ID: 1089356618

View in Genome Browser
Species Human (GRCh38)
Location 11:117858133-117858155
Sequence GATGGGAAGCAGGGGGACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 376}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089356618_1089356626 -5 Left 1089356618 11:117858133-117858155 CCAGCGTCCCCCTGCTTCCCATC 0: 1
1: 0
2: 4
3: 24
4: 376
Right 1089356626 11:117858151-117858173 CCATCCATGCTGGAGCATCCTGG 0: 1
1: 0
2: 2
3: 17
4: 174
1089356618_1089356628 4 Left 1089356618 11:117858133-117858155 CCAGCGTCCCCCTGCTTCCCATC 0: 1
1: 0
2: 4
3: 24
4: 376
Right 1089356628 11:117858160-117858182 CTGGAGCATCCTGGTGCCCTTGG 0: 1
1: 0
2: 2
3: 29
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089356618 Original CRISPR GATGGGAAGCAGGGGGACGC TGG (reversed) Intronic
900162345 1:1230026-1230048 GGTGGGAAGCAGGGGCTCACAGG + Intronic
900528531 1:3141174-3141196 GATGAGAAGCGGGCGGACGGAGG - Intronic
901295163 1:8155781-8155803 GAAGGGGAGGAGGGGGACGCAGG + Intergenic
901391166 1:8947251-8947273 TATGGAAAGAAGGGGGATGCGGG - Intronic
902194651 1:14789390-14789412 GTGGGGAAGCAGAGGGAAGCAGG - Intronic
902366198 1:15975898-15975920 GATGGGGCGCGGTGGGACGCCGG - Intronic
903338014 1:22637704-22637726 GACGGGAAGAAAGGGGAGGCAGG + Exonic
903794433 1:25918245-25918267 GCTGGGAAGCTGGGGGTGGCTGG + Intergenic
904486227 1:30826026-30826048 GATGGGAAGCAGGTGCATGGAGG - Intergenic
904796312 1:33058783-33058805 GATGGGAAGTAGGGGACTGCAGG - Intronic
904811208 1:33164480-33164502 GATGGGAAGGCTGGGGACCCAGG + Intronic
905881802 1:41468780-41468802 GCTGGGAATCAGGAGGCCGCAGG - Intergenic
906069656 1:43007658-43007680 GAGGGGAAGGAGGGGGCCGCGGG - Intergenic
906312954 1:44766963-44766985 GATGGGGTGCAGGTGGACGATGG + Intronic
906382693 1:45342853-45342875 AATGGGAAGCAGCGGGCAGCTGG + Exonic
910547848 1:88439300-88439322 AGTGGGAAGCAGGGGGAAGTGGG + Intergenic
912472704 1:109916491-109916513 GATGGGAGGCAGGAAGAAGCAGG - Intronic
914221539 1:145686444-145686466 TTTGGGGAGCAGGGGGAGGCAGG - Intronic
914474102 1:148009310-148009332 TTTGGGGAGCAGGGGGAGGCAGG - Intergenic
915555222 1:156657495-156657517 GATGGAAAGCAGGGGAATGGGGG - Intronic
917263566 1:173195817-173195839 GGTGGGCAGCAGTGGGACGTGGG + Intronic
917372512 1:174311031-174311053 GATGGGTTGCAGGGGGAGGCGGG - Intronic
918162998 1:181918876-181918898 GATGGGGAGCAGGGGGCATCAGG - Intergenic
918511324 1:185316998-185317020 GATGGGAAGCAGGAGGAAGCGGG + Exonic
919454696 1:197807522-197807544 GATGGGTAGGAGGGAGAGGCAGG - Intergenic
919799510 1:201344937-201344959 AATGGGAAGCAGCAGGAGGCAGG - Intergenic
920205590 1:204288611-204288633 GATGGGAAGCAGTGGGAAGGTGG + Intronic
920578896 1:207086045-207086067 GAAGGGGAGCAGAGGGAGGCAGG + Intronic
921176904 1:212603329-212603351 GATGGGAAGCAGAGAGGGGCAGG + Intronic
922294588 1:224238465-224238487 GCTGGGAGGCAGTGAGACGCTGG - Intronic
923482417 1:234397397-234397419 GATGGGGAGGAGGGGGAAGAGGG + Intronic
923940377 1:238816850-238816872 GATGGATAGCTGGGGGAAGCAGG - Intergenic
1065169106 10:23010180-23010202 GAAGGGAAGGAGAGGGAAGCTGG - Intronic
1069405672 10:68095479-68095501 GATGGGAGGCAGGGAGACCCTGG - Intergenic
1070350187 10:75584147-75584169 TATGGGGAGCAGGGGGTGGCAGG - Intronic
1071463405 10:85919496-85919518 GATGGGGGACAGGGGGAGGCAGG - Intronic
