ID: 1089354680

View in Genome Browser
Species Human (GRCh38)
Location 11:117841922-117841944
Sequence CCTGCCTGGCAGGAGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 1, 2: 1, 3: 47, 4: 372}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089354680_1089354689 7 Left 1089354680 11:117841922-117841944 CCCTACCCCTCCTGCCAGGCAGG 0: 1
1: 1
2: 1
3: 47
4: 372
Right 1089354689 11:117841952-117841974 TCCCCCTGACCCCTGCACCCAGG 0: 1
1: 0
2: 4
3: 71
4: 548
1089354680_1089354691 8 Left 1089354680 11:117841922-117841944 CCCTACCCCTCCTGCCAGGCAGG 0: 1
1: 1
2: 1
3: 47
4: 372
Right 1089354691 11:117841953-117841975 CCCCCTGACCCCTGCACCCAGGG 0: 1
1: 0
2: 4
3: 49
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089354680 Original CRISPR CCTGCCTGGCAGGAGGGGTA GGG (reversed) Intronic
900167044 1:1247972-1247994 CCTGCCTGTGAGGAGGGGTCTGG - Intergenic
900311077 1:2033400-2033422 CCTGCCTCGCTGGAGGGGAGGGG - Intergenic
900519831 1:3100163-3100185 CCTCCCTGGCTGGAGAGGTGGGG + Intronic
900570352 1:3355224-3355246 GAGGCCTGGCAGGAGGGGGAGGG + Intronic
900673582 1:3870427-3870449 TCTGCCTGGCAGGAGCAGCAAGG - Intronic
901001873 1:6152946-6152968 CCTGGCTGGCAGGTGGGAAAAGG - Intronic
901216531 1:7558400-7558422 CCTGGATGGCTGGAGGGGCACGG - Intronic
901638493 1:10681357-10681379 GCTGGCTGGCAGGTGGAGTAGGG - Intronic
901810491 1:11764533-11764555 CCTGCCTGGGAGGGGGGCTCTGG - Intronic
903192199 1:21663108-21663130 CCTCCCTGGCTGGAGAGGTGTGG - Intronic
903234756 1:21942617-21942639 CCAGCCTGGCTGGAGGGGAGGGG - Intergenic
903281425 1:22252277-22252299 CCTGCCTGGCACAGTGGGTAAGG + Intergenic
903604850 1:24568063-24568085 CCTGCCTGGAAGGATGTGAACGG - Intronic
903910827 1:26723605-26723627 CCTTCCTGGCAGGGGCGGTGTGG + Intronic
904498257 1:30899708-30899730 CCTGTCAGGGAGGAGGGGTAGGG + Intronic
904688488 1:32276508-32276530 ACTGCCTGGGAAGAGGGGAACGG + Intronic
905828837 1:41048021-41048043 CCTGCTAGGGAGGAGGGGCAGGG + Intronic
906480616 1:46197080-46197102 CCTGTCTGAGGGGAGGGGTAGGG + Exonic
906955061 1:50367211-50367233 CCTGCCTGGAAGGAGGTGCTAGG + Intergenic
907401790 1:54228967-54228989 CCTGCCTGGCAGCTGGGCCAGGG + Intronic
907621860 1:55989646-55989668 CCTGCCTGGCAGGTGAAGCATGG - Intergenic
907722329 1:56983657-56983679 CCTCCCTAGCAGGTGGGGTTTGG - Intergenic
907931398 1:59004238-59004260 CCTGCCTGCCAGGAAGGGAGAGG - Intergenic
908392902 1:63699439-63699461 CCTGCCTGGCAGGAGTTCTCAGG + Intergenic
909532868 1:76700553-76700575 CTGGCTTGGCAGGAAGGGTAGGG - Intergenic
910144980 1:84069123-84069145 CCATTCTTGCAGGAGGGGTAAGG + Intergenic
910247063 1:85150061-85150083 CCTCCCTGGGAGGTGGAGTAAGG - Intergenic
910333312 1:86100709-86100731 CCTCCCTGGCAGAGGGGGTAGGG - Intronic
912380653 1:109246447-109246469 CCTGCTGGGAAGGAGGGGTGGGG - Intergenic
913227142 1:116710318-116710340 CCTGCCTTGCAGGTGGGGAGAGG - Intergenic
918204599 1:182297827-182297849 TCAGCCTGGCAGTAGGGGGAAGG - Intergenic
919843828 1:201628612-201628634 GCAGCTTGGCAGGAGGGGGAGGG - Intronic
920069136 1:203289946-203289968 TCTGCCTGGCAGGAGGCCTCTGG + Intergenic
920418161 1:205812622-205812644 CCCGCCTGGGAGGAGGGGATAGG - Intronic
921671169 1:217925330-217925352 CCTGGGAGGCAGGAGGGCTATGG - Intergenic
921808399 1:219481697-219481719 CCTACCTGGAAGAAGGGGGAAGG - Intergenic
922727377 1:227928697-227928719 CCTGCCTGTCAGGAGGGTCTGGG - Intronic
923041933 1:230325783-230325805 CCAGCCTGGCAGAAGGGGGAGGG - Intronic
1062954027 10:1528628-1528650 CCAGCATGACAGGAGGGGTGTGG - Intronic
1063168604 10:3486150-3486172 TCCTCCTGGCAGGTGGGGTAGGG - Intergenic
1064222676 10:13455342-13455364 CTGGCCAGGCAGGAGGGGTGGGG + Intronic
1065235452 10:23646832-23646854 CCTGCCTAGCAACAGGGGAATGG - Intergenic
1066086829 10:31979326-31979348 CCCGCCTGGCAGGAGGGAGGTGG - Intergenic
