ID: 1089353467

View in Genome Browser
Species Human (GRCh38)
Location 11:117834687-117834709
Sequence CAGGTTACACAGCTGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 1, 2: 4, 3: 41, 4: 419}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089353467_1089353478 30 Left 1089353467 11:117834687-117834709 CCATCCCCCAGCTGTGTAACCTG 0: 1
1: 1
2: 4
3: 41
4: 419
Right 1089353478 11:117834740-117834762 CAGAATATAGCTGGATTACTAGG 0: 1
1: 0
2: 0
3: 9
4: 98
1089353467_1089353476 21 Left 1089353467 11:117834687-117834709 CCATCCCCCAGCTGTGTAACCTG 0: 1
1: 1
2: 4
3: 41
4: 419
Right 1089353476 11:117834731-117834753 GACCAATCTCAGAATATAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089353467 Original CRISPR CAGGTTACACAGCTGGGGGA TGG (reversed) Intronic
901056133 1:6449337-6449359 CAGGCCACACAGCTAGGGGGTGG - Intronic
901283927 1:8061286-8061308 CAGGCTACACAGCTAGGAAATGG + Intergenic
901976891 1:12952359-12952381 AAGGTGACTCAGCTGGGGGCAGG - Intronic
902008279 1:13249411-13249433 AAGGTGACTCAGCTGGGGGCAGG + Intergenic
902027249 1:13393178-13393200 AAGGTGACTCAGCTGGGGGCAGG + Intergenic
902744876 1:18467135-18467157 CAAGTTCCACAGCTTGGAGATGG - Intergenic
902786161 1:18734002-18734024 GAGGTTACACAGCTGGTAAACGG + Intronic
902997003 1:20233624-20233646 CATGTCACACTGCTGGGGAATGG + Intergenic
903024558 1:20418149-20418171 CAGGTCCCGCAGCTGGTGGATGG + Intergenic
903164787 1:21512586-21512608 CAGGTCACACAGCTGGCGATTGG - Intronic
903734753 1:25523042-25523064 AAGGTCACACAGCTGCTGGATGG - Intergenic
904279631 1:29409690-29409712 GAGGTTACGCAGCTGGGACATGG - Intergenic
904293855 1:29505228-29505250 AAGGTCAGACAGCTGGGAGATGG - Intergenic
904400077 1:30250464-30250486 GAGGTCACGCAGCTGGGGAATGG - Intergenic
904702428 1:32365906-32365928 CAGGTGGCACAGCTGGGCTAAGG + Intronic
905620018 1:39437029-39437051 CCATTTACACAGCTGGTGGAGGG + Intronic
906286173 1:44589235-44589257 AAGGTCACACAGCTGGGAAATGG - Intronic
906516556 1:46442521-46442543 AAGGCTACACAGCTAGTGGATGG - Intergenic
906800756 1:48734985-48735007 CAGGTTATACAGCTAGTGGGAGG - Intronic
907048550 1:51314761-51314783 CAGGTCACACAGCTGGTAGCTGG - Intronic
907251859 1:53144974-53144996 AAGGTCACACAGCTGGTTGAAGG - Intergenic
908231846 1:62112923-62112945 CAGGTTACACAGCTAGCAGGTGG - Intronic
910218952 1:84870739-84870761 AAGGTTACACAGCTAGGAGTGGG + Intronic
910533063 1:88263142-88263164 GAGGTTAGCCTGCTGGGGGATGG + Intergenic
911000332 1:93158209-93158231 AAGGTTACACAGCTAGTGAACGG - Intronic
914250819 1:145919890-145919912 TAGGTCACTCACCTGGGGGAAGG - Intergenic
915283764 1:154839950-154839972 TAGGTCACAGAGCTGGGGGGAGG + Intronic
915285701 1:154850635-154850657 AAGGTCTCCCAGCTGGGGGAAGG - Intronic
916351415 1:163853983-163854005 CAGGTTCCACCTCTGGGGCAGGG - Intergenic
916505703 1:165426402-165426424 CAGGTAACACAGGTGAGTGAAGG - Intronic
917193588 1:172444000-172444022 AGGGTTGCGCAGCTGGGGGACGG + Exonic
917708636 1:177660489-177660511 CAGGGTGCACAGCTTGGGAATGG + Intergenic
917836080 1:178942567-178942589 CAGGTCACACAGCTGGTGCCTGG + Intergenic
919075664 1:192809514-192809536 CAGCTTACACAGCTACTGGAAGG + Intronic
919571360 1:199253018-199253040 CAGTGTACACTGCTTGGGGAGGG - Intergenic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
920414995 1:205793211-205793233 CAGGACACACAGCTGGGAGGAGG + Intronic
920691933 1:208153840-208153862 CAGAACAGACAGCTGGGGGAGGG + Intronic
920890296 1:209978790-209978812 CAGGTTCCACCTCTGGGGGCAGG - Intronic
921095434 1:211883417-211883439 CAACTTACACAGCTGTTGGAAGG - Intergenic
922213131 1:223500518-223500540 CAGCTTGCACAGCTGGGAGCAGG - Intergenic
923245653 1:232129578-232129600 CAGGTTACTCAGCTGGTTAAAGG - Intergenic
1062855789 10:778894-778916 CCGGCTTCACAGCTGGGGGGAGG + Intergenic
1067006170 10:42665667-42665689 CAGGTTCCACCTCTGGGGGCAGG + Intergenic
1067291522 10:44946992-44947014 CTGGTCACACAGCTGGTGAAGGG - Intergenic
1067468982 10:46522778-46522800 AAGGTTACACAGCTGGCAAAGGG + Intergenic
1068173143 10:53422098-53422120 CAGGTTTCTCAGGTGGTGGATGG + Intergenic
1069123663 10:64602266-64602288 CAGGTTAGAAAGGTGAGGGAGGG + Intergenic
1069839505 10:71330355-71330377 GAGGTTACCCAGCTGGGTCAGGG - Intronic