1072606175 10:96984594-96984616 GAAGGGAAGGAAGGGGAAGCAGG + Exonic
1072923492 10:99596222-99596244 GGTGGGAAAGAGGGGGACCCGGG + Intergenic
1073043338 10:100621851-100621873 GATGGGGAGCTGGGGGAGGCGGG + Intergenic
1073569339 10:104563291-104563313 GATGAGAAGCTGGGAGACCCAGG + Intergenic
1074391710 10:113063541-113063563 GATGGGAACCTGGTGGACACAGG + Intronic
1076483309 10:130799222-130799244 GATGGGAAGCCAGAGGATGCTGG + Intergenic
1076552079 10:131287643-131287665 GATGGCAAGGAGGTGGACACTGG - Intronic
1077178233 11:1200217-1200239 GATGGGAGGGAGGGAGACTCGGG - Intronic
1077525317 11:3060675-3060697 CATGGGCAGCAGGGTGTCGCTGG + Intergenic
1077798603 11:5516461-5516483 GATGGGGAGCAGGTGGAAGCTGG + Exonic
1078523980 11:12086663-12086685 GATGGGAAGCAGGAGGCAGGAGG - Intergenic
1078663018 11:13302270-13302292 GAGGGGCAGCAGGGTGACCCAGG + Intronic
1078841509 11:15079852-15079874 GATGGGAAGCTGGCAGATGCTGG + Intronic
1079795573 11:24798709-24798731 AATGGCAAGCAGGGGGAAGCAGG - Intronic
1081811400 11:45916182-45916204 GGTGGGAAGCATGGGGACTCAGG - Intronic
1082028495 11:47589005-47589027 GGAGGGAAGCAGGGGGAGGGAGG + Exonic
1082798574 11:57396473-57396495 AATGGGAAGCATGGGGACAATGG - Intronic
1083581369 11:63827437-63827459 GGTGGGGAGCAGGGGGAGGGTGG - Exonic
1084271562 11:68031973-68031995 GATGGAAAGCTGGGAGGCGCTGG + Intronic
1084565870 11:69928446-69928468 GGTGGGAAGGAGGGGGAAGGAGG + Intergenic
1085217862 11:74848241-74848263 GATGGGAGGCAGTGGCACGAAGG + Exonic
1085430847 11:76445925-76445947 TATGGGAAGTAGGGGGAGGGGGG + Intronic
1087302450 11:96451489-96451511 GATGAGTAGCAGGGAGAGGCAGG + Intronic
1088562229 11:111126867-111126889 GATTGTAAGCTGGGGGAAGCGGG - Intergenic
1088675518 11:112188708-112188730 GATGGAAAGCTGGGGGAATCAGG - Intronic
1089356618 11:117858133-117858155 GATGGGAAGCAGGGGGACGCTGG - Intronic
1089390689 11:118099672-118099694 GATGGGAAGGAGGGGGCAGGGGG - Intronic
1090207120 11:124891516-124891538 GTCTGGAAGCAGGGGCACGCCGG + Exonic
1091675494 12:2486137-2486159 GATGTGCAGCAGGGGGACCATGG - Exonic
1091963371 12:4718162-4718184 GAGGGGAAGGTGGGGGATGCAGG + Intronic
1095256440 12:40041996-40042018 GATGGGACTCAGGTGGACACAGG - Intronic
1095773791 12:45990745-45990767 GTTGGGCCGCAGGGGGGCGCTGG + Intronic
1096828793 12:54299066-54299088 GAAGGGGAGCAAGGGGAGGCAGG + Intronic
1097094957 12:56539431-56539453 GGTGGGAAGAAAGGGGAAGCTGG - Intronic
1098982184 12:76968690-76968712 GAAGGGTAGGAGGGGGACGAGGG - Intergenic
1100550689 12:95644204-95644226 GAGGGGAAGGAGGGGGAGGAGGG - Intergenic
1100948660 12:99819894-99819916 GATGAGAAGAAGTGGGAGGCAGG + Intronic
1101835558 12:108292567-108292589 GATGGTCAGCAGGAAGACGCTGG + Exonic
1102952035 12:117037512-117037534 GAAGGGAAGACGGGGGAGGCTGG + Intergenic
1103192887 12:119017519-119017541 GATGGGAAGCAGCAGGAGGCTGG + Intronic
1103239014 12:119398004-119398026 GATGGGAGGAAGGGGGCGGCGGG + Intronic
1103318765 12:120077951-120077973 GAGGGAAACCAGAGGGACGCAGG - Intronic
1104352325 12:128055724-128055746 GATGGGATCCAGGGGGAAGGAGG - Intergenic
1104481233 12:129110093-129110115 GATGGGAAGGAGGGAGAACCGGG - Intronic
1104745149 12:131205782-131205804 GATGGGACGAAGGAGGACGTGGG - Intergenic
1105578822 13:21675233-21675255 GTGGGGAAGCAGGGTGAGGCAGG + Intronic
1107644761 13:42482433-42482455 GATGGGAACCAGGCTGACACAGG - Intergenic
