ID: 1089352450

View in Genome Browser
Species Human (GRCh38)
Location 11:117829182-117829204
Sequence ACTGAGAAGCAGAGTTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 405}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089352440_1089352450 7 Left 1089352440 11:117829152-117829174 CCGCCCTGGCACGGCCACCCCAA 0: 1
1: 0
2: 2
3: 21
4: 314
Right 1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG 0: 1
1: 0
2: 1
3: 38
4: 405
1089352439_1089352450 14 Left 1089352439 11:117829145-117829167 CCTGTAGCCGCCCTGGCACGGCC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG 0: 1
1: 0
2: 1
3: 38
4: 405
1089352445_1089352450 -10 Left 1089352445 11:117829169-117829191 CCCCAACGTGGACACTGAGAAGC 0: 1
1: 0
2: 0
3: 14
4: 109
Right 1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG 0: 1
1: 0
2: 1
3: 38
4: 405
1089352442_1089352450 3 Left 1089352442 11:117829156-117829178 CCTGGCACGGCCACCCCAACGTG 0: 1
1: 0
2: 0
3: 6
4: 218
Right 1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG 0: 1
1: 0
2: 1
3: 38
4: 405
1089352441_1089352450 4 Left 1089352441 11:117829155-117829177 CCCTGGCACGGCCACCCCAACGT 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG 0: 1
1: 0
2: 1
3: 38
4: 405
1089352444_1089352450 -7 Left 1089352444 11:117829166-117829188 CCACCCCAACGTGGACACTGAGA 0: 1
1: 0
2: 1
3: 11
4: 99
Right 1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG 0: 1
1: 0
2: 1
3: 38
4: 405
1089352436_1089352450 24 Left 1089352436 11:117829135-117829157 CCGTCAGGTTCCTGTAGCCGCCC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG 0: 1
1: 0
2: 1
3: 38
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089352450 Original CRISPR ACTGAGAAGCAGAGTTAGGA GGG Intronic
900007579 1:73168-73190 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
900822402 1:4899665-4899687 CCTGGGAGGCAGAGTGAGGAGGG - Intergenic
900834250 1:4988026-4988048 CCTGACAATCAGGGTTAGGAGGG - Intergenic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
902196358 1:14801477-14801499 ACTGAGAGGGTGATTTAGGATGG + Intronic
903292569 1:22324083-22324105 ACTGGGAAGCACAGTGAGTATGG - Intergenic
903548645 1:24142658-24142680 AGTGAGAGGCAGAGGAAGGATGG + Intronic
905093789 1:35451346-35451368 ACTGAGAAATAAAGTAAGGAGGG + Intronic
905289159 1:36909749-36909771 ACTGAGAGCCAGAGTTGGGGAGG + Intronic
905656023 1:39686619-39686641 GCTGAGAAGCAGGTTTGGGAAGG + Intronic
905976722 1:42180828-42180850 ACAGGGAAGCTGAGGTAGGAGGG + Intronic
906468622 1:46107628-46107650 ACTGTGAAGGATAGGTAGGATGG - Intronic
906977009 1:50586608-50586630 CGTGAGAAGTAGAGTTAAGATGG - Intronic
907014927 1:51003384-51003406 AGTGAGTAGCAGAGGTAGGTGGG + Intergenic
907626384 1:56034453-56034475 TCTGAGAACCAGAAATAGGAAGG + Intergenic
907827393 1:58032049-58032071 TTTGAGAAGCAGAGTTTAGAAGG - Intronic
908316623 1:62939291-62939313 ACAGAGAAACAGAGATAGTAAGG - Intergenic
910262674 1:85307208-85307230 ACTGAGAGGCTGAGTAAGGATGG + Intergenic
910655009 1:89610219-89610241 ACTGACAAGCACAGTGGGGAGGG - Intergenic
911592056 1:99759536-99759558 GCTGAGTAGCAGAGTTAGGTAGG + Intronic
912448045 1:109752193-109752215 CCTAAGAAACAGAGTCAGGATGG + Exonic
912451974 1:109772955-109772977 ACTGAGGGGCAGAGTTGGGGAGG - Intronic
913090528 1:115473750-115473772 AGAGAGAAGCAGGGTAAGGAAGG + Intergenic
913319701 1:117579531-117579553 CCTCAGAGGCAGAGTAAGGAAGG - Intergenic
913331679 1:117672812-117672834 TCTGAGAAGCAGGGCTGGGATGG + Intergenic
916077550 1:161210782-161210804 ACTGAGAAGTAGGGTAAAGAAGG - Intronic
916456813 1:164979605-164979627 ACAGAGGAGCTTAGTTAGGATGG - Intergenic
916581257 1:166111285-166111307 ACTGATAGGCAGGGATAGGAAGG + Intronic
916953675 1:169809169-169809191 AATGAGGAGTAGTGTTAGGAAGG + Intronic
918191663 1:182181431-182181453 GCTGAGCAGCAGAGTGAGCATGG - Intergenic
918385744 1:184005635-184005657 ACGGAGAGGCAGAGTGTGGATGG - Intronic
918430180 1:184451396-184451418 CCTGAGAACCTGAGGTAGGAGGG - Intronic
918632920 1:186740269-186740291 ACTGAGAAAGAGAGTATGGATGG - Intergenic
920311592 1:205051999-205052021 ACTGAGATCCAGAGATGGGACGG + Intronic