1070399506 10:76040911-76040933 CATGTTACACAGCTGGGCTGTGG + Intronic
1070559084 10:77552323-77552345 GAGGTCACACAGCTGGGAAATGG - Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070646211 10:78204062-78204084 CAGGTCACAGAGCTGGGGAGTGG - Intergenic
1071302070 10:84263471-84263493 AAGGTTACCCAGCGAGGGGATGG - Intergenic
1072538135 10:96378666-96378688 AAGGTCACACAGCTAGGGAACGG + Intronic
1073072162 10:100801550-100801572 AAGGTCACACAACTGGGGAATGG - Intronic
1073458412 10:103651572-103651594 AAGGTTGCACAGCTGGGAGGTGG - Intronic
1074390529 10:113053885-113053907 AAGGTCACACAGCTGGGAGGCGG + Intronic
1075271864 10:121059429-121059451 CAGCTTCCACACCTGCGGGAGGG + Intergenic
1075571853 10:123551997-123552019 CATGTCACACAGCTGGTGAATGG + Intergenic
1075817197 10:125273692-125273714 CAGGTCACACCACTGGGGGCTGG - Intergenic
1076691633 10:132226638-132226660 CAGGTGCCACAGCTGGGGGCAGG + Intronic
1076769964 10:132657483-132657505 CAGACTACAGAGCTGGGGGTGGG - Intronic
1077427317 11:2489194-2489216 CATGCCACATAGCTGGGGGATGG - Intronic
1077866822 11:6229232-6229254 AAAGTCACACAGCTGGGGAATGG - Intronic
1080855312 11:36106807-36106829 CAGGTCACACAGCAGAGGGAGGG - Intronic
1081395825 11:42585191-42585213 CAGTTTACACATCTGGGTGGTGG + Intergenic
1081593708 11:44444723-44444745 CAGGTCACACAGCTGGTGAATGG - Intergenic
1081750638 11:45508363-45508385 GAGTTTACACAGCTGGTGAATGG - Intergenic
1081818335 11:45966548-45966570 CAGGTTACACAGCTAGTGAGTGG - Intronic
1081911929 11:46705295-46705317 CAGTTCAGGCAGCTGGGGGAAGG - Exonic
1082814644 11:57499870-57499892 CAAGTTGCACAGCAGGGAGAAGG + Intronic
1083332706 11:61906361-61906383 CAGGTCACACAGCATGGGGCAGG + Intronic
1083678690 11:64341596-64341618 CAGGTGACCCAGCCGGGGGCCGG + Exonic
1083960303 11:66011669-66011691 GAGGTTACACAGCTAGGAAATGG + Intergenic
1084199163 11:67543761-67543783 AAGGTCACACAGCTGGGTAAAGG - Intergenic
1086310571 11:85531718-85531740 CAGGTTACACAGCGGTGGAGGGG + Intronic
1089179925 11:116576409-116576431 CAGATTTCACAACTGGGGGGTGG + Intergenic
1089291931 11:117442893-117442915 CAGGTTGCTCAGCTGTGGAATGG + Intronic
1089340022 11:117750930-117750952 CAGACTTCACAGCTGGGGCAGGG - Intronic
1089353467 11:117834687-117834709 CAGGTTACACAGCTGGGGGATGG - Intronic
1089605225 11:119637854-119637876 CAGGGTACAGAGCTGGAGGTGGG + Intronic
1090188478 11:124753042-124753064 CTGGGTACACAGCTTGGGAAGGG + Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090749774 11:129735188-129735210 CAGGTCACACCTCTGGGGCATGG + Intergenic
1090947143 11:131440721-131440743 CAGGTTCCACAGATGAGTGACGG + Intronic
1091662298 12:2393464-2393486 AAAGTTACACAGCTAGTGGATGG - Intronic
1092747609 12:11688569-11688591 CAGGTTACACAGCAGGATGCAGG - Intronic
1092760384 12:11805083-11805105 CAGGTTGCTGGGCTGGGGGAGGG + Intronic
1095734754 12:45544582-45544604 CAGGTTACACAGCTAGTAAATGG - Intergenic
1096069547 12:48767362-48767384 CAGGTTGCACAGGAGTGGGATGG - Exonic
1096575047 12:52547594-52547616 GAGGGTACATCGCTGGGGGAAGG + Intronic
1100444223 12:94646248-94646270 TAGGTTAGAGAGATGGGGGAGGG + Intronic
1101286019 12:103313497-103313519 CAGGTAACACAGCTGGGAAGGGG - Intronic
1101823177 12:108199782-108199804 AAGATTACCCACCTGGGGGAGGG + Intronic
1101853936 12:108426653-108426675 CAGGTTACACAGCTGGGAAAAGG + Intergenic
1102219779 12:111186639-111186661 AAGGTCACACAGCTGGCAGATGG - Intronic
1102639237 12:114351974-114351996 CAGATTACACAGCTGGTGTGTGG - Intergenic
1102890087 12:116552002-116552024 CAGGATACACACCCGGGAGAGGG - Intergenic
1103530572 12:121598362-121598384 CAGGTCACACAGCTGGTACATGG - Intergenic
1103947953 12:124537484-124537506 CAAGTTGCACAGCTAGGAGAGGG - Intronic
1103961795 12:124613621-124613643 CAGGTCACACAGCTAGGGAGTGG + Intergenic
1104149831 12:126071615-126071637 TAGGTCAGACAGCTGGGGGGTGG + Intergenic
1104172569 12:126296415-126296437 AAGGTTACACAGCTGGTGGGTGG + Intergenic
1105212699 13:18266757-18266779 GAGGTCACACAGCTGGGAGGTGG - Intergenic
1106131325 13:26942058-26942080 CAGATTACACAGCCCGGGGGAGG - Intergenic
1108343277 13:49518690-49518712 CAGGTTACACAGCTGGTCAGTGG + Intronic
1110686749 13:78384522-78384544 AAGGTTACACAGCTGGTAGGTGG + Intergenic