1108171634 13:47748057-47748079 GAAGGAAAGCAGGGTGACACAGG - Intergenic
1112708423 13:102099102-102099124 GATGGGGAGCAGGAGGAAACGGG - Intronic
1113298670 13:108991181-108991203 GAAGGGTAGCATGGGGACGTCGG - Intronic
1113674617 13:112198758-112198780 TATGGGAAGCAGTGGGGGGCTGG - Intergenic
1113909764 13:113836440-113836462 GAAGGGAAGGAGGAGGACGGAGG + Intronic
1117966255 14:61209793-61209815 GGAGGGAAGCAGGGGGATGATGG - Intronic
1119423963 14:74524137-74524159 GATGGGAAGCAGGGGGCAGGGGG - Intronic
1119645664 14:76346608-76346630 GATGGGAAGGAGGGGCATGGAGG - Intronic
1119651512 14:76387217-76387239 GAGGGGAAGCTGGGGTCCGCTGG - Intronic
1120946110 14:89998721-89998743 GATGGGTTGCTGAGGGACGCGGG + Intronic
1121473766 14:94175213-94175235 GCTGGGAAGCGAGGGGAGGCCGG - Intronic
1121793395 14:96716080-96716102 GAGGGGAACCTTGGGGACGCAGG - Intergenic
1122272119 14:100573059-100573081 GATGGGAGGCAGGGTGGGGCAGG + Intronic
1122893264 14:104742729-104742751 CATGGGCAGCTGGGGGAGGCGGG - Intronic
1125918874 15:43512637-43512659 AAAGGGAAGCAGGGAGACCCGGG - Intronic
1126676342 15:51161995-51162017 GCTGGGCAGCAGGGAGAGGCTGG - Intergenic
1126753028 15:51896716-51896738 CATAGGAAGGAGGGGGAAGCTGG - Intronic
1127931792 15:63601570-63601592 GAGGGGAAGCAGGGGCGCACGGG + Exonic
1128455304 15:67828343-67828365 GAAGGGAAGCTGGGGGCGGCGGG + Intronic
1128545034 15:68561081-68561103 GCTGGGAGCCTGGGGGACGCGGG - Intergenic
1129271657 15:74422258-74422280 GATGGGAAGCAGGGGGAGCCAGG - Intronic
1129718543 15:77865481-77865503 GAAGGGAAGCAGCAGGACCCGGG - Intergenic
1130261218 15:82355530-82355552 GATGGGTAGCCGGGCGGCGCGGG + Intergenic
1130280017 15:82513488-82513510 GATGGGTAGCCGGGCGGCGCGGG - Intergenic
1130359725 15:83171744-83171766 GATGGGAGGGAGGGGGACAAGGG + Intronic
1130471392 15:84229674-84229696 GATGGGTAGCCGGGCGGCGCGGG - Intergenic
1130478886 15:84344245-84344267 GATGGGTAGCCGGGCGGCGCGGG - Intergenic
1130492884 15:84443886-84443908 GATGGGTAGCCGGGCGGCGCGGG + Intergenic
1130593686 15:85234301-85234323 GATGGGTAGCCGGGCGGCGCGGG - Intergenic
1132162537 15:99556326-99556348 GAGAGAAAGCAGGGGGACTCAGG + Intergenic
1132550955 16:553666-553688 GAGGGGAAGGAGGGGGGCGGGGG - Exonic
1132880878 16:2161204-2161226 AGAGGGAAGCAGGGGGACGGAGG - Intronic
1132955420 16:2590093-2590115 GATGAGAAGCCAGGGGACACAGG - Intronic
1133024064 16:2980133-2980155 GACGGGAGGCAGGGGCTCGCGGG + Intronic
1133342647 16:5046715-5046737 AAAGGGAAGGAGGGGGACACAGG - Intronic
1134050344 16:11132854-11132876 GATGGGAGGCTGGGGGACAGAGG + Intronic
1134568914 16:15274779-15274801 GCTGGGAAGGAGGTGGAGGCAGG + Intergenic
1134733520 16:16481583-16481605 GCTGGGAAGGAGGTGGAGGCAGG - Intergenic
1134933981 16:18230699-18230721 GCTGGGAAGGAGGTGGAGGCGGG + Intergenic
1135323229 16:21510544-21510566 GATGGGAAGAAGGGTCACACAGG + Intergenic
1135913868 16:26586032-26586054 CATGGGAAGCAAGGGGAAGAGGG - Intergenic
1137617480 16:49856186-49856208 GGAGGGAAGGAGGGGGCCGCAGG - Intronic
1139384736 16:66559096-66559118 GAAGGGCAGCAGGGGGATTCAGG - Intronic
1139966349 16:70747676-70747698 GATGGGCAGCATGGGGGCGAGGG - Intronic
1140776687 16:78255200-78255222 GAAGGACAGCAGGGGGACGGGGG - Intronic
1141506561 16:84482103-84482125 CACAGGAAGCAGGGGGAAGCGGG - Intronic
1141609713 16:85174522-85174544 AATGGGAAGGAGGGGGAGGGAGG - Intronic
