240398-20240420 TGTCTTGGCACCTGCTGCCCTGG - Intergenic
1113308374 13:109103861-109103883 TGTAGTCGCACATGAGGTACTGG + Intronic
1122038342 14:98964533-98964555 TGGCATGGAAACTGAGGCACAGG - Intergenic
1122203959 14:100139057-100139079 AGTCATGGAACTTGAGGCACAGG + Intronic
1122633824 14:103121166-103121188 TGTCGTAGCCTCTGAGGCCCTGG + Intergenic
1123034661 14:105466978-105467000 TGTCCTGGCACGTGTGGCCCTGG + Intronic
1202902897 14_GL000194v1_random:53425-53447 TGTCCTGTCCTCTGAGGCACAGG + Intergenic
1127260106 15:57321126-57321148 TGCCAGGGCACCTGAGCCACTGG - Intergenic
1127518216 15:59716756-59716778 TGTCCTGGCAGCTAAGGCATTGG + Intergenic
1127715108 15:61642420-61642442 TGTTTTGGCATCTGAGCCACGGG - Intergenic
1129275290 15:74441512-74441534 TTTCGTGGCAACCCAGGCACTGG - Intergenic
1129607603 15:77032457-77032479 GGTCCTGGCACTTGAGGCTCAGG - Intronic
1130313086 15:82771712-82771734 TGTCCTGGCATCTGAGGGTCAGG - Intronic
1132560952 16:593671-593693 AGTACTGGCACCTGAGGCAGTGG + Intronic
1141837047 16:86548101-86548123 TCTGGTGGCACCTGATGAACAGG + Intronic
1142300898 16:89257293-89257315 TCTCGCGGCGCCTGAGGCCCCGG + Intergenic
1143725733 17:8844128-8844150 TGCTGTGGCATCAGAGGCACAGG - Intronic
1144744277 17:17603258-17603280 TGACATGGCACCACAGGCACCGG - Intergenic
1144952379 17:19001202-19001224 TGTCCTGGGACCTGTGGCCCAGG - Intronic
1148236304 17:45971563-45971585 AGTGGTGCCACCTGAGGCAAAGG - Intronic
1156760651 18:40584555-40584577 TATCATGACTCCTGAGGCACTGG + Intergenic
1158946474 18:62451229-62451251 GGTCGTGACAGCTGAGTCACAGG + Intergenic
1159950751 18:74481141-74481163 TGTGGTAACACATGAGGCACAGG + Intergenic
1160586094 18:79914503-79914525 TGCCGTGGCCCCGGAGGAACAGG + Intronic
1161276593 19:3421591-3421613 TGACGAGGAAACTGAGGCACCGG + Intronic
1161841017 19:6680319-6680341 TGTCTTGGGAGCTGAGGCAGTGG + Intronic
1167419205 19:49393408-49393430 AGTGGTGGCACCTGGGGCAATGG - Intronic
1168672098 19:58248356-58248378 TGCTGTGGCACCTGAGGCTGGGG - Intronic
925399137 2:3558953-3558975 GGTCGTGGTGCTTGAGGCACTGG - Intergenic
925948901 2:8893040-8893062 TGTGGGGGCACCAGAGGCAGGGG + Intronic
926239585 2:11074711-11074733 TGTTGTCCCACCTGAGGCAAGGG - Intergenic
927575792 2:24201030-24201052 TTGTGTGGCACCTGAGGGACTGG - Intergenic
928905612 2:36364229-36364251 GGTCCTGGCACCTGTGACACTGG - Intronic
931441452 2:62293439-62293461 AGTAGAGGCACCTGGGGCACAGG + Intergenic
932538055 2:72620209-72620231 TGTTGTGGCTCCTGGGTCACTGG - Intronic
947630376 2:231648816-231648838 TGCCAGGCCACCTGAGGCACAGG + Intergenic
948583467 2:239003725-239003747 TGTGGGGGCAACTGAGGCAGGGG + Intergenic
948816653 2:240513691-240513713 GGACATGGCACCTGAGGCAGAGG + Intronic
948995048 2:241573793-241573815 TGTGGGGGCACCTGAGGGGCTGG - Exonic
1168808067 20:684545-684567 AGTTGTGGAACCTGAGGCATGGG + Intergenic
1172200770 20:33124609-33124631 TTTCGTGGAAACTGAGGCCCAGG + Intergenic
1172373362 20:34414961-34414983 TGTGGTGGCACCTGAGTTAGTGG + Intronic
1175958506 20:62623385-62623407 TGTGCTGGCACGTGTGGCACAGG + Intergenic
1176622261 21:9068192-9068214 TGTCCTGTCCTCTGAGGCACAGG + Intergenic
1179132169 21:38647678-38647700 TTCTGTGTCACCTGAGGCACTGG - Intronic
1179289758 21:40008156-40008178 TGTGGTGGCACCAGGGGCAAGGG - Intergenic