920339474 1:205267049-205267071 TCTGAGAAGCAGAGTCCTGAAGG + Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
922013807 1:221622038-221622060 CCTGAAAAGCAGATTTAAGAAGG + Intergenic
922020702 1:221701247-221701269 ACTGTGAAACAGAGTTAGCAAGG - Intergenic
922464983 1:225840314-225840336 ACTGAGAAGCAGAGGGATGGAGG + Intronic
923065199 1:230510986-230511008 GCTGTCAATCAGAGTTAGGAAGG + Intergenic
923653622 1:235896872-235896894 ACTGAGCTTCAGAGTTGGGATGG - Intergenic
923743804 1:236682349-236682371 ACTGAGTAGAATACTTAGGAAGG - Intergenic
923760979 1:236843823-236843845 ACTGAGAAGCAGGTTTGGGATGG + Intronic
923763026 1:236864451-236864473 ACAGAGAAGCAGTGTCAGGAAGG + Intronic
924931268 1:248734254-248734276 TCTGAGAACAAGAGTGAGGAGGG - Intronic
1063570423 10:7210401-7210423 ACTGGGCAGCAGAGGCAGGAGGG + Intronic
1065770706 10:29075436-29075458 ACTGAGAAACAGTCTTGGGAAGG + Intergenic
1066935060 10:41818655-41818677 ACAAAGAAGCAGAGTCAAGATGG - Intergenic
1067233063 10:44425527-44425549 AATGAGAAACAGAGATAGGCTGG + Intergenic
1067674402 10:48358708-48358730 ACTTAGAAGAAAAGATAGGAGGG - Intronic
1067741090 10:48896687-48896709 AATGCAAACCAGAGTTAGGAGGG - Intronic
1068756526 10:60660758-60660780 ACAGAGAAGTAGGGATAGGATGG + Intronic
1069093762 10:64232989-64233011 ACTGGGAAGGATAGTTGGGAGGG + Intergenic
1069780197 10:70950544-70950566 CCTGAGACCCAGAGTTGGGAAGG - Intergenic
1070310869 10:75272959-75272981 ACTGGGCATCAGAGTGAGGATGG + Intergenic
1070528455 10:77315488-77315510 AGTCAGAAGCAAAGTTAGAATGG + Intronic
1070778797 10:79125813-79125835 ACTGAGGCCCAGAGATAGGAGGG + Intronic
1070815740 10:79321949-79321971 TGAGAGAAGCAGAGTAAGGAGGG - Intergenic
1072252753 10:93594581-93594603 ATTAATAAGCAGAATTAGGATGG - Intronic
1072631150 10:97147520-97147542 ACTGAGAAGCTGTGATGGGAAGG + Intronic
1073075417 10:100823047-100823069 GCTTAGAAGCTGAGCTAGGAAGG + Intronic
1073518381 10:104100408-104100430 ACTTGGCAGCATAGTTAGGATGG + Intergenic
1074123044 10:110507486-110507508 ACGTAGAAGCACAGTTAGGGAGG - Intronic
1074490792 10:113937992-113938014 ACTGAGCAGAAAAGATAGGAGGG - Intergenic
1075721608 10:124590765-124590787 ACAGAGAAGCAGGCTCAGGAAGG - Intronic
1076390943 10:130101420-130101442 ACTGAGGAGCAGAGAGAGGGTGG + Intergenic
1076482898 10:130796486-130796508 ACTAAGGAGCAGAGTTGGGGTGG - Intergenic
1076749406 10:132535072-132535094 AGAGAGAAGCAGAGTAAGGCAGG + Intergenic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1079390721 11:20019687-20019709 ATTGAGAAGCGCAGTTAGGGAGG + Intronic
1080357958 11:31473379-31473401 ACTGAGGAGCAGAGAGATGAAGG + Intronic
1080430416 11:32193376-32193398 ACTGAGAAGCAGATTTTGGGGGG + Intergenic
1081152772 11:39652372-39652394 ACTGACGAGAAGAGTGAGGAAGG + Intergenic
1083621902 11:64053435-64053457 ACTGAGGTGCAGGGTTAGGCTGG + Intronic
1084979911 11:72823522-72823544 ACTGAGAAGAGGTGTTAGGCTGG - Intronic
1087512550 11:99115827-99115849 AGTGAGAAGCAAAGAAAGGAAGG + Intronic
1087583359 11:100088231-100088253 TCTGAAAAGCAGTGTTAAGAGGG + Intronic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1088782737 11:113151858-113151880 GCTGAGAAGCTGACTTGGGAAGG + Intronic
1088838648 11:113603410-113603432 AGTCAGAAGCAGAGATTGGAGGG + Intergenic
1089220500 11:116867110-116867132 ACTGAAAAGCAGCCTTGGGAAGG - Intronic
1089226089 11:116923569-116923591 ACTGAGAAACTGAGTAACGATGG + Intronic
1089275476 11:117332784-117332806 TCTGTGAGCCAGAGTTAGGAGGG - Intronic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1089959697 11:122604881-122604903 AGTGAGCAGCAGAGTGAGTAGGG + Intergenic
1090239064 11:125169329-125169351 ACTGAGAAGCAGAATTTAGAGGG + Intronic
1093369236 12:18346775-18346797 ACTGTGAAGCTGAGGTGGGAAGG - Exonic
1093791398 12:23254642-23254664 GATGAGAAGCAGAGTTTTGAAGG + Intergenic
1094128485 12:27049573-27049595 ACTGAGACACAGAGTGATGATGG - Intronic
1094433907 12:30399775-30399797 GGTGACAAGCAGAGTTGGGAGGG - Intergenic
1094701819 12:32877816-32877838 ACTGAACTGCAGAGTCAGGAGGG + Intronic
1095804039 12:46298566-46298588 ACAGAGAAGCATAGTTTAGATGG - Intergenic