1142747133 17:1965542-1965564 GGTGGGAAGCAGCAGGAAGCAGG + Intronic
1143178197 17:4968470-4968492 GCTGGGGAGCAGGGGCAGGCAGG + Exonic
1143373597 17:6454987-6455009 GCTGTGAAGCCTGGGGACGCAGG + Exonic
1143478913 17:7217629-7217651 GAGAGGAAGCAGGGGGAGGGAGG + Intronic
1143601718 17:7950966-7950988 GGAGGGAGGGAGGGGGACGCGGG + Intergenic
1144467372 17:15507225-15507247 AATGGGAAGCAGGTGGTCTCTGG + Intronic
1144554205 17:16267395-16267417 GATGGGAAGGCGGGAGAGGCAGG + Intronic
1145922420 17:28620214-28620236 GATGGGATGGAGGTGGAAGCAGG + Intronic
1146745124 17:35321914-35321936 TATGGGAGGCAGGGGGACTGAGG - Intergenic
1146751923 17:35389614-35389636 GTTGGGAAGCAGGGGGCTGAGGG + Intergenic
1146789675 17:35744194-35744216 GCTGGGGGGCAGGGGGAGGCAGG + Intronic
1147375137 17:40018684-40018706 GATGGGAGGCGGGGGGATGAGGG - Intergenic
1147590905 17:41682748-41682770 GAGGGGAAGGAGTGGGAAGCAGG + Intergenic
1147967045 17:44199329-44199351 GCCGGGAAGCTGGGGGAAGCCGG + Intronic
1148026076 17:44588584-44588606 GATGGGAAACAGGAGAATGCTGG - Intergenic
1148183038 17:45620499-45620521 GCTGGGAGGCGGGGGGCCGCGGG + Intergenic
1148265815 17:46225192-46225214 GCTGGGAGGCGGGGGGCCGCGGG - Intronic
1148673645 17:49432095-49432117 GAAGGGAGGCAGGGGCAGGCTGG + Intronic
1149344866 17:55724532-55724554 GATGGTAAGATGGGGGCCGCTGG + Intronic
1149493990 17:57105573-57105595 GATGAGCAGCAGGTGGAGGCTGG + Exonic
1149598081 17:57875700-57875722 GAGGGGAAGGAGGGAGAAGCTGG + Intronic
1149863881 17:60139730-60139752 GATGAGGAGGAGGGGGCCGCGGG - Intergenic
1149897538 17:60440607-60440629 GATCGGAAGCAGGGAGAGGTGGG + Intergenic
1150218685 17:63483978-63484000 GGTGGGAAGCCGGGGGAAGTGGG + Intergenic
1150270537 17:63861686-63861708 GATGGGAAGCAGGGGCCCCAGGG + Intergenic
1150319658 17:64201919-64201941 TATGGGAAGCAGGAGTAAGCAGG + Intronic
1151381656 17:73729964-73729986 GGTGGGCAGCAGGGGGAAGGAGG + Intergenic
1151919015 17:77140388-77140410 AATGGGGAGGAGGCGGACGCCGG - Intronic
1152634989 17:81427217-81427239 GATGGGCAGCAAGGGGAAACAGG + Intronic
1152693546 17:81732857-81732879 GGTGGGGGGCAGGGGAACGCTGG + Intergenic
1153382223 18:4453890-4453912 GGCGGCAAGCAGTGGGACGCTGG - Intronic
1153448155 18:5196797-5196819 GAAGAGAAGCAGCGGGACGAGGG + Intronic
1153500085 18:5740206-5740228 GATGGAAAGCATGGGGACAGTGG + Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1158564017 18:58538939-58538961 GATGGGAGGCAGAGGGGAGCTGG - Intronic
1161021467 19:2013508-2013530 GATGGGGTGCAGGGGGTAGCAGG + Intronic
1162451307 19:10756842-10756864 GATGGCAGGCAGGGGTACGGAGG - Intronic
1163633802 19:18429444-18429466 GTTGGGAAGCTGCGGGTCGCAGG + Intronic
1163676530 19:18658119-18658141 GCGGGGGAGCAGGGGCACGCTGG + Intronic
1163721339 19:18899585-18899607 GAGGGGATGCAGGTGGATGCCGG + Exonic
1164803594 19:31098698-31098720 CATGGGAACCAGGAGGAAGCAGG - Intergenic
1165424006 19:35735830-35735852 GATGTGAAGAAGGGGGATGGGGG - Intronic
1165433347 19:35784468-35784490 AATGAGAAGGAGGGGGGCGCGGG - Intronic
1165768792 19:38366601-38366623 GACTGGAAGCAGGGAGACTCTGG + Intronic
1166039135 19:40191626-40191648 GATGCGGAGCCGGGGGCCGCCGG + Intergenic
1166355708 19:42226073-42226095 GATGGGGAGGCGGGGGGCGCGGG - Exonic
1166851721 19:45764562-45764584 GTGGGGCAGCAGGGGGACGCAGG - Intergenic