1111559891 13:89931315-89931337 CATCTCAAACAGCTGGGGGAAGG + Intergenic
1111643724 13:91003564-91003586 CAAGTCACACAGCTGGGAAAGGG - Intergenic
1111650946 13:91090710-91090732 CAGGTCACACAGCTGGTGAGAGG - Intergenic
1111910763 13:94309416-94309438 CAGTTTACTCAGCTTGGGGTTGG - Intronic
1112651034 13:101398778-101398800 CAGGGTGCACAGCGTGGGGAGGG + Intronic
1113586163 13:111467623-111467645 CAGGGGACATTGCTGGGGGAGGG + Intergenic
1114613680 14:24057464-24057486 CAGGGTGCACAGCTGGGGAAGGG - Intronic
1114669599 14:24402017-24402039 CAGGTTGCAGGACTGGGGGAGGG + Intronic
1114994298 14:28328515-28328537 CATGTGGCACAGCTGGGGGATGG + Intergenic
1116523781 14:45880275-45880297 CAAGCTCCACTGCTGGGGGATGG + Intergenic
1117242734 14:53851285-53851307 GAGGTTAGACAGTTGGGAGAAGG - Intergenic
1117745604 14:58866387-58866409 CAGGTTTCCCAGCAGGGAGAAGG - Intergenic
1119726222 14:76923214-76923236 CAGGTGACCCAGGTGGGGAAAGG - Intergenic
1120870891 14:89336572-89336594 CAGGTCACACAGCTTGCAGATGG - Intronic
1121422065 14:93823394-93823416 CAGGTCACACAGCTGAGAAAGGG + Intergenic
1121618437 14:95329864-95329886 AAGGTCACACAGCAGGGTGAGGG + Intergenic
1121847933 14:97190554-97190576 CAGGGTACACTGCTCGGTGATGG - Intergenic
1122207489 14:100155254-100155276 CAGGTTACTCAGCTGTGGATGGG - Intronic
1202905142 14_GL000194v1_random:67288-67310 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1123432799 15:20232723-20232745 AAGGTTACACAGCTTGTGAACGG + Intergenic
1124021828 15:25932528-25932550 GAGGTGACACTGCTGGGGGTGGG - Intergenic
1124097993 15:26667183-26667205 CAGGTTTCACACCTGGGTTAGGG + Intronic
1125094090 15:35831050-35831072 CAGGTTACAAAGCAAGGGTATGG - Intergenic
1126332771 15:47551331-47551353 CAGGTTGCAGAGTTGGGGGAAGG + Intronic
1126534092 15:49741971-49741993 CAAGCTACACAGCCTGGGGATGG - Intergenic
1127039981 15:54964008-54964030 CAGCTTCCATACCTGGGGGAAGG + Intergenic
1127402357 15:58602265-58602287 CAGGTTCCAAGGCTGGGGTAGGG - Intronic
1127800835 15:62476208-62476230 CAGGTGACAAAGCAGGAGGAGGG - Intronic
1127960815 15:63888979-63889001 CAGGTCACACAGCTGGGGAGAGG - Intergenic
1128395242 15:67218329-67218351 CAGGTGATAAAGCTGGGGCAGGG + Intronic
1128606016 15:69037207-69037229 CAAGGTACAAAGGTGGGGGATGG + Exonic
1130400480 15:83547427-83547449 CATGCTGCACTGCTGGGGGATGG + Intronic
1130717063 15:86345308-86345330 GAGGTTAAACACCAGGGGGATGG - Intronic
1130731440 15:86497560-86497582 CATGGAACACAGCTGAGGGAAGG - Intronic
1131065593 15:89433295-89433317 CAGGCTCCCCAGCTAGGGGAGGG - Intergenic
1132186196 15:99803989-99804011 AAGGTCACACAGCTGGAGGGTGG + Intergenic
1132429477 15:101748714-101748736 AAGGTCACACAGCTGGAGGGTGG - Intergenic
1132875952 16:2137274-2137296 CAGGTCACACAGCAGGTGGATGG + Intergenic
1133337904 16:5018041-5018063 AAGGTTACACAGCTAGTGAAAGG - Exonic
1133523494 16:6581430-6581452 CAGCCAACACAGCTGGGGGAAGG - Intronic
1134241581 16:12510731-12510753 CAGGCTGGACAGCTGGGGGGTGG - Intronic
1134349171 16:13420534-13420556 CAGGTTATAAAAGTGGGGGATGG + Intergenic
1134535373 16:15022260-15022282 CAGGTTACATAGCTGGTGACTGG + Intronic
1134860297 16:17554742-17554764 CAGGTCACACAGCTGATGAATGG - Intergenic
1135990064 16:27213049-27213071 CAGGTCACCCAGCTGGGAGATGG + Intronic
1136247927 16:28985825-28985847 AAGGAGACACAGCTTGGGGATGG - Intronic
1137367800 16:47875830-47875852 CAGGTGACACAGCTGGTGACTGG + Intergenic
1137545713 16:49401822-49401844 CATGTAATACAGCTGGTGGAGGG - Intergenic
1138086861 16:54141342-54141364 AAGGTCACACAGCTGGGGAGTGG - Intergenic
1138490848 16:57375655-57375677 CAGGACACACAGCTGGGCAATGG + Intronic
1138778347 16:59752706-59752728 CATGTCACACAGCTGGTTGATGG - Intronic
1139339525 16:66259014-66259036 CAGGTCACACAGCTGGGAAGTGG + Intergenic
1139358791 16:66383667-66383689 CAGGTTACAGAGCTGAGGCATGG + Intronic
1139483254 16:67242388-67242410 CAGGACAGACAGCTGGGGGTGGG - Intronic
1139645152 16:68324052-68324074 CTGGCTACCCAGCTGTGGGAGGG + Intronic
1139860675 16:70018529-70018551 CAGGTTACATAGCTGGTGACTGG - Intergenic
1141441880 16:84034419-84034441 GAGGTAAGACAGATGGGGGAGGG + Intronic
1141622353 16:85243107-85243129 CATGTTACTCACCTGAGGGATGG - Intergenic
1143451423 17:7038926-7038948 CATGTTGCACAACTAGGGGAGGG + Intronic