1096045857 12:48561545-48561567 TCTGAGAAGCATGGTAAGGAAGG - Intergenic
1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG + Intergenic
1099051257 12:77783983-77784005 AGGGAGAAGCAGAGTCATGATGG - Intergenic
1099127850 12:78788346-78788368 ACTGAAAAGTAGAGTATGGATGG + Intergenic
1099509075 12:83511255-83511277 TCTCAGAAGAAGAGTTTGGAGGG - Intergenic
1099936950 12:89137700-89137722 ACTGAGAAGAAAAGGTGGGAGGG + Intergenic
1099983127 12:89629827-89629849 ACTTAGAAGCAGGGTGGGGAGGG + Intronic
1101726477 12:107392443-107392465 AATGAGAAGCAGAGGCAGGGAGG - Intronic
1101763318 12:107676959-107676981 CATGAGAAGCAGAGGAAGGATGG - Intergenic
1102095913 12:110241252-110241274 AGGGAGAAGCAGACTTAGGTAGG + Intergenic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102951779 12:117036073-117036095 ACTGAGAAGCAGAGTTCCAGAGG + Intergenic
1104428372 12:128696364-128696386 AAGGAGAATCAGAGGTAGGATGG - Intronic
1104720775 12:131043940-131043962 TCTGAGGAGCAGAGTTGGGAGGG + Intronic
1104948256 12:132427133-132427155 ACTGAGAAGCTGATGTTGGAAGG + Intergenic
1105973879 13:25455955-25455977 GCAGGGAAGCAGAGCTAGGAAGG + Intronic
1106619164 13:31357019-31357041 ACTGAGAGGAAGAGGTATGAGGG - Intergenic
1106747980 13:32724222-32724244 ACTGAGAGGCTGAGGTGGGATGG - Intronic
1107606719 13:42064580-42064602 ACTGAGCAGCTGAGGTAGGAAGG + Intronic
1108125161 13:47234557-47234579 ACTGAGAAGCAGATATTTGAGGG + Intergenic
1109504995 13:63288088-63288110 ACTTAGAGGCTGAGTTGGGAGGG + Intergenic
1110334398 13:74310281-74310303 ACTCAGAAACAGAGCAAGGAAGG + Intergenic
1110561561 13:76915425-76915447 ACTGAGAAGCACAGTTAGAGAGG + Intergenic
1110633324 13:77735832-77735854 CCTGAGAAGAAGAGTTAGATGGG - Intronic
1112171353 13:96976078-96976100 ACTAAGAAGCTGAGTTGGTAAGG + Intergenic
1112404142 13:99103262-99103284 AAAGGGAAGCTGAGTTAGGAAGG - Intergenic
1113958170 13:114110538-114110560 CCTGAGAAGCCGTGTAAGGAAGG - Intronic
1114142253 14:19926713-19926735 ACTGAAGACCAGAGTTAGTACGG - Intergenic
1114286532 14:21249508-21249530 ACCGGGAAGCAGAGATAGCAGGG + Intronic
1115255453 14:31396296-31396318 ACTGAGAGGCTGAGGTGGGAGGG + Intronic
1115765455 14:36618388-36618410 ACAGAGAAGCAGACTTTGAAAGG - Intergenic
1115794368 14:36916871-36916893 ACAGAGGAGCAGATTTAGGGTGG - Intronic
1116779286 14:49218412-49218434 ACTGAGAAGGAGAATAAGGCAGG - Intergenic
1116949713 14:50868055-50868077 GAAGAGAAGCAGAGCTAGGAAGG + Intronic
1117092388 14:52264263-52264285 ATTTAGAAGCATAGTTAGAATGG + Intergenic
1117198798 14:53366776-53366798 ACTGAGACGCTGACTTTGGAGGG + Intergenic
1117232370 14:53733915-53733937 TCAAAGAAGCAGAGTTAGAATGG + Intergenic
1117502411 14:56366513-56366535 TCTCAGAAGGAGAGTAAGGAAGG - Intergenic
1117564704 14:56981281-56981303 AATGTGAAGCAGAGATAGGATGG - Intergenic
1117661564 14:58011201-58011223 ACTGAGAAGCAGAAATAGTAAGG + Intronic
1117694401 14:58344476-58344498 ACTGAAAAGTAGAGTTAGAGTGG + Intronic
1119343274 14:73899601-73899623 AATGAGAAGCAGCGTAGGGAGGG + Intronic
1119717851 14:76871359-76871381 ACTGAGGAGAAGAGTGAGAAGGG + Intergenic
1119819481 14:77602321-77602343 ACTGAGAGGGAGGGTTAGGATGG - Intronic
1120072520 14:80120057-80120079 AAAGAGAAGCAGAGTCAGGTGGG - Intergenic
1121031607 14:90663195-90663217 ACTGAGATGCAGAGTTGTTAAGG + Intronic
1121108912 14:91298883-91298905 AGTGAATAGCAGAGTCAGGATGG - Intronic
1121704204 14:95979050-95979072 AGTGAGAGGCTGAGCTAGGAGGG + Intergenic
1121822132 14:96979512-96979534 ACTGAGAACCAGAGAGACGAAGG + Intergenic
1121919087 14:97863930-97863952 ACTGAGGAGGAGAATCAGGATGG + Intergenic
1122284916 14:100645177-100645199 ACTGTGAAGCAAAGTTAAAAGGG - Intergenic
1122874494 14:104657414-104657436 AGGGAGAGGCAGGGTTAGGAGGG - Intergenic
1123080984 14:105694948-105694970 ACAGAGAAAGAGAGTTAGAAAGG + Intergenic
1125257759 15:37785643-37785665 GCTGGGAAGAAGAGTTATGAAGG - Intergenic
1125437828 15:39666991-39667013 GCTGAGAAGCAGATTTAGGGTGG - Intronic
1125523578 15:40361688-40361710 ACTGAGAAGAGGAACTAGGAAGG - Intronic
1126450841 15:48807127-48807149 TCTGAGAAGCAGAGGCTGGAGGG - Intronic