1166880921 19:45929476-45929498 GATGGGGAGCAGAGGGACAGAGG + Intergenic
1166976978 19:46610481-46610503 GAGGGGAAGCAGGGGGTGGGGGG - Exonic
1167360670 19:49028739-49028761 GATGGGAGGCAGATGGACGGAGG + Intronic
1167362984 19:49040067-49040089 GATGGGAGGCAGATGGACGGAGG - Intergenic
1167365586 19:49053526-49053548 GATGGGAGGCAGATGGACGGAGG + Intergenic
1167367779 19:49064030-49064052 GATGGGAAGCAGATGGAGGGAGG + Intronic
1168105002 19:54161138-54161160 GCTGTAAAGCAGGGGAACGCTGG + Exonic
1168258922 19:55181968-55181990 GACGGGAGGCAGTGGGACGAGGG - Intronic
1168705548 19:58468383-58468405 GAGGGGAAGAAAGGGGACACCGG + Intronic
925854669 2:8118033-8118055 GATGGGAAGCTTGGGGAAGGTGG - Intergenic
926087758 2:10030679-10030701 GATGGAAAGAAGGGGGAGGAGGG + Intergenic
926337719 2:11876774-11876796 GCTGGGAAGCAGGGGTCGGCAGG - Intergenic
927459939 2:23289815-23289837 GAGAGGAAGCAGTGGGAAGCTGG - Intergenic
927636492 2:24820634-24820656 GGTGGGAGGCAGGGGCACGTGGG + Exonic
927692846 2:25220490-25220512 GATGGGAAGCAGGCAGAGGAGGG + Intergenic
927859997 2:26554763-26554785 GGTGGGAATCAGGGGGAGGGTGG + Intronic
929948727 2:46389833-46389855 GCTGGGAAGGAGGGGGCGGCCGG + Intergenic
931234588 2:60402553-60402575 GATGGGACACAGGGGGATGAAGG + Intergenic
931330081 2:61271692-61271714 GAGGGGAAGAAGGGGGAAGGAGG + Intronic
932144143 2:69304365-69304387 GATGGGAAGCTGAGGGATGGTGG + Intergenic
932356411 2:71071701-71071723 GGTGGGGACCAGGAGGACGCGGG + Exonic
933432263 2:82198025-82198047 GAAGGGAAGGAGGGAGACGTGGG + Intergenic
933918369 2:87019304-87019326 GGTGGGGAGCAGGGGGACTTTGG - Intronic
933935189 2:87198055-87198077 GATGTGAAGCAGAGGCACGGTGG + Intergenic
934004627 2:87750609-87750631 GGTGGGGAGCAGGGGGACTTTGG + Intronic
934971770 2:98770001-98770023 GACGGGAAGGAGGGGGAGTCAGG - Intergenic
934987788 2:98900125-98900147 GAGGGGAGGCAGGGGGACAGAGG + Intronic
934987806 2:98900188-98900210 GAGGGGAGGCAGGGGGACAGAGG + Intronic
934987844 2:98900309-98900331 GAGGGGAGGCAGGGGGACAAAGG + Intronic
934987864 2:98900370-98900392 GAGGGGAGGCAGGGGGATGGAGG + Intronic
936154229 2:110037678-110037700 GAGGGGAAGCTGGGGGACAGTGG - Intergenic
936190455 2:110333737-110333759 GAGGGGAAGCTGGGGGACAGTGG + Intergenic
936357958 2:111767843-111767865 GATGTGAAGCAGAGGCACGATGG - Exonic
936617244 2:114060898-114060920 GATGAGAATTAGGGGGACTCTGG - Intergenic
939091749 2:137787852-137787874 GATTGGGAGCAGGGGGACAGAGG - Intergenic
942940745 2:181613148-181613170 GAGGGGAAGCAAGGGGATGATGG - Intronic
942941362 2:181622065-181622087 GAGGTGAAGCAGGGGAACTCTGG + Intronic
944047647 2:195431366-195431388 GATGGAAGGCAAGGGGAAGCAGG - Intergenic
944086220 2:195850782-195850804 GAAAGGATGCAGGGGGAAGCAGG + Intronic
945976802 2:216277489-216277511 GATGGGAAGGGGGAGGAGGCAGG - Intronic
946347670 2:219124273-219124295 GCTGGGAAGCAGAGGAAAGCGGG + Intronic
946372551 2:219289809-219289831 GCTGAGAAGCAGGGGGAGCCGGG + Exonic
946551540 2:220806937-220806959 GAGGGGAAGCAGGGAGACTTAGG - Intergenic
946856065 2:223951026-223951048 GAAGGGGAGCAGGGGGAGGTTGG - Intergenic
947071028 2:226288032-226288054 GAAGGGAAGCAGGAGAGCGCAGG - Intergenic
947527425 2:230886990-230887012 GGTGGGAGGCAGGGGGAGGTGGG + Intergenic
947727635 2:232409906-232409928 GGTGGGGAGCAGGGGAACTCCGG - Exonic
947750894 2:232531481-232531503 GCTGGCAAGCAGGGTGAGGCCGG - Intronic