1146141767 17:30374277-30374299 CAGGTTACATAGCAAGTGGAGGG + Intergenic
1146259836 17:31414134-31414156 CTGGTCACACAGCTGGGAAATGG + Intronic
1146463274 17:33065053-33065075 CAGGTTCCCCAGCTGGGAAATGG + Intronic
1146745350 17:35323883-35323905 CAGGTCACACAGATGAAGGATGG + Intergenic
1147159719 17:38562952-38562974 CATTGTGCACAGCTGGGGGATGG - Intronic
1147188366 17:38725053-38725075 CAGGTACCTCAGCAGGGGGAAGG + Intronic
1148212965 17:45819329-45819351 AAGGTCACACAGCTAGTGGAAGG + Intronic
1148439771 17:47705909-47705931 CAGGTGGCAGAGCTGGGAGAGGG + Intronic
1148875618 17:50685135-50685157 TAAGTTGCACAGCTGGGAGAAGG + Intronic
1150123806 17:62623734-62623756 CAGGTTACAAAGCTGGGAAATGG + Intergenic
1150136381 17:62697540-62697562 CAGGTTTCACAGCTGGGGGAGGG + Intergenic
1150642802 17:66961017-66961039 CAGGTTTCACACCTGGAGGATGG - Intergenic
1150850887 17:68702724-68702746 AAGGTTACACAGCTGCCAGAGGG - Intergenic
1151140494 17:71987067-71987089 CATATTACTCAGCTGGGGGTTGG - Intergenic
1151190679 17:72395632-72395654 AAGGTTACACGGCTAGGGGCTGG + Intergenic
1152199620 17:78937770-78937792 CAGGTCACCCAGCTGGCGGTAGG - Intergenic
1152230967 17:79113970-79113992 CAGATAACACAGCTTGGGGACGG - Intronic
1153016084 18:583861-583883 CAGATCACCCAGGTGGGGGAGGG + Intergenic
1153166701 18:2269739-2269761 CAAGTCACACAGCTGGTGCATGG + Intergenic
1153732586 18:8029402-8029424 CAGGTAGGACAGGTGGGGGAGGG - Intronic
1153873883 18:9347909-9347931 CAGGTAACAGAGTTGGGGGAAGG - Intronic
1154301918 18:13201659-13201681 CAGGTCACACAGCTGGTAAATGG - Intergenic
1155131075 18:22934824-22934846 AAGGTCACACAGCTGGGACATGG - Intronic
1155309688 18:24511254-24511276 CTGGTTATAAAGCTGAGGGAAGG + Intergenic
1156521505 18:37725746-37725768 CAGGTAACACAGCTGGTAAATGG + Intergenic
1156889905 18:42178736-42178758 AAGGTCACACAGCTGGTGGCAGG + Intergenic
1157485855 18:48086350-48086372 AAGGTCACACAGCTAGGAGATGG + Intronic
1157565736 18:48678006-48678028 CAAATCACACAGCTGGGAGAAGG + Intronic
1160743162 19:696892-696914 CAGCTCACACAGCCGGGTGATGG + Intergenic
1161213782 19:3082545-3082567 AAAGTCACACAGCTTGGGGAGGG + Intergenic
1161494170 19:4578696-4578718 AAGGTTATAGAGCAGGGGGAGGG - Intergenic
1162001670 19:7748129-7748151 AAGGTCACACAGCTGGTAGATGG + Intergenic
1162015733 19:7845608-7845630 AAGGTCACACAGCTGGTTGAGGG + Intronic
1162559947 19:11411298-11411320 CAGGCGATAGAGCTGGGGGAAGG - Intronic
1163125766 19:15243392-15243414 CTGGTGACACGGCTGGGGGCCGG + Exonic
1164816897 19:31211322-31211344 CAGGTTGCAGAGATGAGGGAGGG + Intergenic
1165029046 19:32984096-32984118 AAGGTTACACAGCTTGTGAACGG + Intronic
1166017763 19:39995977-39995999 CAGATTCCAGAGCTGGGGAAGGG - Intronic
1166695418 19:44848917-44848939 CAGGGAAGAAAGCTGGGGGAGGG - Intronic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167576665 19:50320956-50320978 CAGGGGGCACAGCTGGGAGAGGG + Intronic
1167669774 19:50844079-50844101 CAGGTTTCTCAGGTGGAGGATGG + Intergenic
926297553 2:11579617-11579639 AGGGTTACACAGCTGGGAGGTGG + Intronic
926371792 2:12186052-12186074 CAAGATACACGGCTGGTGGATGG + Intergenic
926842054 2:17091774-17091796 AAGGTCACACAGCTGGGTGGGGG + Intergenic
927149824 2:20189120-20189142 CAGGTTACACAGTGGGAGGCAGG + Intergenic
927606252 2:24490086-24490108 CAGGTTCCCCAGTTGGGAGAAGG + Intergenic
927929343 2:27034143-27034165 TAGGTTCCACAGCAGGGGGTGGG - Exonic
928179734 2:29060269-29060291 CAGGTCACAGAGCCAGGGGATGG + Exonic
928486283 2:31735724-31735746 AAGGTTCCACAGCTGGTGAATGG + Intergenic
929428031 2:41863823-41863845 CAGGTCACACAGCTTGGGTCCGG - Intergenic
929487711 2:42369701-42369723 CAAATTAGAGAGCTGGGGGAGGG + Intronic
929489638 2:42384865-42384887 CACCTTGCAGAGCTGGGGGAAGG - Intronic
929926811 2:46219418-46219440 CAGATTTCAGAGCTTGGGGATGG - Intergenic
930400768 2:50882464-50882486 CAGGTGACATAGCTGGTGTACGG + Intronic
931517276 2:63057371-63057393 CAGGGTACAGAGGTGGGGGTTGG + Exonic
932079123 2:68695352-68695374 CAGGTTATCAAGATGGGGGAGGG - Intronic
933307331 2:80618647-80618669 AAGGTCACACAGCAGGGCGATGG + Intronic
934501492 2:94863186-94863208 CAGGTCAGACAGGTGGAGGAGGG - Intergenic
934573782 2:95388041-95388063 AAGGTCACACAGCTGGTGAATGG - Intergenic