1066416483 10:35226384-35226406 GCTGCCTTGCAGCAGGGGGAAGG + Intergenic
1069809647 10:71148860-71148882 GCTGCCTGGGTGTAGGGGTAAGG - Intergenic
1069877144 10:71570098-71570120 CTTGCCTGGCTGCAGGGGGATGG + Intronic
1070313684 10:75292098-75292120 ACTCCCTGGCATGAGGGGTGAGG + Intergenic
1072536811 10:96370408-96370430 CGTGCCTGGCAGGAGAGGCCAGG + Intronic
1072712105 10:97722594-97722616 CATGCCTGGCAGGAGGTCTGTGG + Intergenic
1073139723 10:101239059-101239081 CCAGCCTGGGAGGAGGGGTTTGG + Intergenic
1073321671 10:102619674-102619696 ACTGCCTGGCAGGGGGAGGAGGG - Intronic
1073452866 10:103619886-103619908 CCTGCCAGGGAGGAGGGCTCTGG - Intronic
1074079764 10:110158213-110158235 CCTGACTGGCAGAAGGCATAGGG + Intergenic
1074884789 10:117685163-117685185 CCTGCCTGCCAGGCTGGGGAGGG + Intergenic
1074921525 10:118019343-118019365 CCTGGCTGGCAGGAGGGAAGAGG + Intronic
1075263781 10:120984027-120984049 AGGGCCTGGCAGGAGGGGGAGGG - Intergenic
1075674392 10:124286344-124286366 CCTGCCCTGCAGGAAGGGAACGG + Intergenic
1075973598 10:126675385-126675407 CCTTCATGGGAGAAGGGGTATGG + Intergenic
1076251624 10:128988686-128988708 CCTTCCTGTCAGGAGATGTAAGG + Intergenic
1077295735 11:1825495-1825517 CCTGCCTGGCCGGTGGGCTAGGG - Intergenic
1077536445 11:3127023-3127045 CCACCCTGGCAGGCTGGGTAAGG + Intronic
1077579275 11:3406477-3406499 CCTGCTGGGCAAGAGGGGTGCGG - Intergenic
1078463608 11:11533900-11533922 CCTGCCTGGCAGATGGAGTAGGG + Intronic
1078840161 11:15070822-15070844 CCAGCCTGGCAGGAGAGGAAAGG - Intronic
1080027970 11:27632986-27633008 ATTGCCGGGCAGGAGGGGGAAGG + Intergenic
1080316465 11:30955712-30955734 CCTACCTGGCAGGGAGGTTACGG - Intronic
1082990697 11:59205189-59205211 CCTACTTGGGAGGTGGGGTAGGG - Exonic
1083276061 11:61597774-61597796 CCTCACTGGCTGGAGGGGAACGG - Intergenic
1083540180 11:63506872-63506894 CCAGCCTGGAAGGAAGGGTCAGG + Intronic
1083966477 11:66046842-66046864 CCTGGGTCCCAGGAGGGGTAAGG + Intronic
1083990729 11:66244325-66244347 CCTGGCTGGGAGGATGGGTCTGG - Exonic
1084129351 11:67120716-67120738 ACGGCCTTACAGGAGGGGTATGG + Intronic
1084412627 11:69013282-69013304 CTGGCCCGGCAGGAGGGGGAGGG + Exonic
1087187826 11:95220399-95220421 ACTGGTTGGCAGGAGGGGGAGGG + Intronic
1088653682 11:111979042-111979064 CCAAACAGGCAGGAGGGGTAGGG - Intronic
1089270752 11:117300039-117300061 CCTGCCTCGCAGGAGAGGAAGGG - Intronic
1089354680 11:117841922-117841944 CCTGCCTGGCAGGAGGGGTAGGG - Intronic
1090235950 11:125147207-125147229 CCTGCCTGGCAGGGGAGGGAGGG - Intergenic
1090625357 11:128603601-128603623 CTGGCCTGGCAGGAGGAGAATGG - Intergenic
1090965381 11:131593412-131593434 CCTGCCTGACACGATGGGTTGGG - Intronic
1092247215 12:6870398-6870420 CTGGCTTGGCAGGAAGGGTAGGG - Exonic
1092954544 12:13537701-13537723 CCTGGGTGGCTGGAGGGGTTAGG - Exonic
1093117955 12:15234533-15234555 CATGGCTGGCAGGATGGGAAAGG - Intronic
1095160143 12:38905833-38905855 CCCTCCTGGCTGGAGGGGTCAGG + Intronic
1096075987 12:48805120-48805142 CCTGTTTGCCAGGATGGGTATGG - Intergenic
1097054741 12:56242755-56242777 TCTGCCTGGCAGTAGGGGCAGGG + Exonic
1097803863 12:63944404-63944426 CTTGCATGGCAGAAGGGGTGAGG + Intronic
1100760083 12:97797588-97797610 GGTGCCTGGCAGAAGGGGAATGG + Intergenic
1102031164 12:109740988-109741010 CCTGGCTGGAAGGAGGGCCAGGG + Intronic
1103378415 12:120474813-120474835 CCCGCCTGGCAGGAGAGCTATGG + Intronic
1103520215 12:121533027-121533049 CCTGCCTGGCGGAAGGGGAGGGG + Intronic
1103906094 12:124327891-124327913 ACTGCCAGGGAGGTGGGGTAGGG + Intronic
1105441933 13:20422514-20422536 CCAGCCTGGCTGGAGGTGCAAGG - Intronic
1105712545 13:23026457-23026479 CCTGCATGGCAGGAGCAGGAGGG - Intergenic
1106407178 13:29484299-29484321 CCTGCTCTGCAGGAGGGCTAAGG - Intronic
1106582816 13:31032373-31032395 ACTGCCTGGCAGAGGGGGCAGGG - Intergenic
1108629414 13:52267012-52267034 CCTGTCAGGAAGGAGGGGTTGGG - Intergenic