948174760 2:235934410-235934432 GACGCGAACCAGAGGGACGCCGG - Intronic
948573815 2:238937016-238937038 GACAGGAAGCAGGGGGACTCTGG - Intergenic
948669666 2:239559792-239559814 GATGGGCAGGAGGGTGAGGCGGG + Intergenic
948884303 2:240875220-240875242 GATGGGAAGGTGGAGGGCGCTGG + Intronic
1169357266 20:4917701-4917723 GGAGGGTAGCAGGGGGAAGCTGG - Intronic
1172009489 20:31838048-31838070 GATGGGGATCAGGGTGAAGCTGG + Intergenic
1172160816 20:32866749-32866771 GAAGGGAAGAAGGGGGAGGGAGG - Intronic
1172173984 20:32961319-32961341 GATGGGGAGGAGGCGGCCGCAGG - Intergenic
1172972176 20:38881551-38881573 GCTTGGAAGCAGGGGCAGGCTGG + Intronic
1173546380 20:43901408-43901430 TATGTGAAGCAGGGGGATGGTGG + Intergenic
1174053867 20:47785299-47785321 GGTGGGTGGCTGGGGGACGCGGG - Intronic
1174951829 20:55050793-55050815 GATGGGAAGGAGAGGGAAGCGGG + Intergenic
1175259033 20:57663423-57663445 GGTGGGCAGCAGGGGGACAGTGG + Intronic
1175722696 20:61296878-61296900 GATGGGTAGGTGGGGGACGATGG + Intronic
1175813518 20:61871938-61871960 GGTGGGATGCAGGGGAACCCTGG - Intronic
1176114968 20:63428238-63428260 GCTGGGACGCGCGGGGACGCTGG - Intronic
1176193336 20:63824696-63824718 GATGGGAAGATGGGGGAGGGAGG - Intronic
1176193351 20:63824748-63824770 GATGGGAAGATGGGGGAGGGAGG - Intronic
1176193366 20:63824800-63824822 GATGGGAAGATGGGGGAGGGAGG - Intronic
1176193381 20:63824852-63824874 GATGGGAAGATGGGGGAGGGAGG - Intronic
1176193396 20:63824904-63824926 GATGGGAAGATGGGGGAGGGAGG - Intronic
1176193411 20:63824956-63824978 GATGGGAAGATGGGGGAGGGAGG - Intronic
1176193426 20:63825008-63825030 GATGGGAAGATGGGGGAGGGAGG - Intronic
1176193441 20:63825060-63825082 GATGGGAAGATGGGGGAGGGAGG - Intronic
1178824581 21:36004863-36004885 GGGGGGAGGCAGGGGGAGGCAGG + Intergenic
1178824614 21:36004931-36004953 GAGGGGAGGCAGGGGGAAGCAGG + Intergenic
1179086588 21:38223825-38223847 GGTGGGAAGCAGAGGGAGGATGG - Intronic
1179460373 21:41530730-41530752 GATGGGAAGCAGGGGTCTCCTGG + Intronic
1179500808 21:41807518-41807540 GAGGGGAAGGAAGGGGACTCGGG - Intronic
1179792001 21:43761250-43761272 GATGGGAAGAAAGGAGAGGCTGG - Exonic
1179986857 21:44927075-44927097 GAAGGGAAGCTGGGGGGCCCAGG - Intronic
1181167141 22:20989794-20989816 GGTGGGAGGCAGGGGGAGCCAGG + Intronic
1183056121 22:35307087-35307109 CATGAGAAGCAGGGGGATTCAGG + Intronic
1184500441 22:44868302-44868324 GGTGGGGGGCAGGGGGACGGGGG + Intergenic
1184600243 22:45539137-45539159 GAAGGGAAGGAGGGGGAGGAGGG - Intronic
1184639264 22:45860453-45860475 GATGGAAAGGAGGAGGGCGCAGG - Intergenic
1184685861 22:46096054-46096076 GGTGGCAGGCAGGGGGACCCAGG + Intronic
1185089383 22:48757251-48757273 GATGGGAAGGAGGAGGAGGAGGG + Intronic
1185089412 22:48757352-48757374 GATGGGAAGGAGGAGGAGGAGGG + Intronic
950124132 3:10501247-10501269 GGCGGGAGGCAGGGGGAAGCGGG - Intronic
950525914 3:13523184-13523206 CACGGGAAGCAGGGGGAAGCTGG - Intergenic
953238662 3:41128156-41128178 GAGGGTGAGCAGGGGGACGGGGG + Intergenic
953405846 3:42659400-42659422 GAGGGGGAGGAGGGGGAGGCTGG + Exonic
953457130 3:43052344-43052366 GAAGGGAAGCAGGGAGCAGCAGG - Intronic
954263936 3:49459232-49459254 GATAGGAGGCAGGGGGACCTTGG + Intergenic
954406878 3:50350122-50350144 GATGGGAGAGAGGGGAACGCTGG - Intronic
957260274 3:77893092-77893114 GATGGGAAACAGCGGGTCGATGG - Intergenic