935599384 2:104907114-104907136 CATGTTAGAGAGATGGGGGAAGG - Intergenic
936401165 2:112165443-112165465 AAGGTTACACAGCTAGGGGGTGG + Intronic
936950335 2:117971650-117971672 GAGGTCACACAGCTGGGAAATGG + Intronic
936950858 2:117975997-117976019 GAGGTCACCCAGCTGGTGGATGG - Intronic
937633834 2:124133469-124133491 CTGGTCACACAGTTGGGGCAAGG + Intronic
938076854 2:128344339-128344361 CAGGTCACACAGCTAGAGAATGG - Intergenic
938112714 2:128579716-128579738 CAGGTTGGGCAGCTGGGCGATGG - Intergenic
938689447 2:133774142-133774164 CAGGCTAATCAGCTGGAGGAGGG - Intergenic
939099726 2:137881657-137881679 CAGATCCCACAGCTGCGGGAGGG + Intergenic
939125559 2:138173485-138173507 AAGGTTACAGAGCTAGGGAATGG + Intergenic
940201239 2:151153282-151153304 GAGGTTACCGTGCTGGGGGAAGG + Intergenic
940394126 2:153167712-153167734 TAGGTTACAGAGCAAGGGGAAGG + Intergenic
946059182 2:216927173-216927195 AAGGTTACACAGCTAGTGGGGGG + Intergenic
946568313 2:220992831-220992853 CATGTTAAACACCTGGTGGATGG - Intergenic
947430612 2:230024517-230024539 CAGGCTGCACAGGTAGGGGAAGG - Intergenic
947722939 2:232380341-232380363 CAGGGGGCACAGCAGGGGGAGGG + Intronic
948329506 2:237154016-237154038 AAGGTCACACAGCAGAGGGAAGG - Intergenic
948337420 2:237221448-237221470 CAGGTCACACAGCTGGTAGCGGG + Intergenic
948851899 2:240712369-240712391 CCGGTCACACCGCTGGTGGAAGG + Intergenic
1168956611 20:1838682-1838704 CAGGTCATAAAGCAGGGGGATGG - Intergenic
1168971157 20:1931723-1931745 CAGGTTGCAGGGCTGGTGGAGGG + Intronic
1169602355 20:7276103-7276125 CAGGTCACACAGCTGTGAGAAGG - Intergenic
1169788949 20:9389304-9389326 CTGGTTACAAGGCCGGGGGAAGG - Intronic
1169876433 20:10302392-10302414 CAGGTCACAGAGCTGGTGAATGG - Intronic
1170621974 20:18004034-18004056 AAGGTTACACAGCTAGGAGGTGG - Intronic
1171070414 20:22062766-22062788 CAGCTTGCCCAGCTGGGGCAAGG - Intergenic
1171736642 20:28793852-28793874 TAGGTTCCACATCTGGGGGCAGG - Intergenic
1172489717 20:35326065-35326087 CAGATCACAAAGTTGGGGGAAGG + Intronic
1172636649 20:36414562-36414584 AAGGTCACACAGCAGGTGGAGGG - Intronic
1173581811 20:44152263-44152285 CAGGTTGCACAGCTGAGTCATGG - Intronic
1174389313 20:50208092-50208114 GAGGTCACACAGCTGGTGGGTGG + Intergenic
1174452305 20:50627959-50627981 CAGGGCACACAGCTGGGAGAGGG + Intronic
1174631453 20:51961989-51962011 CTGGTTACACAACTGTGGGGAGG - Intergenic
1174819564 20:53714718-53714740 CAGGTCACACAGCTAGGCAACGG - Intergenic
1175788777 20:61728543-61728565 GAGGTTCCACCGCTGGGGCATGG - Intronic
1176309710 21:5143037-5143059 CATGGCAGACAGCTGGGGGAGGG + Intronic
1176624509 21:9082043-9082065 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1178592727 21:33924975-33924997 CAAGTCACACAGCTGGTGAAGGG - Intergenic
1178723838 21:35034133-35034155 AAGGTCACACAGCTGGGAAATGG - Intronic
1178977340 21:37231378-37231400 CAGGCTACAGAGGTGGGAGACGG + Intronic
1179847348 21:44118996-44119018 CATGGCAGACAGCTGGGGGAGGG - Intronic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1180142801 21:45902446-45902468 CAGGTCACGCCGCTTGGGGATGG + Intronic
1180713223 22:17854205-17854227 CTGTTGACACAGCTTGGGGAGGG + Intronic
1180815516 22:18787081-18787103 GAGGTCACACAGCTGGGAGGTGG - Intergenic
1181201706 22:21221416-21221438 GAGGTCACACAGCTGGGAGGTGG - Intronic
1181625806 22:24121373-24121395 CAGGTGACACAGGTCTGGGAGGG + Intronic
1181700051 22:24615555-24615577 GAGGTCACACAGCTGGGAGGTGG + Intronic
1181939014 22:26461198-26461220 CCGGTTTCCCAGTTGGGGGAAGG + Intronic
1182105542 22:27686503-27686525 GAGGTTACTCAGCTGGGAGGAGG - Intergenic
1182366808 22:29784625-29784647 CAGGGGACCCACCTGGGGGAAGG - Intergenic
1183014116 22:34971915-34971937 CAGGTCACACAGCTGGCTCATGG - Intergenic
1183020055 22:35019554-35019576 CAGGTCACACAGCAGGGCCAGGG + Intergenic
1183086863 22:35491910-35491932 CAGGGGACACATCTGGGGCAGGG - Intergenic
1183086956 22:35492267-35492289 CAGGGAACACACCTGGGGTAGGG - Intergenic
1183086966 22:35492303-35492325 CAGGGAGCACACCTGGGGGAGGG - Intergenic
1183341917 22:37286298-37286320 AAGGTGACACAGCTGGAGGGTGG - Intronic
1183354922 22:37353107-37353129 CAAGGTACGCAGCTGGGGGCAGG - Intergenic
1183695916 22:39422083-39422105 CTGGGTTCAAAGCTGGGGGAAGG + Intronic
1184474321 22:44712344-44712366 CAGGTTCCACAGCTGGTGCTTGG - Intronic