1108656641 13:52539476-52539498 CCTGTCAGGAAGGAGGGGTTGGG + Intergenic
1109023305 13:57127800-57127822 GTTGGTTGGCAGGAGGGGTAGGG + Intergenic
1109529719 13:63625918-63625940 CCTGCCTGGCAGTATGGGCAGGG + Intergenic
1112321253 13:98409758-98409780 AGTGGCTGGCAGGAGGGGGAAGG - Intronic
1113637121 13:111927274-111927296 CCTGCCTGCCTGCAGAGGTACGG - Intergenic
1113776771 13:112952316-112952338 CCTGGCTGGAGGGAGGGGTGGGG - Intronic
1113799953 13:113081095-113081117 CCTGCCCAGCAGGAGGGGACTGG - Intronic
1115745960 14:36437824-36437846 CCTGGCTGGCAACAGGGGTCAGG - Intergenic
1116425492 14:44785096-44785118 CTTGCATGGCAGAAGGGGCAAGG - Intergenic
1117069002 14:52039598-52039620 GCAGCCTGGCAGGAGATGTAGGG - Intronic
1119656509 14:76421105-76421127 CCAGGCTGGGAGGAGGGGCAAGG - Intronic
1121011108 14:90520770-90520792 CCAGCCTGGCAGGTGGGGAGGGG + Intergenic
1122272027 14:100572572-100572594 CCTCCCCTCCAGGAGGGGTAAGG - Intronic
1122690694 14:103530907-103530929 CCTCCCGGGCAGGAGAGCTAGGG + Intronic
1122894591 14:104750245-104750267 CCTGCACGGCAGGAGGAGAAAGG + Intergenic
1123033657 14:105463023-105463045 CCTGCCTGCCAGCAGGGGCCTGG + Intronic
1123584166 15:21742304-21742326 CCTCCCTGCCAGGAGGCGGAGGG - Intergenic
1123620816 15:22184907-22184929 CCTCCCTGCCAGGAGGCGGAGGG - Intergenic
1124249291 15:28096759-28096781 CCAGCCTGGGAGGAGGGGCGGGG + Intronic
1124259410 15:28175317-28175339 CCTGCTTTGCAGCAGGGGTTGGG - Intronic
1124340723 15:28887662-28887684 TCTGCCAGGCAGGAGGGCCAGGG + Intronic
1127267942 15:57376420-57376442 CCCTCCTGGGAGGAGGGGCAGGG - Intronic
1128096331 15:64959177-64959199 CCTGAGGGGCAGGAGGGGGAGGG + Intergenic
1128391860 15:67187651-67187673 CCTGGCAGGCAGGAGGGGCCGGG + Intronic
1128546090 15:68568821-68568843 CCTGCCAGCCAGGAAGGGGAAGG + Intergenic
1128618786 15:69131563-69131585 TCTGCCTGGCAGGAGGACTGTGG - Intergenic
1129235200 15:74219595-74219617 CATGCCTGGCAGGAGAGTTCTGG + Intergenic
1129708795 15:77809683-77809705 CCTGCCTGGCAGGGGGGTGAAGG + Intronic
1129709077 15:77811106-77811128 CTGGCCTGGCAGGAGGGGTTGGG - Intronic
1130229993 15:82089426-82089448 CCTGCCAGGAAGGAAGGGAAAGG + Intergenic
1130270816 15:82445912-82445934 CTTGCGTGGGAGGAGGGGGAGGG + Intergenic
1130463156 15:84173235-84173257 CTTGCGTGGGAGGAGGGGGAGGG + Intronic
1130489518 15:84421553-84421575 CTTGCGTGGGAGGAGGGGGAGGG - Intergenic
1130501109 15:84500315-84500337 CTTGCGTGGGAGGAGGGGGAGGG - Intergenic
1130540531 15:84817958-84817980 CCTCCCTGGCAGGAAGGGAGGGG + Intronic
1131714794 15:95096691-95096713 TCTGCCAGGCAGAAGGGGAATGG - Intergenic
1132080088 15:98856212-98856234 CCTGCCTCCAAGGAGGGGCATGG - Intronic
1132258645 15:100401472-100401494 GCTCCCTGGGAGGAGGGATAGGG - Exonic
1132701840 16:1225327-1225349 CCTGCCTGACAGCAGGTGTGTGG - Intergenic
1132814449 16:1819048-1819070 CCTGCCTGGCAGGAGACACAGGG + Intronic
1132931239 16:2460177-2460199 CCTGCGCGGCAGGAGGGGGTGGG + Intronic
1132997464 16:2830595-2830617 CCTGTCTGCCTGGAGGGGTGGGG + Intronic
1137758919 16:50924967-50924989 CCAGCCTGGCAGGTGGGGAGTGG - Intergenic
1138186842 16:54983539-54983561 CCTGACTGGCAGGAGGGAAGGGG - Intergenic
1138417191 16:56878175-56878197 CCAGCCAGTCAGGAGGGGGAGGG + Intronic
1138455306 16:57117439-57117461 CCTGCCTGGCAGGAGGCTGGGGG + Intronic
1138521734 16:57575120-57575142 GCTACCTGGCAGGGGGTGTATGG + Intronic
1139634325 16:68248755-68248777 TCTGCCTGGGAGGAGGGGCTTGG - Intronic
1140262000 16:73388580-73388602 CCTGCCTGGCAGGTTGGCTTAGG - Intergenic
1141689658 16:85589019-85589041 CCTGCATGCCAGGAGGGCCATGG + Intergenic
1141842316 16:86580999-86581021 CCTGCCTGGCAGGGCTGGGAGGG - Exonic
1141978814 16:87536659-87536681 TCTGCCTGGCAGAAAAGGTAGGG + Intergenic
1142302114 16:89264976-89264998 TGAGCCTGGCAGGAGGGGAAGGG - Intergenic