1126903799 15:53342956-53342978 CCAGGGAAGCAGAATTAGGAAGG + Intergenic
1128686175 15:69687342-69687364 AGGGAGAAGGAAAGTTAGGAAGG + Intergenic
1129027397 15:72590267-72590289 ACTGAGAAGCAGATACAGCATGG - Exonic
1129603386 15:77013011-77013033 ACTGAAAACCTGAGGTAGGAAGG - Intronic
1129824928 15:78628668-78628690 CCTGGGAAGCACAGTGAGGAAGG - Intronic
1130007536 15:80114544-80114566 AATGAGAACCACAGTTGGGATGG + Intronic
1130801789 15:87272377-87272399 ACTGATAAGCAGGGTTATAAGGG - Intergenic
1130995802 15:88903328-88903350 ACTGAGAGCCAGAGAGAGGAAGG - Intronic
1131548970 15:93339977-93339999 CGTGAGGAGCAGAGTTAAGAGGG - Intergenic
1132416606 15:101624784-101624806 ACTGAGAGGCAGAGAAAAGAAGG + Intronic
1132445971 15:101918944-101918966 ACAGAGTAGCAGAGGGAGGATGG + Intergenic
1133469258 16:6058341-6058363 TCTGAGAAGGAGAGGGAGGAAGG - Intronic
1135388616 16:22069012-22069034 AGTGAGAAGCAGAGGTAGCCTGG - Intronic
1135529388 16:23239665-23239687 CTTGAGAAGCTGAGGTAGGAGGG - Intergenic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1137375931 16:47951823-47951845 AGTTAGTAGCAGAGTTAGGCTGG - Intergenic
1137378996 16:47980586-47980608 AGAGAGGAGCAGAGTTAGGAAGG - Intergenic
1138072878 16:54010450-54010472 ACTAATATGAAGAGTTAGGATGG - Intronic
1138969739 16:62130336-62130358 GCTGAGAATCAGAGTGTGGACGG + Intergenic
1139079602 16:63499907-63499929 ACAGAGAAGCAGAGATAGTCAGG - Intergenic
1139837265 16:69849203-69849225 ATTGGGAAGCAGAGCTAGCAGGG + Intronic
1140915170 16:79486956-79486978 TCTGGGCAGCAGATTTAGGATGG - Intergenic
1141662302 16:85448007-85448029 AGGGAGAAGCAGAGCTGGGAAGG + Intergenic
1143173624 17:4944358-4944380 AAAGAGAAGCAGAGGTAAGAAGG - Intronic
1143613837 17:8037957-8037979 AGTGAGAAGCAGAGGTGGGAAGG - Intergenic
1144672914 17:17143057-17143079 ACTGAAAGAAAGAGTTAGGAAGG - Intronic
1146031536 17:29370534-29370556 ACTGAAGGGCAGAGTTATGAGGG - Intergenic
1146041593 17:29459821-29459843 ACTATGAAGAAGAGTTTGGATGG - Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146717792 17:35100891-35100913 ACTGGGAAGAAAAGTTGGGAGGG + Exonic
1147155938 17:38544538-38544560 ACAGAGAATCAGAGACAGGAAGG + Intronic
1147740679 17:42669628-42669650 ACAGAGAGGCAGAGTCAGGGTGG + Intronic
1148734266 17:49855915-49855937 ACCGAGAAGGAGAATTAGAAGGG + Intergenic
1148760867 17:49999254-49999276 ACGGAGCATCAGAGTTTGGATGG - Intergenic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1151514339 17:74582503-74582525 TCTGAGGAGCAGACTAAGGAGGG + Intronic
1151973844 17:77473013-77473035 AGTGAAAAGCAGAGTTGAGATGG + Intronic
1152440817 17:80308444-80308466 ACTCAGAAGGAGGCTTAGGAGGG - Intronic
1152911235 17:83005933-83005955 CCTGAGATCCAGAGGTAGGAGGG + Intronic
1155252837 18:23968060-23968082 ACTGAGGAGCAGAGTTGTGTGGG + Intergenic
1155492175 18:26410202-26410224 CCTGAGAGGCTGAGTCAGGAGGG - Intergenic
1156241383 18:35257894-35257916 AGAGAGAAGCAGGATTAGGAAGG - Intronic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156700428 18:39818381-39818403 GTTGAGAAGCAGATTTTGGAGGG + Intergenic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1158069334 18:53452218-53452240 TCTCTGAAGCAGAGTTAAGAGGG + Intronic
1159447620 18:68559691-68559713 CCTGAGAAGCAGAGTAGGCAGGG - Intergenic
1159946873 18:74450547-74450569 TGTGAAAAGCAGAGTGAGGAGGG + Intronic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160451395 18:78968740-78968762 ACTGGGAAGCAGGCTCAGGAGGG - Intergenic
1160454255 18:78987485-78987507 ACTGAGAAACACAGACAGGAAGG + Intronic
1160521128 18:79508758-79508780 ACAGAGAAACAGAGCGAGGAAGG - Intronic
1160639336 19:114763-114785 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1162018446 19:7857917-7857939 ACTGAGAGCCAGAGTGGGGAAGG + Intronic
1162099272 19:8330042-8330064 CCAGAGAGGCAGAGTGAGGAGGG + Intronic
1162279834 19:9686918-9686940 ACTCAGGAGCTGAGATAGGAGGG - Intergenic
1162933474 19:13968766-13968788 TCGCAGAAGCAGAGGTAGGAAGG - Exonic
1163538627 19:17893433-17893455 GCAGAGAAGCAGAGAAAGGAGGG + Intronic
1164769107 19:30794741-30794763 AGAGAGGAGAAGAGTTAGGAGGG - Intergenic