1184743448 22:46442492-46442514 CAGGAGCCACAGCTGGGGGCAGG - Intronic
1184799615 22:46751693-46751715 CTGGCAACAGAGCTGGGGGAAGG + Intergenic
1184899496 22:47435916-47435938 CAGGGTACGCAGCTGAGGGTTGG + Intergenic
1185246510 22:49775932-49775954 GAGGTTCCACAGCTGGCGGGGGG - Intronic
1203225208 22_KI270731v1_random:74012-74034 GAGGTCACACAGCTGGGAGGTGG + Intergenic
1203265619 22_KI270734v1_random:12772-12794 GAGGTCACACAGCTGGGAGGTGG - Intergenic
950143729 3:10633126-10633148 AAGGTCACACAGCTGGGAGGTGG - Intronic
950153554 3:10706915-10706937 AAGGTCACACAGCAGGGGGCAGG - Intronic
952314547 3:32221234-32221256 GAGGTTGCACAGCTGGTGGATGG - Intergenic
952314613 3:32221800-32221822 GAGGTTGCACAGCTGGCGGATGG + Intergenic
953743907 3:45558477-45558499 CAGGTTATCCAGCTGTGGGGAGG - Intronic
954643772 3:52118167-52118189 CATGCTACAAGGCTGGGGGAAGG - Intronic
954922121 3:54200227-54200249 CTGGTTACACAGCTAGTGGGTGG + Intronic
955795963 3:62637245-62637267 AAGGTTACCCAGCTGGTGAACGG + Intronic
956278550 3:67530198-67530220 AATGTCACACAGCTGGGTGAGGG - Intronic
956611266 3:71125883-71125905 CAGGTCACACAGCTAGCGAATGG - Intronic
957425667 3:80036023-80036045 CAGGTTAAAAGGCTGGGAGATGG + Intergenic
959100575 3:102004742-102004764 CAGGATACAGAGCTTGGGTATGG + Intergenic
959705993 3:109339311-109339333 CAGGTCACACAGCTAGTGAAGGG - Intergenic
960283536 3:115801635-115801657 CAAGTTAGGCGGCTGGGGGATGG - Intergenic
960294942 3:115931372-115931394 CAGGTCACTCAGCTGGGGGCAGG - Intronic
961035853 3:123641126-123641148 AGGATTACACAGCTGGGGTAAGG - Intronic
961366535 3:126403072-126403094 CAGGTTTCGCAGGAGGGGGAAGG + Intronic
961454631 3:127017929-127017951 CAGGGTCCACAGGTGGGGCATGG - Intronic
961682934 3:128611041-128611063 CAGGGTCCACAGCTGGGTGTGGG - Intergenic
962317596 3:134368493-134368515 AAGGTTAAACAGCTGGAGCAGGG - Intronic
962638926 3:137362362-137362384 CATGTGACACTGCTGGGGGATGG + Intergenic
962851527 3:139311755-139311777 GAGGTCACACAGCTGGGAAATGG + Intronic
963806660 3:149729337-149729359 CTGGTGACTCAGCTGGGGGCAGG + Intronic
965817106 3:172648106-172648128 CAGGTTACTCTGCAGGGCGAGGG + Exonic
966329552 3:178795251-178795273 CAGGTGACGCAACTGGGGCAGGG + Intronic
969578179 4:8048521-8048543 CAGGTCACACAGCTGGGAGGAGG + Intronic
969602722 4:8186519-8186541 CAGGTTACGCAGGTGTGAGATGG + Intronic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
969629810 4:8329567-8329589 AAGGTCTCACAGCTGGAGGAGGG - Intergenic
969674674 4:8608150-8608172 CAGGATCCGCAGCTGGGGGCTGG - Intronic
969709817 4:8836269-8836291 CAGGAAACACAGGTGGGGAATGG - Intergenic
971052402 4:22876003-22876025 AAAGTGACACAGCTGGTGGATGG + Intergenic
971123860 4:23731111-23731133 GAGTTTACACAGCTGGGAAATGG - Intergenic
971954240 4:33395599-33395621 CACATGACACTGCTGGGGGATGG - Intergenic
973069194 4:45835927-45835949 CAGACTCCACAGCTGGGGGAAGG - Intergenic
973933931 4:55822687-55822709 CAGATTTCACAGCTGGTGGGTGG - Intergenic
974925018 4:68287280-68287302 CAGGTTACCAGGCTGGGGGATGG - Intergenic
975987365 4:80213796-80213818 AAGGTTACACAGCTGGAGAATGG - Intergenic
977332013 4:95648329-95648351 CAGGCTATACAGCTGGGAAATGG - Intergenic
980326441 4:131352934-131352956 TAGGCTCCACATCTGGGGGAAGG + Intergenic
981073197 4:140566954-140566976 AAGGTCACACAGCTGGGAGGGGG - Intronic
982409759 4:155061359-155061381 CAGGTGAGAGAGTTGGGGGAAGG + Intergenic
982842255 4:160204836-160204858 AAGGTTACATAGCTGGGAGGTGG + Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983503716 4:168529380-168529402 CAGGTTACATGACTGAGGGAGGG - Intronic
984182347 4:176499153-176499175 AAGGTTACACAGCTGGTGAGTGG - Intergenic
984287750 4:177755206-177755228 GAGGTGACACAGCTGGCGGGTGG + Intronic
985495783 5:204281-204303 CAGGTCACGCACCTGGGGGCTGG + Exonic
985812462 5:2099704-2099726 CAAGTCACAAAGCTGGGGGATGG + Intergenic
986041871 5:4001376-4001398 CAGGGAGTACAGCTGGGGGAAGG + Intergenic
986098510 5:4584077-4584099 AAGCTTCCACAGCTGGGAGATGG + Intergenic
988197725 5:28027457-28027479 CACGCTTCACAGCTTGGGGATGG - Intergenic
989195601 5:38713445-38713467 GAGGATGCACAGCTGGGTGACGG + Intergenic
992418055 5:76572018-76572040 CAGGGAACAGGGCTGGGGGAGGG - Intronic