1142472143 17:170474-170496 CCAGGCTGGGAGGAGGGGCAGGG + Intronic
1142560253 17:805295-805317 CCTGCCTGGCAGGAGGCTCGCGG + Intronic
1142716340 17:1748901-1748923 CCTACCTGGCAGGAGGACTGAGG + Intronic
1142755009 17:2011308-2011330 CTTGTCAGCCAGGAGGGGTATGG - Intronic
1143096276 17:4480216-4480238 CCTGTCTGGAGGGAGGGGCAGGG - Intronic
1143135887 17:4711991-4712013 CCAGCCTGGCAGGAGGTGGCTGG + Intronic
1143874513 17:9981642-9981664 CCTGCTTGGCAGCAGGCCTAAGG + Intronic
1144584125 17:16477711-16477733 TCTGCCTGGCTGCAGGGGTCTGG - Intronic
1144756642 17:17683528-17683550 CTTGCCTGTCAAGAGGGGGAGGG - Intronic
1145184260 17:20780600-20780622 CCTGCCTGACCGGAAGGGTTGGG - Intergenic
1146271917 17:31490208-31490230 CCTGCCTACCAGGAGGGGAAGGG - Intronic
1147164659 17:38586881-38586903 CCTGCCTAGGAGGAGCGGTGAGG + Intronic
1147165625 17:38591699-38591721 CCTTCCAGGCAGGAGGAGTCAGG - Intronic
1147705510 17:42422552-42422574 CCTGCCTGGGAGTTGGGGTGGGG - Intronic
1148053204 17:44779360-44779382 ACAGCCTGGCAGCAGGGGTGGGG - Intronic
1148716882 17:49722291-49722313 CCTGCCTAGCAGGAGGGTCTGGG + Intronic
1150159633 17:62884986-62885008 CCAGCATGGCAGAAGGGGAAGGG - Intergenic
1150587958 17:66535483-66535505 CCTGTTTGGCAGCAGGGGTGGGG - Intronic
1150773625 17:68061955-68061977 GATGCCTGGTAGGGGGGGTACGG - Intergenic
1151480765 17:74369015-74369037 CGTGCCAGGTAGGAGTGGTAAGG - Intronic
1151598661 17:75093369-75093391 CCAGCCTGGCAGGAGGTGGCAGG - Intronic
1151658353 17:75506227-75506249 CCTGACTGGCTGGGGAGGTACGG - Intronic
1151949596 17:77343230-77343252 CTTGCCTCGCAGGAGGTGGATGG - Intronic
1152250507 17:79210143-79210165 CCTGCCTGGGGGGAGGGATATGG + Intronic
1152437183 17:80283597-80283619 CCTGCCTTGCAGGAGGGGAGTGG - Intronic
1152640100 17:81445726-81445748 CCTGCCGGGCAGGGGTGGGAGGG - Intronic
1152690460 17:81715597-81715619 GCTGCCGGGCGGGAGGGGGAGGG + Intronic
1152805149 17:82352178-82352200 CCTCCCTGCCAGGAGGCGTGTGG + Intergenic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1153695202 18:7633453-7633475 CCTGCCAGGAATGAGGGGAAGGG - Intronic
1154394191 18:13971914-13971936 GCTGAATGGCAGGAGGGGAATGG - Intergenic
1155473474 18:26214641-26214663 CTTGCCTGGCAGGAGGAGCATGG + Intergenic
1155504946 18:26524180-26524202 CCTGCTTTCCAGCAGGGGTAGGG + Intronic
1156209239 18:34920693-34920715 CCTGCCTGTCAGATGTGGTAGGG + Intergenic
1156351585 18:36306602-36306624 CCTGAATGGCAAGAGGGCTAAGG - Intronic
1157202130 18:45668331-45668353 CCGACCTGGCAGGAGAGGGAGGG - Exonic
1157624987 18:49044013-49044035 GCTGCTTGGCTGGAGGGGTCCGG + Exonic
1158559166 18:58499278-58499300 CCTTTCCAGCAGGAGGGGTAGGG + Intronic
1159388624 18:67759371-67759393 CCACCCAGGCAGGATGGGTAAGG - Intergenic
1160082786 18:75745222-75745244 CTTGCCTCGCAGGAGAGGTAAGG - Intergenic
1160149102 18:76385815-76385837 GCTGCCTGGGAGGAGGAGTGAGG - Intronic
1160594082 18:79962388-79962410 CCTGCCTGGCGTGGGGGGCAAGG - Intergenic
1160880290 19:1316556-1316578 CCTGCCTTGCAGGGGCAGTAGGG - Intergenic
1161114522 19:2489201-2489223 CCGCCCCGGCAGGAGGGGTTGGG + Intergenic
1161335034 19:3708484-3708506 CCTGCCTGGCACGGGTGGTGGGG - Intronic
1161364550 19:3870730-3870752 GCAGCCTGGAAGGAGGGGGAGGG + Intergenic
1161640745 19:5421174-5421196 CGGGCCTGGCTGGAGGGGTGGGG + Intergenic
1162456637 19:10788907-10788929 ACTGCCTGGCAGAGGGGGTGGGG - Intronic
1162723550 19:12676366-12676388 CCTGCCTTGCAGATGGGGCAGGG - Intronic
1162777694 19:12989906-12989928 ACAGGCTGGCAGGTGGGGTAGGG + Intergenic
1162782851 19:13015603-13015625 CTTGCCTGGCAGGCAGGGAATGG - Intronic
1163289647 19:16370922-16370944 CCTGCCAGCCAGGATGGGGAGGG - Intronic
1163472184 19:17504184-17504206 CCTGCCTGTCATGTGGGGAATGG + Intronic
1163798168 19:19349029-19349051 ACTGTCTGTGAGGAGGGGTATGG - Intronic
1164158036 19:22608222-22608244 CCTGCCCCGCAGGAGGGGGCTGG - Intergenic
