ID: 1089355421

View in Genome Browser
Species Human (GRCh38)
Location 11:117848104-117848126
Sequence GAATTCCTACCCAGTACACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089355421 Original CRISPR GAATTCCTACCCAGTACACT AGG (reversed) Intronic
900734473 1:4288113-4288135 GAAGTCCTAGCCAGAACAATGGG - Intergenic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
903363713 1:22793165-22793187 TATTTCCTACCCAGATCACTAGG - Intronic
904052245 1:27646690-27646712 CAATTCCTATCCATTACACCAGG + Intergenic
904272857 1:29361965-29361987 GAGTTCCTACCCTGCACACAGGG - Intergenic
905655147 1:39682210-39682232 GAATTCCTAACCAGAACCCCAGG + Exonic
908968581 1:69797052-69797074 GAATGCCTACCATGTATACTGGG - Intronic
909369038 1:74862375-74862397 GAATTCCTCCCCAGAAAAATGGG + Intergenic
913423593 1:118701375-118701397 GAAGTCCTAGCCAGAACAATTGG - Intergenic
916959346 1:169873128-169873150 GAATTCCTGCCCATGACACATGG - Intronic
917325171 1:173824632-173824654 GAATTCCTTCCCGGTAATCTTGG + Exonic
918289222 1:183090622-183090644 GAATTCCTACCCAGAGGACAAGG + Intronic
924618590 1:245638484-245638506 GAATTCCTAGCCAGCACAATAGG - Intronic
924646898 1:245886478-245886500 CAATTAATACCCAGTACAATTGG + Intronic
1064879447 10:20033733-20033755 GAGTTCCTTCCCATGACACTTGG + Intronic
1065053977 10:21824661-21824683 CACTTCCTACCCAGTTCACAAGG + Intronic
1065729436 10:28697306-28697328 GAATTCCTTCCCAGTTCCATAGG - Intergenic
1066427418 10:35320605-35320627 GAAGTCCTAGCCAGTACAATAGG + Intronic
1071277122 10:84065547-84065569 GGATTCCTACCCAGCACTCAAGG + Intergenic
1074081825 10:110174011-110174033 GAAGGACTCCCCAGTACACTAGG + Intergenic
1074750949 10:116586492-116586514 GAATTCTTACCCAATCCATTGGG + Intergenic
1076545763 10:131244924-131244946 GTCTTCCTGCCCAGGACACTGGG + Intronic
1077389507 11:2293479-2293501 GTGGTCCTACCCAATACACTCGG + Intergenic
1086972328 11:93096551-93096573 CAATTCCTACCTAGAAAACTTGG - Intergenic
1089355421 11:117848104-117848126 GAATTCCTACCCAGTACACTAGG - Intronic
1090912127 11:131130250-131130272 ACATTCCCACCCAGTACTCTAGG - Intergenic
1091399366 12:173070-173092 GAATTCCTCCCCAGGAGACACGG - Intronic
1096509203 12:52118133-52118155 GTATCACTACTCAGTACACTTGG - Intergenic
1096875200 12:54624436-54624458 AAATTCCTACACAGTCCTCTGGG - Intergenic
1098224259 12:68305397-68305419 GAAGTCCTACCCAGAGCAATCGG + Intronic
1099116422 12:78631059-78631081 GTATTCCTCTCAAGTACACTTGG + Intergenic
1101029437 12:100645129-100645151 GTATCACTACTCAGTACACTTGG - Intergenic
1103514097 12:121495600-121495622 TAATTCCTACCAAGCACTCTGGG + Intronic
1103906695 12:124331371-124331393 GCATTTCTAACCAGTACCCTGGG + Intronic
1104736993 12:131141089-131141111 GTATTCCTACAATGTACACTTGG + Exonic
1105949605 13:25217808-25217830 CAATGCCTTCCCAGTGCACTTGG - Intergenic
1110896856 13:80763825-80763847 GAATGCCTACCAAGTTCACCAGG + Intergenic
1111492313 13:88996676-88996698 GATTTCCAACCCAGTATATTAGG - Intergenic
1112855878 13:103768811-103768833 GAATTTCTCCCCAGGAAACTGGG + Intergenic
1114971809 14:28040238-28040260 GAAGTCCTAGACAGAACACTAGG + Intergenic