960732641 3:120743414-120743436 GAAGTGAAGCAGGGGGAAGCTGG + Intronic
962255673 3:133868423-133868445 GTTGCGAGGCAGGGGGACACAGG - Intronic
962409774 3:135130834-135130856 GATGAGAAACAGGGGCCCGCGGG + Intronic
962414356 3:135168649-135168671 GCAGGGAAGCAGGGAGACGAAGG - Intronic
966200124 3:177353433-177353455 GATTGGGAGCGGGTGGACGCTGG + Intergenic
966882620 3:184358825-184358847 GAAGGGAAGAAGGGGGAGGATGG + Intronic
968288170 3:197520160-197520182 GAGGGGAAGCAGGGAGAGGGAGG + Intronic
968438654 4:610037-610059 GATGGGAGACAGGGAGACACGGG + Intergenic
968693502 4:2008709-2008731 GTTGGGAATCTGGGGGCCGCGGG + Intronic
969300723 4:6295436-6295458 GATGGCAAGCAAGGGGCCCCTGG + Intronic
970980804 4:22094769-22094791 GATGGGAAGGAGAGAGAGGCGGG - Intergenic
972428410 4:38956804-38956826 GATGGGATGGATGGGGAAGCAGG - Intergenic
972980384 4:44692500-44692522 GATGTGAAACATGGGGAAGCAGG + Intronic
973063900 4:45763664-45763686 GATGCCAAGCATGGGGACCCTGG + Intergenic
977232082 4:94463616-94463638 GAAGGGAAGCAGGAGAAAGCAGG + Intronic
979531298 4:121771606-121771628 GATGGGAAGCTGGGTGGCGGGGG + Intergenic
981606450 4:146545962-146545984 GTTGGGAAGCATGGGGTCGAGGG + Intergenic
981614538 4:146633421-146633443 GACTGGGAGGAGGGGGACGCAGG - Intergenic
984881445 4:184413185-184413207 GATGGGAAGGAGTGGGAGGCAGG - Intronic
985070800 4:186165023-186165045 GGTGAGAAGCCGGGGGACACAGG - Intronic
985490058 5:174098-174120 GGTGGGAAGATGGGGGCCGCAGG + Exonic
985528717 5:421319-421341 GATGCGGGGCAGGGGGATGCCGG + Intronic
985926929 5:3026275-3026297 GAGGAGAAGCAGGGAGAGGCAGG - Intergenic
986610730 5:9564554-9564576 GGTGGGGAGCAGGGGGAAACAGG - Intergenic
986797238 5:11223962-11223984 GATGAGAAGCAGGGGATCCCAGG - Intronic
988825183 5:34929274-34929296 GAAGGGAGGCAGGGCCACGCTGG - Intergenic
989977634 5:50605623-50605645 GACGAGAAGCAGGGGAAGGCAGG - Intergenic
991275667 5:64843903-64843925 GAGGGGCAGCAGTGGGAGGCAGG - Intronic
998331085 5:141327858-141327880 GATGGTATGCAGGGTGATGCAGG - Intergenic
998407197 5:141880577-141880599 GATTGGAACCAGGGTGATGCTGG + Intergenic
1000091068 5:157930100-157930122 GAGGGGAAGAAGGGGGAGGAAGG + Intergenic
1000882193 5:166711199-166711221 GCTGGGGAGCAGGGGAAAGCAGG - Intergenic
1002169336 5:177366681-177366703 GAGGGGAAGGAGGGGGAGGCAGG - Intronic
1002478352 5:179482845-179482867 GATGGGAAGCCATGGGACCCAGG - Intergenic
1002804983 6:564640-564662 GAGGGGAAGCAGGGCTCCGCGGG + Exonic
1003548938 6:7084959-7084981 GATGGGAAGAAGAGGGCTGCTGG - Intergenic
1003552349 6:7109523-7109545 GGCGGGGAGCTGGGGGACGCGGG + Intronic
1003895005 6:10599131-10599153 TATGGGAAGCTGAGGGACGGAGG - Intronic
1004000516 6:11592931-11592953 AGTGGGAAGCAGTGGGAGGCAGG + Intergenic
1004319924 6:14624357-14624379 GGTGGGAAGCAGGAGAAGGCAGG + Intergenic
1005672886 6:28124848-28124870 GATGGGTGGAAGGGGGACACTGG + Intronic
1005885915 6:30097590-30097612 AATGGGAAGCAGGTGGGGGCAGG + Intergenic
1007585435 6:42986256-42986278 GAGGAGAAGCTGGGGGAGGCTGG - Intronic
1007692108 6:43709129-43709151 GAGGGGAAGGAGGGGGAGGAGGG - Intergenic
1008833757 6:55801898-55801920 GATGGGAAGCATGGGAAGACCGG - Intronic
1009032826 6:58081123-58081145 GATGGGATGATGGGGGATGCTGG - Intergenic
1009229399 6:61043952-61043974 GTTGGGAAGCAGGGGGTCAAAGG + Intergenic
1013482298 6:110563197-110563219 GGTGGGGAGCAGGGAGAAGCTGG + Intergenic