1164515903 19:28934993-28935015 CCTTGCTGGCAGGAGGTCTAGGG + Intergenic
1164600865 19:29562485-29562507 CGTGCCTGTGAGGAGGGGTGTGG - Intronic
1166067409 19:40367897-40367919 CCTGGCCGGCAGCAGGGGCAGGG + Intronic
1166706876 19:44913001-44913023 TCAGCCTGGCAGTAGGGGGATGG - Intergenic
1167746546 19:51354308-51354330 TCTGCCCAGCAGGAGGGGAAGGG + Exonic
1167792984 19:51692296-51692318 CCTGCCTGGCCGGAGGGAGGAGG + Intergenic
1168138733 19:54370182-54370204 CCTCCCAGGCAGGAAGGGTGGGG - Intronic
1168159295 19:54498315-54498337 CCTCCCAGGCAGGAAGGGTGGGG + Intronic
1168181579 19:54665595-54665617 GCTTCCTGGCTGGAGGGGTCTGG + Intronic
1168236894 19:55069206-55069228 CCAGCCTGGCAGGAGGAGGAGGG - Intronic
1168314928 19:55480864-55480886 CCTGCCTGTCTGGAGAGGGAGGG + Intronic
925002477 2:416432-416454 GCTGCCTGGCAGGAGGAGTGAGG + Intergenic
925719958 2:6817493-6817515 CCTGGCTGGCAGGGAGGGTCTGG + Intergenic
925889779 2:8424238-8424260 CCGGCCTGGCGGGAGGTGTTTGG - Intergenic
925944594 2:8849366-8849388 CCAGCCAGGGAGGAGGGGTGGGG + Intergenic
926142466 2:10375945-10375967 CCAGCATTGCAGGAGGGGTCTGG + Intronic
927090190 2:19704779-19704801 ACTGCAAGGCAGGAGGGGAAAGG - Intergenic
927487467 2:23498461-23498483 CCTGCTTGGCAGGGAGGGCAGGG - Intronic
927889987 2:26742239-26742261 CCTGCCTGGCAGGGAGGCCAAGG + Intergenic
927972621 2:27315328-27315350 CATCCCTGGCTGGAGGGATAGGG - Intronic
930057932 2:47266158-47266180 CCAGCCTGTCAGGAGAGTTAAGG + Intergenic
931808013 2:65826782-65826804 CCTGGCTGGCAGGAGAGCTAAGG + Intergenic
932340688 2:70961127-70961149 CCGGCCAGCCAGGAGGGGTGAGG + Intronic
932404101 2:71502609-71502631 TCTGACTGACAGGAGGGGTGGGG - Intronic
932475625 2:72004002-72004024 CCTGCCTGGAAGGAGGGGTAAGG + Intergenic
932596626 2:73097671-73097693 CCTGTTTGGCAGGTGGGGTGGGG - Intronic
933794233 2:85906937-85906959 CCTGCCTGGAAGGTGGGGTGAGG + Intergenic
934953293 2:98593841-98593863 CTAGCCTTGCAGGAGGGGTGAGG - Intronic
935038790 2:99405385-99405407 CCTGCATGGAAGGAGGCGGAAGG - Intronic
938102338 2:128505616-128505638 CCTGCCTGGGCTGAGGCGTAAGG - Intergenic
938160819 2:128983119-128983141 CATGCCTGTCAGGAAGGGGAAGG + Intergenic
938238318 2:129723910-129723932 CCAGCCTTGCAGGAAGGGGATGG - Intergenic
938684744 2:133727364-133727386 CCAGCCTGGCAGGTGGGATTAGG - Intergenic
943226888 2:185188890-185188912 CCCTCCTGGCAGCAGGGGCATGG - Intergenic
943834734 2:192504972-192504994 CCTGCATCGTAGGAGGGGCAGGG - Intergenic
945079222 2:206072038-206072060 CCTGAGTGGCAGGAGAGGTGGGG - Intronic
947140044 2:227012256-227012278 GCTGGATGGCAGGAGGGGTGTGG - Exonic
947904021 2:233746606-233746628 CTTGCCTGAAAGGAGGGGTCAGG - Intronic
947905430 2:233758023-233758045 CTTGCCTGAAAGGAGGGGTCAGG - Intronic
1172358929 20:34298898-34298920 CCTGCCTGGCAGCCGAGGCAGGG - Intronic
1172421531 20:34822729-34822751 CATGCCTGGCAGTAGGAGTAGGG + Intronic
1173089325 20:39955310-39955332 CCTCCATGGCAGAAGGGCTAGGG + Intergenic
1173205559 20:40990633-40990655 TCTGCCTGGCAGGAGGGCTCGGG + Intergenic
1173438041 20:43050241-43050263 ACTGCCTGGAAGGAGGGCTGTGG + Intronic
1174575015 20:51531150-51531172 CCTGCCTGGCAGGAGATGTTTGG - Intronic
1175169796 20:57072198-57072220 CCTGCCTGGCAGTGGGAGAAGGG - Intergenic
1175779565 20:61673645-61673667 CCAGCCTGGCAGGCTGGGGAGGG + Intronic
1175888908 20:62307458-62307480 CCTGCGTGGCAGGAGCGATGAGG - Intronic
1175936514 20:62516713-62516735 GCTGGCTGGCACGAGGGGCAGGG + Intergenic
1176130573 20:63495126-63495148 CCTGCCAGGCAGGCGGGGCAGGG - Intronic
1176185868 20:63778608-63778630 CCAGCCTGGCAGGAGCGGGTGGG + Intronic
1179014822 21:37587485-37587507 CCTGCCTTGCAGGTTGGGTATGG + Intergenic
1179503398 21:41823896-41823918 CCAGCCTGGCATGATGGGTGTGG + Intronic
1179808539 21:43855320-43855342 CTTCCCAGGCAGGAGGGGTGTGG + Intergenic