1181164730 22:20977183-20977205 TGTGGTGGAAACTGAGGCTCTGG - Intronic
1183072561 22:35406639-35406661 TGTTGCGGCAGCTGCGGCACTGG - Exonic
954373906 3:50184360-50184382 GGTCATGGCACCTGAGGCCAGGG + Intronic
962238717 3:133732045-133732067 TGTAGTGGGACCTGAGGGGCTGG + Intergenic
966756875 3:183379259-183379281 TGTCCTGCCGCCTTAGGCACTGG - Intronic
966846556 3:184135158-184135180 TGTCCCGGCCCCTGAGGCGCAGG - Intronic
967680453 3:192356225-192356247 TGTCCTGGCACTTGAGGCAAAGG - Intronic
968623214 4:1613891-1613913 TTGCGTGGGACCTGAGGTACAGG - Intergenic
981068094 4:140506681-140506703 TGTCCTTACACCTGAGCCACAGG + Intergenic
985731977 5:1554329-1554351 TGTGGGGGCACCTGGGGCCCAGG + Intergenic
987583019 5:19820414-19820436 TGTTGTGGCACCTATGGCCCAGG - Intronic
988969521 5:36452458-36452480 TGTCATGGGAACTGAGGCTCTGG - Intergenic
993289289 5:86043925-86043947 AGTCGTGGCACTTGGGACACAGG - Intergenic
998001758 5:138631165-138631187 TGGAGTGGCATCTGGGGCACAGG + Intronic
1001283374 5:170404409-170404431 TGTAGTGGCACCAGATGCTCAGG + Intronic
1001809680 5:174618273-174618295 TCTCCTCGCACCTGAGCCACAGG - Intergenic
1001884856 5:175280262-175280284 TGTCTTGGCCGCTGAGGCAGTGG + Intergenic
1002160272 5:177310765-177310787 TGTAGTGGCTCTTGAGCCACTGG - Intronic
1003573044 6:7268542-7268564 TCTGGAGGGACCTGAGGCACGGG - Intronic
1004328137 6:14695820-14695842 AGTCGTGGCAGCTGCAGCACAGG - Intergenic
1017801123 6:157897406-157897428 TGTAGGGGCACCTGGGGCAGGGG - Intronic
1019552483 7:1610090-1610112 CGCTGTGGCACCTGAGACACAGG - Intergenic
1020309905 7:6859628-6859650 TGTTGCAGGACCTGAGGCACAGG + Intergenic
1022219050 7:28294034-28294056 TGGAATGGCACCTGAGGGACTGG - Intergenic
1023932142 7:44712517-44712539 GGTCCTGGCCCCTGGGGCACTGG + Intergenic
1023978999 7:45055151-45055173 TGTCGTGTCACCCCAGCCACAGG + Intronic
1024145476 7:46512232-46512254 TGTCCTGGCACTGGAGCCACAGG - Intergenic
1027269002 7:76510260-76510282 GCTCCTGGCACCTGGGGCACAGG + Intergenic
1028696740 7:93722615-93722637 TGTAGTTGCAGCTGAGGCAGAGG - Intronic
1037804454 8:22051217-22051239 TGGCGTGAGACTTGAGGCACTGG - Intronic
1049709443 8:144057057-144057079 TGACGTGGTGCATGAGGCACAGG - Exonic
1051740100 9:20242984-20243006 GGTCTTGGCACCTTATGCACGGG - Intergenic
1056589102 9:87951370-87951392 TGGTGTGGCACCTGTGGCCCAGG + Intergenic
1057844771 9:98514961-98514983 TGGCGTGGCACCTGGGCCTCAGG + Intronic
1061037757 9:128122878-128122900 GCTCGTGGCACCGGAGGCTCGGG + Intronic
1061071995 9:128316591-128316613 TGTCTTGCTTCCTGAGGCACAGG - Intronic
1062041739 9:134407571-134407593 TGTCGTGCCACCCGATGCCCGGG + Intronic
1062486221 9:136777629-136777651 GGTCGTGGAGCCTGAGGCCCAGG - Intergenic
1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG + Intronic
1187532872 X:20112526-20112548 CGTCTTGGCATCTGAGGCTCTGG - Intronic
1193733207 X:85126418-85126440 TGGTGAGGAACCTGAGGCACAGG + Intergenic
1193799220 X:85914729-85914751 TGCTGTGGCAGCTGGGGCACAGG - Intronic
1194101043 X:89704326-89704348 GGTCTTGGCAGCTGAGGCAAAGG - Intergenic
1200227780 X:154428659-154428681 TGTCGAGGCCGCTGAGGCAGTGG + Exonic
1200453997 Y:3365410-3365432 GGTCTTGGCAGCTGAGGCAAAGG - Intergenic
1201158783 Y:11153633-11153655 TGTCCTGTCCTCTGAGGCACAGG + Intergenic