992566425 5:77999454-77999476 GAGGTTAGAAAGCAGGGGGACGG + Intergenic
993143279 5:84061581-84061603 AAGGCTACACAGCTGGGAAATGG - Intronic
996414185 5:123191881-123191903 CAGGTTAAACATCTGTGGCAAGG - Exonic
996749064 5:126871126-126871148 GAGGTCACACAGCTGGGCGAGGG - Intronic
997472568 5:134124962-134124984 GAGGTCACACAGCAGGGGGAGGG - Intronic
998445304 5:142193879-142193901 CAGGTCACAAAGTTGGGGCATGG + Intergenic
999092745 5:148951938-148951960 CAGGTTACCCAGCTGGTGGGTGG - Intronic
999172698 5:149608739-149608761 CAGGTTACACAACTGGGGAAGGG + Intronic
1000162855 5:158617154-158617176 AAGGTCACACAGCTGGGAAATGG - Intergenic
1000367118 5:160502023-160502045 CAGGGTACACTGCTTGGTGATGG - Intergenic
1001260554 5:170224943-170224965 CAGATTACTCAGCTGGGAAATGG - Intergenic
1001279905 5:170379195-170379217 CAGGCTACACACCTGGGCGCAGG + Intronic
1001283549 5:170405846-170405868 CTGGTAACACAGCTGTGGAAAGG - Intronic
1001653305 5:173329909-173329931 CATGTGACACGGCTGGGGGAGGG + Intergenic
1001843153 5:174897738-174897760 CAGGTTATACAGCTGGGAGAGGG - Intergenic
1001963772 5:175896028-175896050 CAGGCTCCTGAGCTGGGGGAGGG - Intergenic
1002181415 5:177432924-177432946 CAGGTCACACAGCAGGGGCAAGG - Intronic
1004460409 6:15829857-15829879 CAGGTCACACAGCTAGGGACTGG - Intergenic
1004467036 6:15895551-15895573 AAGGTTACACAGCTGAGGTCTGG + Intergenic
1004636186 6:17470242-17470264 CAAGTTACCCACTTGGGGGAAGG + Intronic
1004947367 6:20630360-20630382 CAGGTGGCTGAGCTGGGGGAAGG - Intronic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1006381177 6:33698195-33698217 CAGGTTGCACAGCTGGGAAGTGG + Intronic
1007143005 6:39595355-39595377 AAGATTACCCAGCTAGGGGAGGG - Intronic
1007147982 6:39656581-39656603 CAGGTTAAACAGCTAGAGAAAGG - Intronic
1007255879 6:40528380-40528402 CATGTTAAAGAGCTGGGAGAAGG - Intronic
1008359099 6:50593564-50593586 CAGGTTTCAAGGCTGGAGGAAGG + Intergenic
1012508503 6:99976031-99976053 CAGCTTATACAACTAGGGGAAGG + Intronic
1013073756 6:106752375-106752397 CAGGAGACACAGCAGAGGGATGG - Intergenic
1013267299 6:108512410-108512432 GAGGACACAGAGCTGGGGGATGG + Intronic
1013721964 6:113040949-113040971 TTGGTTACACAGCTGTGGGGTGG - Intergenic
1013900124 6:115145371-115145393 TAGGTCACACAGCTGGTGAATGG - Intergenic
1014538280 6:122643275-122643297 CAGGTTACATAGCTGGTTAATGG - Intronic
1015657674 6:135538145-135538167 GAGGTAAGACAGCTGGGGGTGGG - Intergenic
1017153666 6:151303955-151303977 CAGGTCACACAGCTCAGGAATGG - Intronic
1017615058 6:156237702-156237724 GAGGGTACAGAGTTGGGGGAGGG + Intergenic
1017858056 6:158368712-158368734 CAGGGTATACAGCCTGGGGATGG + Intronic
1018114998 6:160574358-160574380 CAGACTTCACAGGTGGGGGAAGG - Intronic
1018430235 6:163716399-163716421 CAGGTCACAGAGCTGGTGAATGG + Intergenic
1019497583 7:1347657-1347679 CAGGTTACACAGCAGGGTGCAGG - Intergenic
1019528082 7:1489749-1489771 CAGGTGGCAAAGCTGGGGCAGGG + Intronic
1020264832 7:6553409-6553431 AAGGTCACCCAGCTGGGGAATGG + Intergenic
1022188755 7:27996584-27996606 CAAGTTCTATAGCTGGGGGAAGG - Intronic
1022888371 7:34669794-34669816 AAGGTTACATAGCTGGTAGATGG + Intronic
1023254004 7:38294951-38294973 CAGGTCACACAGCTGGTTCATGG - Intergenic
1023588142 7:41752176-41752198 CAGGGCACACAGCTGGGGGTGGG - Intergenic
1024322156 7:48082072-48082094 CAGGTTACATAGCTGGTTAATGG + Intergenic
1025738082 7:64171873-64171895 CTGGTTACATATCTTGGGGAAGG + Intronic
1026889302 7:73972886-73972908 CAGAATACACAGCTAGGAGACGG - Intergenic
1027232351 7:76280367-76280389 CACGGCACACAGATGGGGGAGGG - Intronic
1032251940 7:130265126-130265148 CATGATACACAGCTGGGTTAAGG - Intergenic
1032467463 7:132155260-132155282 CAGGTTACACAGCAGGGAGGTGG - Intronic
1032487864 7:132301510-132301532 AAGGTCACACATCTGGCGGATGG + Intronic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1032779463 7:135152192-135152214 AAGGTCACACAGCTGGTGAATGG + Intronic
1033026862 7:137782563-137782585 CAGGTTTCTCAGGTGGTGGACGG - Intronic
1033314662 7:140287578-140287600 AAGGTCACACAGTTGGGGGTGGG - Intergenic
1034265877 7:149780454-149780476 GGGGTTACACAGCTGGCGCACGG - Intergenic
1035167358 7:156999835-156999857 CGGTTTACCCAGCTGGGGGCAGG - Intronic
1035651981 8:1273393-1273415 CAGGTCACACAGCTGGCTTATGG + Intergenic