1165455401 19:35907785-35907807 ACTGAGGCACAGAGTTATGACGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166134757 19:40769325-40769347 ACTGAGAGGCCGAGGTGGGAGGG + Intergenic
1166228700 19:41413066-41413088 ACAGTGAAGCAGAGAAAGGATGG - Intronic
1166941274 19:46367612-46367634 TTTGAGAAGCAGATTTATGAGGG + Intronic
1168312028 19:55465208-55465230 CCTGAGCAGCAGAGTGAGGGAGG + Intergenic
1168705153 19:58466635-58466657 AGTGAGAGGCAGAGCTGGGAAGG + Intergenic
925040108 2:725987-726009 TCTGGGAAGAAGAGTTAGGAGGG + Intergenic
925189490 2:1871371-1871393 ACTGAGGAGCAGAGATAGGAGGG - Intronic
925770520 2:7278193-7278215 TTTGAGAAGCTGAGGTAGGAGGG + Intergenic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
926978802 2:18544246-18544268 TCAGAGAAGTAGAGATAGGAAGG - Intergenic
927436768 2:23073380-23073402 ACAGAAAAGCAGAGTTATGGAGG + Intergenic
927837117 2:26408019-26408041 ACTGAGAAGCAGGCTTTGAAGGG - Intronic
927841665 2:26448933-26448955 CCTGAGGAGCAGAGTCAGGATGG + Intronic
928634510 2:33229364-33229386 ACTGAGAAGCTGAGGCAGAAGGG + Intronic
929334545 2:40725211-40725233 ACTGAGAAGCAGAGTTCTACTGG + Intergenic
929676135 2:43931890-43931912 ACTGAGAAGGAAAGGAAGGAGGG - Intronic
931752242 2:65339895-65339917 ACAGAGAAGGGGAGTTAGTAAGG - Intronic
932134039 2:69213047-69213069 TCTGAGAAGCTGAGGCAGGAGGG - Intronic
932226347 2:70044079-70044101 TCTGAGAACCAGACTGAGGAAGG - Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
934912822 2:98274959-98274981 CCTGAGGAGCAGAGGAAGGATGG - Intronic
936995070 2:118404781-118404803 TCTGAGGAGCAGAGAAAGGATGG + Intergenic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937740841 2:125351335-125351357 ACTGAGAAGCATAGAGAAGAGGG + Intergenic
937856219 2:126673671-126673693 ACTGAGAAGAGGAGTTGGCACGG - Intronic
938700304 2:133872118-133872140 TCTGAGAAGCAGTTTTGGGAGGG + Intergenic
939250150 2:139672267-139672289 AAGGATAAGCAGAGTTAGGGTGG + Intergenic
939725667 2:145718520-145718542 ACTGCGGATCAGAGTTAGAAAGG + Intergenic
940251192 2:151678761-151678783 ACTGAGAAGCAGAGACATGAGGG + Intronic
940562954 2:155325004-155325026 ACAGAGAGGCAAAGTTAGAATGG - Intergenic
941013216 2:160325015-160325037 ACTCAGGAGCAGAGTCAGTAAGG + Intronic
941397572 2:164992147-164992169 CCTGAGAAGCAGATTAAGGCAGG - Intergenic
942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG + Intronic
944692471 2:202170321-202170343 AGTGAGAAACAGAGATTGGAAGG - Intronic
944849028 2:203698567-203698589 ACAGTTAAGCAGAGTTAAGAGGG + Intergenic
945194157 2:207222690-207222712 AATGAGAAGAAGAGTTAGAGAGG - Intergenic
945702394 2:213188404-213188426 TCAGAGAAGCAAAGTGAGGAGGG - Intergenic
947292784 2:228596122-228596144 AATGAGAAGCAGTTTTAGAAGGG + Intergenic
1169151846 20:3295613-3295635 ACTGAGAGGGAGCGTGAGGATGG + Intronic
1169152161 20:3297911-3297933 GATGAGAGGGAGAGTTAGGAGGG - Intronic
1170956237 20:20982392-20982414 ACTCAGATGCATAATTAGGATGG - Intergenic
1172863484 20:38076567-38076589 GCTGAGAAGCAGAGGCAGCAAGG - Intronic
1173155727 20:40606937-40606959 ACTGAGAAGCAAAGTGATCACGG - Intergenic
1173733302 20:45343037-45343059 GGTGAGCAGCAGAGCTAGGACGG + Intronic
1173845976 20:46189067-46189089 AGAGAGAAACAGAGATAGGAAGG + Intronic
1174350145 20:49961406-49961428 ACTGAGAGACAGAGATATGAAGG + Intergenic
1175192263 20:57219404-57219426 ACTGAGAAGCACAGGGTGGAGGG - Intronic
1177418847 21:20828741-20828763 AAACAGAAGCAAAGTTAGGAAGG + Intergenic
1177684347 21:24417366-24417388 ACAGAGAGGCAGGGTGAGGAAGG - Intergenic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1178405732 21:32321671-32321693 ACTGAGAGCCAGGGTTAGGTCGG + Intronic
1178822859 21:35991336-35991358 ACAGAGCAGGAGAGTGAGGAGGG + Intronic
1178910509 21:36669648-36669670 ACACAGAGGCAGAGATAGGAGGG - Intergenic
1180854624 22:19038219-19038241 CCTGAGAAGGAGAGCTTGGAAGG - Exonic
1181776101 22:25161113-25161135 AAGGAGAAGGAAAGTTAGGAAGG - Intronic
1182459455 22:30473379-30473401 ACTGTGAAGGAGAGCCAGGAGGG + Intergenic