1179982515 21:44903669-44903691 CCCGCCTGGCAGGAGAGCTGAGG + Intronic
1180921451 22:19523561-19523583 CGTGGCTGGCAGGAGGGGCCCGG + Exonic
1181496010 22:23287917-23287939 CCCAGCTGGCAGGAAGGGTAGGG + Intronic
1182276902 22:29195529-29195551 GCTGCCTGTCAGGAGGGAAAGGG + Intergenic
1182792696 22:32966216-32966238 CCTGCCTGGATGGAGGGGGAGGG + Intronic
1183780457 22:39995587-39995609 CCTGCCTGGGAGGTGGGGCCCGG - Intronic
1183985901 22:41570257-41570279 CCTTCCTGACTGGAGGGGGAGGG + Intronic
1184089012 22:42282779-42282801 CATGCCTGGGAGGAGGGGGCCGG + Intronic
1184478347 22:44733648-44733670 CCTCCCTGGCAGGATAGGTGAGG + Intronic
1184602804 22:45553376-45553398 CCTGCGTGGCAGGGGGGGACGGG + Intronic
1184892782 22:47389798-47389820 CAAGCCTGGCAGGAGGGGTAGGG + Intergenic
1185408631 22:50671682-50671704 CCTGCCTGGCCGGTGGGGTCTGG + Intergenic
949514686 3:4796404-4796426 GCTGTCTGGCAGCAGGGTTAAGG - Intronic
950633779 3:14301121-14301143 CTTGGCTGTCATGAGGGGTAGGG - Intergenic
950739382 3:15037743-15037765 GCTGCCTGGCAGCAGGGTCAGGG + Intronic
951268877 3:20601940-20601962 CCTGCCTGGCAGAGGGCGTGGGG + Intergenic
953780975 3:45870137-45870159 TCAGCCTGGCAGGAGGGGCAGGG + Intronic
954371325 3:50170941-50170963 ACTGCCTGCCAGGAGGGCCAGGG - Intronic
954407186 3:50351759-50351781 GCTGCCTCTCAGGAGGTGTAAGG + Intronic
954843590 3:53534479-53534501 CCTGCCTGGGAGGGCGGCTAGGG + Intronic
955073096 3:55588279-55588301 CCTGGTTGGAAGGAGGGGTTGGG - Intronic
955230488 3:57094986-57095008 CATGCATGGCAGGTGGGGAAAGG - Exonic
956363415 3:68472954-68472976 CATGACTGGCATGAGGGCTAAGG + Intronic
956582137 3:70825959-70825981 CTTGCATGGCAGAAGGGGCAAGG - Intergenic
956691424 3:71881262-71881284 GCAGCATGCCAGGAGGGGTAGGG - Intergenic
961368250 3:126414800-126414822 CATGCCTGGCACGTGGGGCAGGG - Intronic
961520767 3:127466296-127466318 CCTGTCTGCCAGGAGGAGTGGGG - Intergenic
961555033 3:127691503-127691525 TCCCCCTGGCAGGAGGGGAAGGG + Exonic
961648572 3:128405896-128405918 CCTCCTTGGCAGGCAGGGTATGG + Intronic
961885869 3:130096027-130096049 CCTGCTAGGCAAGAGGGGTGTGG - Exonic
962411752 3:135146895-135146917 CCAGCCTGGCAGGTGGGATCTGG + Intronic
963225991 3:142862108-142862130 CCTGCCAGGCTGGAGGGAGAAGG + Intronic
966792829 3:183689523-183689545 CGCACCTGGCAGAAGGGGTAAGG + Intergenic
967709340 3:192687441-192687463 TCTGCCTGGTAGGTGGGATAAGG + Intronic
967876140 3:194269763-194269785 CCTGGCTGCCAGGAAGGGTGGGG - Intergenic
967889783 3:194356868-194356890 GCTTCCTGTCTGGAGGGGTACGG + Intronic
967994001 3:195153170-195153192 CCTGGCTGGCAGTGGGGCTAGGG - Intronic
968126556 3:196164302-196164324 CCGGCCTGCCAGGCGGGGTCTGG - Intergenic
968568115 4:1325717-1325739 CCAGCCTGGCAGGAGAGGAAGGG - Intronic
968572683 4:1350347-1350369 CCTTCGTGGCAGGTGGGGTAAGG - Intronic
968626969 4:1630098-1630120 CCTGCCTGCCAGGTGTGGTGAGG + Intronic
968756879 4:2420962-2420984 CCTCCCTGGCAGCTGGGGCATGG - Intronic
968945274 4:3660300-3660322 CCTGCCTGCACGGAGGGGTGGGG + Intergenic
968995055 4:3940173-3940195 CCTGCTAGGCAAGAGGGGTGCGG - Intergenic
969369580 4:6723244-6723266 CAAGCCTGGCTGGAGGGGAAGGG - Intergenic
969477640 4:7430609-7430631 TCTGCCTGGGAGGAGGGAGAGGG - Intronic
972686762 4:41360267-41360289 CCTTCCTGGCCGCAGAGGTAGGG - Intronic
978605599 4:110476089-110476111 GCTGCAGTGCAGGAGGGGTAGGG + Exonic
979977471 4:127214443-127214465 TGTGCCAGGCAGGAGGGTTAGGG + Intergenic
981194178 4:141899370-141899392 CATGCCTGGCTGGAGGGAAAAGG - Intergenic
982316330 4:154035800-154035822 CCTGTCGGGGAGGAGGGGAAAGG + Intergenic
985543223 5:496338-496360 CCTGCCTGGCCGGTGGGGATGGG - Intronic
985983362 5:3490082-3490104 CCTCCCTGGCCAGAGGTGTATGG - Intergenic
986118767 5:4809019-4809041 TCTGCCTGTCAGGAGGAGTAAGG - Intergenic
986192522 5:5510248-5510270 CCTGCCAGGGTGGAGGGGGAAGG - Intergenic