1036206983 8:6812762-6812784 TGGGTTACAAAGCTGGGGGAAGG + Intronic
1036690118 8:10939929-10939951 CAGGGGACACACCTGGGGGAGGG - Intronic
1037806403 8:22060017-22060039 AGGGACACACAGCTGGGGGAGGG + Intronic
1038779211 8:30556504-30556526 CAGGAGACACAGGAGGGGGAGGG - Intronic
1039859977 8:41448659-41448681 CCGGTCACACAGCTAGTGGATGG - Intergenic
1039967321 8:42292808-42292830 CAGCTCACACAGCTGTGAGAGGG - Intronic
1041102960 8:54415146-54415168 CAGACAACACAGCTGGAGGAGGG - Intergenic
1041748771 8:61236821-61236843 CAGGTCACAGAGCTGGCGCAGGG + Intronic
1042452687 8:68967216-68967238 CAGGTAACACAGCTAGGGCCAGG + Intergenic
1043270331 8:78325205-78325227 CAGTTCACACAGCTGGGGGCTGG - Intergenic
1044523589 8:93226695-93226717 CAAGATTCACAGCAGGGGGAAGG + Intergenic
1045086087 8:98687466-98687488 CGGGTCACACAGCTGGAGGTGGG - Intronic
1046795998 8:118372692-118372714 AATGTCCCACAGCTGGGGGATGG + Intronic
1047294531 8:123559359-123559381 CAGGTTAAACAGCCGTGGTATGG + Intergenic
1047727469 8:127696392-127696414 CAGGCTACATGGCTGGGGAAGGG + Intergenic
1047739879 8:127797910-127797932 CAGGTCACACAGCTTGGGAGAGG + Intergenic
1047761378 8:127957157-127957179 CAGGTTGCACAGCTTGGGGATGG + Intergenic
1047761835 8:127960279-127960301 CAGGTCACACAGCTTGAGGGTGG + Intergenic
1048352747 8:133629297-133629319 CAGGTTACACAGCTGGGAAGGGG - Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049526544 8:143129745-143129767 CAGGCTTCAGGGCTGGGGGAAGG + Intergenic
1049676371 8:143891085-143891107 CTGGCTGCACAGCTGGGGGTCGG - Intergenic
1050076654 9:1872761-1872783 GAGGTGACACAGCTGTGGCAGGG - Intergenic
1051721085 9:20038202-20038224 AAGCTTACACAGCTGGGAAATGG - Intergenic
1052565426 9:30143846-30143868 CAGGTTAGACAGCAGGGATATGG + Intergenic
1053165189 9:35839517-35839539 CACGTTACACAGTTGAAGGAAGG + Intronic
1053281936 9:36826136-36826158 CATGTAGCACAGCTGGGGGTGGG - Intergenic
1056559644 9:87718973-87718995 CAGGTCACAGAGCAGGTGGAGGG - Intergenic
1056905707 9:90645858-90645880 CTGGATACCCAGCTGGGTGAGGG + Intergenic
1057644230 9:96858239-96858261 CAGGCAACACTCCTGGGGGAGGG - Intronic
1057955091 9:99401051-99401073 AAGTTGAAACAGCTGGGGGAGGG - Intergenic
1058705659 9:107636310-107636332 AAGGTAACACAGCTGGGTGCTGG - Intergenic
1058766696 9:108188903-108188925 CAGGTCACATAGCTGGGACATGG - Intergenic
1059463383 9:114449629-114449651 AAGGTGGCACAGCTGGGGGCGGG + Intronic
1059745465 9:117196146-117196168 AAGGTAACACAGCTGGAGTATGG - Intronic
1059842975 9:118239136-118239158 CAGTTTACACTGCTTGGGGTTGG + Intergenic
1060028101 9:120190183-120190205 CATGTTGGACAGCTGGGGGTGGG - Intergenic
1060400330 9:123344858-123344880 AAGGTCACACAGCTGGTAGAAGG - Intergenic
1060521309 9:124295559-124295581 CAGGTCACACAGCAGGCGGCAGG - Intronic
1060667264 9:125439344-125439366 CAGGTCACACAGCAGGTGGGAGG - Intronic
1060978540 9:127779374-127779396 CAGGTAACACAGCTGGTTGCTGG + Intergenic
1060996440 9:127877013-127877035 AAGGTCACACAGCTGAGTGATGG - Intronic
1061363034 9:130155812-130155834 CAGGTCACACAGCTGGTGACTGG - Intergenic
1061794060 9:133073800-133073822 CAGGCCACACAGCTGGGGAGCGG + Intronic
1062031751 9:134365022-134365044 CCGGTTGCCCAGCTGGGGGATGG + Intronic
1062210832 9:135362892-135362914 AAGGTTACCCAGCTGGTGGTTGG - Intergenic
1203747685 Un_GL000218v1:52475-52497 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1187359980 X:18616957-18616979 CAGGTTTGACAGCTAGGGAATGG - Intronic
1189761060 X:44322060-44322082 CTGGTGATACAGCTGGGGGTGGG - Intronic
1190871635 X:54429743-54429765 CTGGTTATACAGATGGGAGAAGG - Intergenic
1192748840 X:73966644-73966666 CAAGGTACACACCTGGGAGAGGG - Intergenic
1195243539 X:102976720-102976742 GAGTTTACACAGCTTGAGGATGG - Intergenic
1195491712 X:105478240-105478262 CTAGTTTCACAACTGGGGGAAGG + Intronic
1195573220 X:106420170-106420192 AAGGTCACACAACTGGTGGAAGG - Intergenic
1195574938 X:106439023-106439045 CAGATTCCACAGATTGGGGAGGG - Intergenic
1197838273 X:130718323-130718345 CAGGCTACAGAGCAGGGTGACGG + Intronic
1198596731 X:138244025-138244047 AAGCTGACACAGCTGGAGGAAGG - Intergenic
1199146850 X:144379115-144379137 GAGGCAACACAGCTGGGGGGAGG + Intergenic
1201161017 Y:11167460-11167482 CAGGTCAGACAGGTGGAGGAGGG + Intergenic