1182582493 22:31323021-31323043 ACTGAGAGGTAGAGTTTGTAAGG + Intergenic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1183273766 22:36878325-36878347 ACAGAGCAGCAGAGACAGGAAGG - Intergenic
1184445425 22:44544340-44544362 GCTGAGAAGCAGAGCCTGGAGGG + Intergenic
1184961368 22:47931218-47931240 CCTGAGTAGAAGAGATAGGATGG + Intergenic
950158393 3:10740999-10741021 GCTGAGCAGCAGCGGTAGGAAGG - Intergenic
950437460 3:12988942-12988964 ACTGAGGATCAGAGACAGGAAGG + Intronic
950900159 3:16490381-16490403 TCAGAGAAGCAGAGAAAGGAGGG + Intronic
951336364 3:21427309-21427331 ACTGAGAAGCATTATTAGTAGGG + Intronic
953234155 3:41091572-41091594 ACTGAGGACCAGAGAAAGGAAGG - Intergenic
953443565 3:42941783-42941805 CCTGGGAAGAAGAGTCAGGATGG - Intronic
953458646 3:43063744-43063766 ACTGATAGGAAGACTTAGGAAGG + Intergenic
954811440 3:53250752-53250774 ACTGAGAACCTGAGATAGGAAGG + Intronic
955398433 3:58573866-58573888 ACTGAACAGCAGAGTTGAGATGG + Intronic
955621519 3:60869430-60869452 ATTGAGAAGCAGAGATAGAAGGG - Intronic
955780856 3:62483103-62483125 TCTCAGATGCAGAGTTAGGCTGG - Intronic
956127801 3:66027704-66027726 ACTGGGAATCTGAGTTAGGAGGG - Intronic
956153444 3:66267929-66267951 ACTGGGAAGGAGACTTTGGAGGG - Intronic
957124492 3:76141308-76141330 ACTGACAGCCAAAGTTAGGAAGG + Intronic
958189541 3:90167352-90167374 ACTGAGAATCACCGGTAGGAGGG - Intergenic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959560708 3:107777330-107777352 GTTGAGAAGCAGAGATAAGAGGG - Intronic
959572522 3:107900268-107900290 GGTGAGAAAAAGAGTTAGGAAGG - Intergenic
960797705 3:121505400-121505422 ACTGAAAAGCAGAGCAATGAAGG + Intronic
961259048 3:125584882-125584904 ACTCAGATGCTGAGGTAGGAGGG - Intronic
961264634 3:125631915-125631937 GATGAGAAGCAGCGTTATGAAGG + Intergenic
961542547 3:127609807-127609829 ACTGAGAAACAGAGGAAGGAAGG - Intronic
962115073 3:132496860-132496882 ACTGAAAAACATAGTTATGAAGG - Intronic
962221438 3:133567580-133567602 AATGAGTGGCAGAGTTAGGGAGG + Intergenic
962237114 3:133716066-133716088 ACTGAGGTGCAGTGTCAGGAGGG - Intergenic
962499396 3:135974666-135974688 GCTGAGAAGCAGAGTTTGAAAGG - Intronic
964074434 3:152676180-152676202 AATAAAAATCAGAGTTAGGATGG + Intergenic
964679966 3:159327696-159327718 ACATAGAAGCAGAGTTATTAGGG - Intronic
965709556 3:171543699-171543721 AGTGAGTAGCAGAGTTGGAAGGG + Intergenic
967954288 3:194865801-194865823 ACTGAGACTCAGAAGTAGGAAGG + Intergenic
968814499 4:2814989-2815011 ACTGAGAAGCACAGCCAGGGAGG + Intronic
969385853 4:6846939-6846961 ACTGAGAAGCACTTTTAAGAGGG - Intronic
969873502 4:10119031-10119053 AATGAGAAGCAGTGTTTGCAAGG - Intergenic
970215042 4:13750163-13750185 ACTGAGACACAGAGATAGTAAGG - Intergenic
970376498 4:15463010-15463032 ACTGTGATGCAGAGAGAGGATGG + Intergenic
970914753 4:21320218-21320240 GCAGATAAGCAGAGTTTGGAGGG + Intronic
972357188 4:38291127-38291149 TCTGAGCATCAGAGTGAGGAGGG + Intergenic
973019860 4:45189104-45189126 AATGAGAAGCAGAGTGTGGTTGG - Intergenic
973823559 4:54684098-54684120 ACTCAGTAGCAGAGGCAGGAAGG + Intronic
974056780 4:56991533-56991555 ACTGAGAAACAAAGTGAGGTAGG + Intronic
974393627 4:61306430-61306452 AAAGATAAGCAGAGTTAAGATGG + Intronic
975937970 4:79604739-79604761 AGAGAAAAGAAGAGTTAGGAAGG - Intergenic
976668484 4:87626040-87626062 ACTGAGAAGCAGTGAGAGGATGG - Intergenic
976780465 4:88752721-88752743 ACTGAGAGGCGAAGTAAGGAGGG + Intronic
976802735 4:89010790-89010812 CCTGAGAAACTGTGTTAGGAAGG - Intronic
977270980 4:94917175-94917197 ACAGAGAACCACTGTTAGGATGG + Intronic
977571934 4:98638007-98638029 ACCGTGGAGCAGAGTTAAGAAGG - Intronic
977848006 4:101789300-101789322 ATTGTGGAGCAGAGTCAGGATGG + Intronic
977871155 4:102092387-102092409 ACTGTGAAGAAGCTTTAGGAAGG - Intergenic
979265865 4:118702194-118702216 ACTGGGAAGCAGAGTTTTGCAGG - Intronic
980029564 4:127811550-127811572 ATTGAGAAGCAAAATTTGGAAGG + Exonic
981453239 4:144923490-144923512 CTTGAGATGCAGAGTTAGGGAGG - Intergenic
982442462 4:155453054-155453076 AATTAGGAGCAGAGTTAGAAGGG + Intergenic
983575777 4:169260305-169260327 CCAGAGAAGCAGTTTTAGGAAGG + Intronic
983991741 4:174128032-174128054 ATTGACAATCAGAGTTACGATGG + Intergenic