990382711 5:55232546-55232568 CCTGCCGGGAAGGAGGGGGGAGG + Exonic
991690359 5:69219385-69219407 CCAGCCTGGCAGCAGGAGTGTGG + Intronic
992137645 5:73763409-73763431 CCTGCCTGGCTGTAGGCGAATGG + Intronic
995861969 5:116650662-116650684 TCTGTCTGGCAGGAGTGGCATGG - Intergenic
996344885 5:122477515-122477537 ACTGCTGGGCAGGAGGGGGAGGG + Intergenic
997590101 5:135067128-135067150 CATGCCAGGGAGGAGGGGTCGGG - Intronic
997614851 5:135239300-135239322 CCAGCCTGCGAGGAGGGGGATGG + Intronic
997690038 5:135822123-135822145 ACTGGATGGCAGGAAGGGTAGGG + Intergenic
999045798 5:148468182-148468204 ACTGCCTGGCAGCAGGTGTTAGG + Intronic
999232434 5:150069693-150069715 CCTGCCAGGCAGGAGGGGCTTGG + Intronic
1000308381 5:160017384-160017406 CCTACATGGCAGCAGGGGCAGGG + Intronic
1000344581 5:160304053-160304075 CCTGGGTGGCAGGTGGGGCAGGG + Intronic
1001928068 5:175653569-175653591 CCTGCCTTGCCGGAGGGCTTTGG - Intergenic
1002180401 5:177428206-177428228 CCAGCCAGGGAGGAGGGGTGGGG + Intronic
1002381847 5:178836307-178836329 CTTGCATGGCAGAAGGGGCAAGG + Intergenic
1003521677 6:6863440-6863462 CCTGACTGGAAGGAGGAGGAAGG - Intergenic
1005881071 6:30061398-30061420 CGTGCGTGGCAGGAGGGTTCGGG + Exonic
1006028447 6:31162086-31162108 CCTGCCTGGGGGGATGGGCACGG + Intronic
1006336904 6:33425712-33425734 CCTTCCTGGGAGGAGGCGGAGGG + Intronic
1006359721 6:33580360-33580382 CCTGCCTGGGAGGTGGGGTGGGG - Intergenic
1006554123 6:34851502-34851524 GCTGCCTGGAATGAGGGGAAGGG + Intronic
1006628321 6:35413189-35413211 GGTGCCTGGGAGCAGGGGTAGGG + Intronic
1006735671 6:36270768-36270790 CCTGGGTGGCAGGAAGGGAAGGG + Intronic
1007082119 6:39115011-39115033 CCTGACTGGCAGCAGGGGGTTGG + Exonic
1007091903 6:39190003-39190025 TCAGGCGGGCAGGAGGGGTAAGG + Exonic
1007614957 6:43174347-43174369 CCTGCCAGGCAGGCGGGCTGCGG - Intronic
1007699351 6:43757610-43757632 CCTGGCTGGCTGGAGTGGGATGG + Intergenic
1008535500 6:52503862-52503884 CCTGGCTGGCGGGGGAGGTATGG - Intronic
1009394824 6:63187488-63187510 CTTGCATGGCAGGAGGGGCAAGG - Intergenic
1010044123 6:71420614-71420636 CCGGCCCGGCAGGAGGAGGAGGG + Intergenic
1012521276 6:100124250-100124272 ATTGCCTGGCAGGAGGGATATGG + Intergenic
1013620132 6:111879922-111879944 CCTGGCTGGCAGCTGGGGTATGG - Intergenic
1013635030 6:112021029-112021051 CCTGCTTGGCATGTGGGCTATGG + Intergenic
1013972624 6:116039510-116039532 CTGGCTTGGCAGGAAGGGTAGGG - Intronic
1015343221 6:132126405-132126427 CCTACATGGCAGGAGGGGAGAGG + Intergenic
1016417779 6:143851120-143851142 CCTGCCCAGAAGGAAGGGTATGG + Intronic
1017816320 6:158019043-158019065 CCTGCCTTGCAGGTGTGGCAGGG + Intronic
1017878018 6:158539746-158539768 ACTGCCTGTCAGGAGAGGGAAGG + Intronic
1018174238 6:161165004-161165026 CCTGCCCAGGAGGAAGGGTATGG - Intronic
1019137887 6:169922526-169922548 GCTGCCTGGGAGGAGGAGGAAGG + Intergenic
1019341223 7:510042-510064 GGTGCATGGCAGGAGGAGTAGGG - Intronic
1019421399 7:952941-952963 CCAGCCTGGCAGGAGGAAGAGGG - Intronic
1020319317 7:6928498-6928520 CCTGCTAGGCAAGAGGGGTGCGG - Intergenic
1020785670 7:12570321-12570343 TGTGCCTGGCAGGAGGGGTGAGG - Intergenic
1022348116 7:29538362-29538384 CCTCCCTGGCAGCAGCGGTGTGG + Intergenic
1022840009 7:34155176-34155198 CTGCCCTGACAGGAGGGGTAGGG + Exonic
1023401491 7:39795096-39795118 CCTGCACAGCAGCAGGGGTAGGG + Intergenic
1023871112 7:44263490-44263512 CCCGGCTGGCAGGAGGAGGAGGG + Intronic
1024763673 7:52630441-52630463 CCATCCTGGCAGGAGGATTAGGG + Intergenic
1025143310 7:56483604-56483626 CCTGGCAGGCAGGAGAGGTTTGG + Intergenic
1025710067 7:63900476-63900498 CCTGGCAGGCAGGAGAGGTTTGG + Intergenic
1026794047 7:73354451-73354473 GCCGCCTGGCAGGAGTGGAAGGG + Intronic
1026930559 7:74220890-74220912 CCTGCCTGCCAGGAGAAGGAGGG - Intronic
1026983113 7:74538054-74538076 CCTGACTGCCTGGAGGGGCAAGG + Intronic