1121616007 14:95314311-95314333 CATTTTCTACCCAGGACACTTGG + Intronic
1123027628 14:105434976-105434998 GAAGTCCCAGCCAGTACAATGGG - Intronic
1124799020 15:32811402-32811424 GAAATCCTACACCCTACACTAGG - Intronic
1126273130 15:46845225-46845247 GAATTCCTCCCCAGAAAAATGGG + Intergenic
1130792152 15:87167005-87167027 GAAGTCCCATCCAGTACAGTAGG - Intergenic
1130964952 15:88690183-88690205 GACTTCCTACCCAAAACACTCGG - Intergenic
1134268182 16:12709835-12709857 GAAATCCTAGCCAGTGCAATAGG + Intronic
1134332842 16:13265880-13265902 AAATTGATACCCAGAACACTTGG - Intergenic
1143538951 17:7558298-7558320 GGATTCCTCCCCAGCACACAGGG - Intronic
1147935170 17:44006890-44006912 GAGTTCCCTTCCAGTACACTGGG - Intronic
1150567440 17:66354220-66354242 TAATTCCAACCCAGCACACCAGG + Intronic
1153012004 18:547699-547721 GAATTTCTACCCAGAAAAATGGG + Intergenic
1153446939 18:5184330-5184352 GAAGTCCTAGCCAGAACAATCGG + Intronic
1153726204 18:7958055-7958077 TAATTCCAAGCCAGTACTCTTGG - Intronic
1155929850 18:31695404-31695426 AGATTCCTGCTCAGTACACTTGG + Intergenic
1155992082 18:32288135-32288157 GAGTTCATCCCCAGTACACAGGG + Exonic
1156212373 18:34958696-34958718 AAATTTCTACCCAGTAAATTAGG - Intergenic
1157275328 18:46306517-46306539 GAATTTCTACTCAATACAATAGG - Intergenic
1164441063 19:28281282-28281304 GAATTCCTAGCCAGAATAATCGG - Intergenic
1165490329 19:36119630-36119652 GTAATCCCACCCAGTACATTGGG + Intronic
929045374 2:37784003-37784025 GAATCCCTACCCACCTCACTAGG - Intergenic
930811096 2:55541706-55541728 GAAGTCCTACCTAATCCACTAGG - Intronic
931118402 2:59189623-59189645 GAAATCCTATACAGTACACCTGG + Intergenic
935332994 2:101990920-101990942 GAATTCATACCCAGAACAAATGG - Intergenic
938793430 2:134697225-134697247 GATGTCCTACCCAGTATAGTAGG - Intronic
942299001 2:174544340-174544362 GATTTCCCACCCACTACGCTGGG + Intergenic
942600528 2:177636284-177636306 TAATTTCTACACAGTACACTTGG + Intronic
944479385 2:200140109-200140131 GAACTCATAGCCAGTACTCTTGG - Intergenic
946612911 2:221478552-221478574 GAAGTCGTACCCAGTAAAATTGG - Intronic
1170888649 20:20361697-20361719 GAATTCAGACCCAGCACACGTGG + Intergenic
1171354644 20:24534481-24534503 AAATCCCTGCCCAGCACACTGGG - Intronic
1171408352 20:24928979-24929001 GTGTTACTACTCAGTACACTTGG + Intergenic
1172160536 20:32865055-32865077 GAATTCCAACCCAGAGCTCTGGG + Intronic
1172252977 20:33492842-33492864 ACATTCCTAGACAGTACACTTGG + Intronic
1173860952 20:46283236-46283258 GAATGCATTCCCAGTGCACTTGG - Intronic
1177085302 21:16695429-16695451 GAATTCCTCCCCAGAAAACCTGG + Intergenic
951578949 3:24141921-24141943 AAATTCTAACACAGTACACTTGG - Intronic
957794506 3:84986543-84986565 AACTTCCTACCCAGAACACATGG + Intronic
958855089 3:99375596-99375618 GATTTCCATCCCAGGACACTTGG - Intergenic
964875665 3:161365882-161365904 GAATTCCTACTCAGGGCACTTGG - Intronic
968988862 4:3895232-3895254 GTATCACTACTCAGTACACTTGG - Intergenic
970007039 4:11421354-11421376 TCCTTCCTACCCAGGACACTGGG + Intronic
976970201 4:91094270-91094292 GTGTTACTACTCAGTACACTTGG - Intronic