985163145 4:187064348-187064370 ACTGAGATGCGGACCTAGGATGG - Intergenic
986095582 5:4550561-4550583 ACAGAGAAACAGTATTAGGAGGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987149431 5:15023783-15023805 ACTGAGCAGGAGTGTCAGGAAGG + Intergenic
991407245 5:66312116-66312138 ACAGAGAAGCCCAGTTAGCATGG + Intergenic
991676835 5:69096593-69096615 AATGGTAAGCAGAGTTAAGAGGG - Intronic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
995232550 5:109785387-109785409 GCTGAGAAGCATAGCCAGGAAGG + Intronic
996472211 5:123873946-123873968 AGTAAGCAGCAGAGTCAGGATGG + Intergenic
996789674 5:127279375-127279397 AGTGAGTAGCTGAGGTAGGATGG + Intergenic
998215923 5:140238737-140238759 GCTCAGATGCAGAGGTAGGAAGG - Intronic
998656389 5:144185162-144185184 GCTGAGCAGTAGAGTGAGGATGG + Intronic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
999030873 5:148289825-148289847 TCTGGGAATCAGAATTAGGATGG + Intergenic
1000244380 5:159437097-159437119 CCTGAGGAGCAGGGATAGGATGG + Intergenic
1000507968 5:162145509-162145531 AGTGAGAGGCAGAGTAGGGATGG - Intronic
1001421322 5:171589428-171589450 TGTGAGAAGCAGAGGTAGGAGGG + Intergenic
1001950086 5:175810259-175810281 ACTGAGACCCAGAGTGGGGAGGG + Intronic
1002414131 5:179109955-179109977 AGGGAGAAGCAGGGGTAGGAAGG - Intergenic
1002746687 6:63169-63191 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1003510968 6:6780027-6780049 ACTGGGAAGAAGAGAAAGGAGGG + Intergenic
1004715784 6:18215212-18215234 ACTGAGAATCACAGGAAGGAAGG + Intronic
1005195551 6:23279419-23279441 ACTGGGCAGCAGAGTTATAAAGG + Intergenic
1005457940 6:26039443-26039465 ACTGTAAATCAGAGTTAGGAGGG - Intergenic
1006648954 6:35535337-35535359 ACTGAGAGGCTGGGGTAGGAAGG - Intergenic
1008437515 6:51493914-51493936 AGTGTGATGCAGAGTTAGAAAGG - Intergenic
1010269106 6:73901147-73901169 ATTGAGAAGCAAAGCTAGGCTGG - Intergenic
1010293399 6:74166895-74166917 AATGAGAAGCAGAGGAAGAAAGG - Intergenic
1010952358 6:82052207-82052229 ACTGAGAAGTGAATTTAGGAAGG - Intergenic
1011401150 6:86962995-86963017 ACTGACAAACAGCGTTAGGCAGG + Intronic
1012612581 6:101233869-101233891 ACTAAGAAGCTGAGTTAGTGTGG + Intergenic
1012921427 6:105224272-105224294 ACACAGTAGCAGTGTTAGGAGGG + Intergenic
1013570356 6:111417547-111417569 CCAGTGAAGCAGAGTGAGGAGGG - Intronic
1014075264 6:117228183-117228205 ACAGAGAAACAAAGTGAGGAGGG - Intergenic
1015495461 6:133877755-133877777 ATTGTGAAGCAGAGGAAGGAAGG + Intergenic
1015993632 6:138975116-138975138 TCTGGGCAGCAGAGTTAGGAGGG - Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1018074581 6:160200603-160200625 AATGAGAAACAGACCTAGGAAGG - Intronic
1019090712 6:169530487-169530509 ACTGAGGAGCAGAGGTGGGGAGG - Intronic
1019546518 7:1579626-1579648 ACTGGGAAGCCGCGTCAGGAGGG + Intergenic
1019725684 7:2601239-2601261 AGTGAGAGGCAGAATTAGGATGG - Intronic
1020646921 7:10825717-10825739 ACTGAGCTACAGAATTAGGAAGG - Intergenic
1020872911 7:13656051-13656073 AAAGAAAAGCAGAGTTAGGGTGG - Intergenic
1021088226 7:16449528-16449550 AGTGAGAAGCAGAGGAAAGAAGG - Intergenic
1021297700 7:18929392-18929414 ACTGAGAAAGAGAATTAGAAGGG - Intronic
1021402525 7:20225987-20226009 ACTGAGATGCATAGGTAGAAAGG - Intergenic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022911389 7:34902173-34902195 ACTGAGGGGCAGATTTAGGCTGG + Intergenic
1023836289 7:44069825-44069847 AGGGAGAAGGAGAGATAGGAGGG + Intergenic
1025035597 7:55591029-55591051 GCTGAGAGGCAGTGTCAGGATGG + Intergenic
1025957037 7:66190980-66191002 CCTGAGAAGCAGAGGTTGCAGGG - Intergenic
1026192275 7:68140307-68140329 TCTGAGCAGCAGAGTGAGTAGGG - Intergenic
1026303551 7:69120163-69120185 TCTGGGAAGCAGAGGTTGGAGGG + Intergenic
1026443759 7:70465931-70465953 TCAGGGAAGCACAGTTAGGATGG + Intronic
1027646746 7:80811388-80811410 ACTGAGAAGGAAAGTTAAGCAGG + Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028188539 7:87818857-87818879 GCAGAGAAGCAGTGTTAAGAAGG + Intronic
1028555592 7:92120528-92120550 ACTGAGAAGCTGAGATGGGAAGG - Intronic
1030021203 7:105276952-105276974 CAGGAGAAGTAGAGTTAGGATGG - Intronic