1027260087 7:76458663-76458685 ACTGCCTGGTAGGAGGGGGCTGG - Intergenic
1027311462 7:76956767-76956789 ACTGCCTGGTAGGAGGGGGCTGG - Intergenic
1027876008 7:83769528-83769550 CCTGCCTGACAGCAGGCATATGG + Intergenic
1028546959 7:92012922-92012944 ACTTCCTGGCAGGATGAGTAGGG + Intronic
1029355468 7:100048530-100048552 CATGGATGGCAGGAGGGGGATGG + Intergenic
1029658856 7:101945662-101945684 CCTGGATGGCAAGAGGAGTAGGG + Intronic
1030155255 7:106448342-106448364 GAAGCCTTGCAGGAGGGGTAAGG + Intergenic
1030491034 7:110234783-110234805 CTAGCCTGGCAGAAGGGGAATGG - Intergenic
1032632510 7:133669180-133669202 CATGACTGGAGGGAGGGGTAAGG + Intronic
1034254553 7:149717360-149717382 CCTGCTTGCCAGGAGGGCTCAGG - Intronic
1034355970 7:150451051-150451073 TCTTCCTGGCAGGAGGGTTTCGG - Exonic
1034866815 7:154649044-154649066 CTCGCCTGGGTGGAGGGGTATGG - Intronic
1035397895 7:158547019-158547041 CTTGCCTGGCAGGAGGGCCTGGG - Intronic
1036868942 8:12422659-12422681 CCTGCTAGGCAAGAGGGGTGGGG - Intergenic
1037834905 8:22210010-22210032 GCTGCCTTGGGGGAGGGGTAAGG - Intronic
1040460622 8:47644254-47644276 CATACCTGGCAGGAAGGGTTAGG + Intronic
1040598895 8:48865247-48865269 CCTGCCTGAGGGAAGGGGTACGG + Intergenic
1042497648 8:69472633-69472655 ACTGCCTGGGATGATGGGTAAGG + Intronic
1042843423 8:73147417-73147439 CCTGTCAGGCAGGAGGGGGTAGG - Intergenic
1046739430 8:117812608-117812630 CAGGCCTGGGAGGAGGGGTGAGG + Intronic
1047190452 8:122674498-122674520 CCTACCTGGCAGATGGGGTAGGG - Intergenic
1047521585 8:125599191-125599213 GTTGCATGGCAGAAGGGGTAGGG + Intergenic
1047866951 8:129035194-129035216 CCTGCGAGGCAGCAGGGGTGGGG + Intergenic
1048989142 8:139751123-139751145 CCTGCCTGGGAGAAAGGTTATGG + Intronic
1049113473 8:140664929-140664951 GCTGGCTGGTAGGAGGGGAATGG + Exonic
1049222920 8:141436058-141436080 TCTGCCTTGCAGGAGCGGGACGG - Intergenic
1049231784 8:141488459-141488481 GGTGCCTGGGAGGAGGGGTAGGG - Intergenic
1049523006 8:143104239-143104261 CCTGCTAGCCAGGAGGGGTGAGG - Intergenic
1051384895 9:16497069-16497091 ATTGCCTGGCAGGAAGGGGAAGG + Intronic
1053752356 9:41269333-41269355 CCAGGCTGGCTGGAGGGGCATGG + Intergenic
1054856620 9:69907112-69907134 CTTGCATGGCAGGAGGGGGATGG + Intergenic
1056731494 9:89169971-89169993 CTGACCTGGCAGGAGGGGTGAGG - Intronic
1057194357 9:93108510-93108532 CCTGCCTGGCAGGTGTGGTGAGG + Intronic
1057589080 9:96356173-96356195 CCCTCCTGGCAGAAGGGGAAGGG - Intronic
1057938193 9:99258116-99258138 CCTGCCTTCCAGGAGGGCTTGGG - Intergenic
1060941592 9:127545877-127545899 GCTGCCAGGCAGGCGGGGTGGGG - Intronic
1061371011 9:130197599-130197621 CCTGGCTGGCGGGAGGGCTGGGG + Intronic
1062277502 9:135737748-135737770 ACAGCCAGGTAGGAGGGGTAAGG - Intronic
1062290763 9:135793410-135793432 CATGCCTGGCTGCAGGGGTGAGG - Intergenic
1062400393 9:136370199-136370221 CGTGCCTGGAAGGTGGGGTGTGG - Intronic
1062696990 9:137880582-137880604 CCTGCCTCGCAGGTGTGGGAGGG + Intronic
1186459200 X:9734816-9734838 ATGGCCTGGCAGGAGGGGTGGGG - Intronic
1189240172 X:39518817-39518839 CCCCACTGGCAGGAGGGGAATGG + Intergenic
1190000034 X:46677100-46677122 CCTTCAGGGCAGGAGGGGAAGGG - Intronic
1192261538 X:69508707-69508729 CCTGCCAGGGAGGTGGGGTGAGG - Intronic
1197922427 X:131609588-131609610 CGTGCCTGAGAGGAGGGGAAAGG + Intergenic
1197948161 X:131862995-131863017 CGTGCCTGGGAGGAGGGGAAAGG + Intergenic
1197957998 X:131973731-131973753 CATGACTGGCAGCAGAGGTAAGG + Intergenic
1199897123 X:152136568-152136590 CGTGGCTGACAGAAGGGGTAGGG + Intronic
1200043672 X:153388272-153388294 CCTGCCTGGGAGCAGGGCTTTGG + Intergenic
1200070652 X:153527386-153527408 CCGGGCTGGCAGGAGGGGCGTGG + Intronic
1200083894 X:153593356-153593378 CCTGACTGGAAGGAGGGGAAGGG + Intronic
1202372037 Y:24205377-24205399 CTTGCGTGGGAGGAGGGGGAGGG - Intergenic
1202498748 Y:25464739-25464761 CTTGCGTGGGAGGAGGGGGAGGG + Intergenic