978652360 4:111021278-111021300 GAATTCCTCCCAAGTCCTCTAGG + Intergenic
981275617 4:142895466-142895488 GAATTCCTAGCCAGAGCAATTGG - Intergenic
990845588 5:60134863-60134885 GAATGCCTTCTCAGTACACTTGG - Intronic
991059594 5:62359433-62359455 AACTGACTACCCAGTACACTTGG - Intronic
991152795 5:63390859-63390881 GAAATTCTACCAAATACACTTGG - Intergenic
991778756 5:70111894-70111916 GAAATCCTACCTAGTTCTCTGGG - Intergenic
991858047 5:70987361-70987383 GAAATCCTACCTAGTTCTCTGGG - Intronic
991871205 5:71112247-71112269 GAAATCCTACCTAGTTCTCTGGG - Intergenic
996426930 5:123323086-123323108 GAAGTCCTAGCCAGTGCAATTGG - Intergenic
997231727 5:132250195-132250217 GAAGTCCTAACCAGGACAATAGG - Intronic
1000049350 5:157548473-157548495 GAACTCAAGCCCAGTACACTGGG + Intronic
1001027816 5:168238934-168238956 GAATTCCTACCAAGCCGACTGGG + Intronic
1002574327 5:180163257-180163279 GAAGTCCTAGCCAGTGCAATAGG - Intronic
1006417944 6:33915959-33915981 GAATTGCTTCCCAGGAGACTGGG + Intergenic
1008113262 6:47517078-47517100 GAATTCTCACCCAGTTCACTTGG + Intronic
1008238606 6:49079883-49079905 GAATTCCTAGCCAGAGCAGTTGG - Intergenic
1017529750 6:155277603-155277625 GAATGTCTACCCAGTAAAATAGG - Intronic
1018155641 6:160983147-160983169 GAATTCCTCCCCAGAAAAATGGG - Intergenic
1019754674 7:2760331-2760353 GAATGCCTTACCAGTACACCAGG + Intronic
1020714523 7:11654036-11654058 GAGTTCCTACACAGAATACTTGG - Intronic
1022272209 7:28819674-28819696 GATTTCCTACCCAGTTACCTTGG - Exonic
1025721052 7:64014496-64014518 GAATCTCTACCCAATACAATTGG - Intergenic
1026380738 7:69797034-69797056 AAATTACTACCCACTATACTAGG - Intronic
1026382624 7:69814589-69814611 GGAGTCCTATTCAGTACACTGGG - Intronic
1027808269 7:82858440-82858462 GAAGTCCTACCCAGAGCATTGGG + Intronic
1029652027 7:101899879-101899901 GAATTCCCATCCAGTGCCCTCGG - Intronic
1032350944 7:131163121-131163143 GAATTCTTACCCATTGCTCTAGG + Intronic
1036745910 8:11409482-11409504 GTCTTCCTACCGAGGACACTTGG + Intronic
1037111882 8:15172658-15172680 GACTTCCTAACCAATACACTTGG + Intronic
1040850563 8:51897956-51897978 GAATAACTACCCACCACACTTGG + Intronic
1045535122 8:103020725-103020747 GAACTACTAGCCAGTATACTAGG + Intergenic
1048390440 8:133958678-133958700 GAAAACCTTCCCAGTCCACTGGG + Intergenic
1052827565 9:33188051-33188073 CAGTTCATACCCAGGACACTGGG - Intergenic
1062160901 9:135079199-135079221 CAACTCCTACCCAGAGCACTCGG - Intronic
1187893583 X:23960594-23960616 GAAGTCCTAGCCAGTAAAATAGG - Intergenic
1188016873 X:25115802-25115824 GAATTTCCATCCAGTACAGTAGG - Intergenic
1190011337 X:46787513-46787535 GAAGTCCTAGCCACTATACTAGG + Intergenic
1190218816 X:48497675-48497697 GAATGCCTGCCCAATACAGTAGG + Intergenic
1190500815 X:51076215-51076237 GAAGTCCTAGCCAGCACAATCGG - Intergenic
1191707395 X:64108426-64108448 GAAGTCCTACCCAGTGCAACAGG - Intergenic
1193646279 X:84072540-84072562 GAAGTCCTAGCCAGAACAATTGG + Intronic
1195566990 X:106351702-106351724 GGATTTCTAGCCAGTACACAGGG - Intergenic
1199251738 X:145671052-145671074 GAAGTCCTAGCCAGAACAATTGG - Intergenic
1199322562 X:146457411-146457433 GAATTCATTACCAGTAGACTAGG + Intergenic