1030745264 7:113158223-113158245 ACTGAGCAGCAGGGCTAAGAAGG + Intergenic
1030821400 7:114096429-114096451 ACAAAGAAGCAAAGTTAGAAGGG - Intronic
1031388892 7:121188765-121188787 GCTGAGAAATAGAGTTAAGATGG + Intronic
1032120325 7:129150486-129150508 ACTGGGAGGCAGAGATAGGAAGG + Intronic
1032211208 7:129915759-129915781 AAAGACAGGCAGAGTTAGGAGGG - Intronic
1032546132 7:132744583-132744605 ACTGAGAAGCAGTGTTGATATGG - Intergenic
1032982991 7:137306355-137306377 AATGAGAATGAGAGTTGGGAGGG + Intronic
1033313750 7:140281248-140281270 ACTGAGGAGCAGAGCTGGCAAGG + Intergenic
1033593085 7:142831013-142831035 AATGACAAGCAGAGATAGGGTGG + Intergenic
1033932774 7:146545083-146545105 ACAGAGAAGCTCAGGTAGGAGGG + Intronic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1036688418 8:10926528-10926550 ACTGACAACCAGAGTGAGGCTGG + Intronic
1037118571 8:15255601-15255623 AATAAGAAGCATATTTAGGAAGG + Intergenic
1037349534 8:17936018-17936040 ACTCAAAAGCAGAGTTAGGGTGG - Intronic
1038084807 8:24183816-24183838 ATTGAAAAGCAGTGTTAAGAGGG - Intergenic
1038858501 8:31359708-31359730 GTTGAAAATCAGAGTTAGGAGGG - Intergenic
1039301492 8:36214208-36214230 ACTGCCTAGCAGAGGTAGGAAGG - Intergenic
1039569442 8:38575395-38575417 AATGAGAGGCAGAGCCAGGAGGG - Intergenic
1040509145 8:48078057-48078079 ACCCAGAAGCAGAGTTTGCAGGG - Intergenic
1041388740 8:57330502-57330524 ATTGTGAAGGAGAGTTGGGAAGG - Intergenic
1041901364 8:62986749-62986771 ACTGAAAAGCAGAGTTTTGGGGG - Intronic
1043357301 8:79428159-79428181 ACTGTGAAAAAGAGTTGGGATGG - Intergenic
1045666869 8:104497362-104497384 ACTGAGCAGCAGCGTTGTGATGG - Exonic
1045858162 8:106788383-106788405 ACTGTAAAGCAGACTTAGGCAGG - Intergenic
1047683947 8:127284630-127284652 ACTGAGAACAAGAGTTAGCAAGG - Intergenic
1049650430 8:143764947-143764969 AGGGAGGAGCAGAGTTAGGTGGG - Intergenic
1049864417 8:144924748-144924770 ACTGGGCAGGCGAGTTAGGAGGG + Intergenic
1050365656 9:4871257-4871279 CCTGAGAAGAAGAGTGAGAAAGG + Intronic
1055636758 9:78286783-78286805 AGAGAGAAGCAAAGTTAGAAAGG + Intergenic
1056041870 9:82676598-82676620 ACTCAGAAGCAGAGATGGGAGGG - Intergenic
1056213695 9:84388824-84388846 ATTGTAAATCAGAGTTAGGAGGG - Intergenic
1057282708 9:93724416-93724438 TCTGAGAAAGAGAGTTAAGATGG - Intergenic
1058140320 9:101350868-101350890 ACTGGGAAGATGAGTTTGGAAGG + Intergenic
1058354010 9:104061228-104061250 CCTGAGAAGCAGAGAAAAGAGGG + Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1060492447 9:124094863-124094885 ACAGAGGAGCATAATTAGGAAGG + Intergenic
1061390463 9:130314864-130314886 ACTGAGGCCCAGAGTGAGGATGG + Intronic
1061508242 9:131044817-131044839 ACTGAGAAGCGGTGATAGGTTGG + Intronic
1062519138 9:136950414-136950436 ACTGAGCAGCAGAGGTCGGGTGG - Intronic
1185976852 X:4730922-4730944 ATTGAAAATCAGAGTTAGAAGGG - Intergenic
1186344033 X:8672656-8672678 AGTGAGGAGCAGAGTGCGGAGGG - Intronic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1187277496 X:17828716-17828738 ACTCAGGATCAGATTTAGGATGG + Intronic
1188025817 X:25208244-25208266 ACTGAGAGGCTGAGTTAATAAGG + Intergenic
1188144609 X:26595632-26595654 TCTCAGAAGGATAGTTAGGAGGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188905313 X:35784538-35784560 AGTGGGAAGCAGAGTAAGCAGGG + Intergenic
1189248479 X:39581527-39581549 ACTGAGGAGCAGAGGTGGGCAGG - Intergenic
1192205243 X:69091477-69091499 GCTGAGAACCAGAGTGGGGAAGG - Intergenic
1193310010 X:79995740-79995762 GCTGAGAAGTATAGGTAGGAGGG + Intergenic
1193364027 X:80608885-80608907 ACAGAGAAGAAGAGAAAGGATGG + Intergenic
1195797135 X:108663170-108663192 ACTAACAAGCATATTTAGGAGGG - Intronic
1195819317 X:108926157-108926179 AAAGATAAGCAGAGTTAGGGCGG + Intergenic
1196700958 X:118667989-118668011 ACTAATAAGCAGATTTAGTAAGG - Intronic
1197143508 X:123143483-123143505 ACTGAGAAACAGGGTTGAGAAGG + Intergenic
1197371044 X:125626940-125626962 TATGAGAAGCAGTGTCAGGACGG + Intergenic
1197371152 X:125627678-125627700 CATGAGAAGCAGTGTCAGGACGG - Intergenic
1199061227 X:143357346-143357368 ACTGTGAACCAGGTTTAGGAAGG - Intergenic
1199363874 X:146955436-146955458 ACTGTGAAGGAGAGTTGGGGAGG - Intergenic