1014685760 6:124498204-124498226 GATGTGTAGCAGGGAGACCCAGG + Intronic
1014937372 6:127400172-127400194 GCTGGGAAGCAGGGAGAGTCAGG - Intergenic
1015638383 6:135303808-135303830 GTTGGGAAGCAGGGGGTGCCAGG - Intronic
1016266749 6:142241504-142241526 GATGGGAAGCACAGGGGCACAGG + Intergenic
1016602059 6:145873606-145873628 GCTGGGAAGCATGGGCATGCTGG - Intronic
1018128416 6:160704758-160704780 GGTGGGGAGCAGGGGGACTTTGG + Intronic
1018653749 6:166012234-166012256 GGTGGGAAGCAGGGAGACCCAGG + Intergenic
1018681661 6:166270351-166270373 GATGAGAAGCAGGAGGATTCTGG + Intergenic
1019378870 7:711296-711318 GAAGGGAAGCAGCGGGCGGCGGG + Intronic
1019476908 7:1248721-1248743 GATGAGAAGCTGGAGGATGCTGG + Intergenic
1019593227 7:1846176-1846198 GAAGGGCAGCAGGGGGAGACTGG - Intronic
1019602719 7:1893297-1893319 GATGGGAAGCAGAGTGGCGGGGG + Intronic
1019828440 7:3301962-3301984 GCCGGGAAGCGGGGGGACCCCGG - Intronic
1019856452 7:3613207-3613229 TTAGGGAAGCCGGGGGACGCAGG + Intronic
1021266046 7:18523907-18523929 AATGGGAAGCAGGGCGGAGCGGG - Intronic
1023469998 7:40507494-40507516 GATGGGTAGCAGGGGTAGGGGGG - Intronic
1024023311 7:45390397-45390419 GATGGGAAGGAGGTGGAGGGAGG + Intergenic
1026112378 7:67468938-67468960 GATGGGAAGAAGGAGAACTCAGG - Intergenic
1027721814 7:81752181-81752203 GAGGGGAAGAAGGGGGACCCTGG - Exonic
1029991550 7:104967162-104967184 GATGGGAAGGAGGAGGATCCAGG + Intergenic
1032226102 7:130032836-130032858 GATGGGAAGGAGGGGAAGGAGGG + Intronic
1032859819 7:135866310-135866332 GATGAGGAGGAGGGGGAAGCAGG - Intergenic
1033760995 7:144436681-144436703 GATGGGAAGCAGGATCACACGGG - Intergenic
1034182711 7:149150700-149150722 GAGGGGAGGCGGGGGGGCGCGGG - Intronic
1037167365 8:15847154-15847176 GACTGGAAGCAGGGAGAGGCAGG + Intergenic
1037728289 8:21502122-21502144 GATGGGAAGCAAGGAGACAGAGG + Intergenic
1037916361 8:22775632-22775654 GCTGGGAAGGAGGGGGACGGAGG + Intronic
1037951745 8:23023111-23023133 GATGGGAAGCGGGTGGGCACTGG - Intronic
1037965133 8:23128139-23128161 GATGGGAAGCAGGTGGGCGCTGG + Intergenic
1038053687 8:23837677-23837699 GAGGGGAAGCAGAGGGGAGCAGG + Intergenic
1038481813 8:27907174-27907196 GATGGGAAGCTGGGGGCCACAGG - Exonic
1038897709 8:31804498-31804520 TATGGGAAGTAGGGAGACCCAGG + Intronic
1039572962 8:38601888-38601910 GATGTGAAGCAGCGGGACAGAGG - Intergenic
1040104931 8:43536154-43536176 GCTGGGATGCAGGGAGAGGCAGG + Intergenic
1040298219 8:46174281-46174303 GATGAGAAGCAGCGAGACTCAGG + Intergenic
1041413099 8:57578270-57578292 GATGGGAGGCAGGTGGAGCCAGG + Intergenic
1041659958 8:60391891-60391913 CATGGGCAGCAGGGGCAGGCAGG - Intergenic
1045367853 8:101493360-101493382 GCTGGGAGGCCGGGGGGCGCGGG + Intronic
1045685117 8:104703643-104703665 GAAGGGAAGCAGGGAGAGGGAGG - Intronic
1047676196 8:127205797-127205819 GATGGTAAGCAGGGGCACAATGG + Intergenic
1049035298 8:140070933-140070955 GTTGTGAAGCAGAGGGACGGGGG + Intronic
1049688415 8:143948490-143948512 GATGGGAAGCTAGGGGAAGGAGG - Intronic
1049843116 8:144786923-144786945 GATGGGAAGCCTCGGGCCGCTGG + Intronic
1050767054 9:9147756-9147778 GAAGGGAAGCAGGGAGAGGGGGG - Intronic
1051522125 9:18000964-18000986 GATGAGAAGTAGGGGGAACCTGG + Intergenic
1051806376 9:20997178-20997200 GATGGGAAGGAGAGGGAAGCTGG - Intergenic
1053503658 9:38621840-38621862 GCTGGGAAGCCAGGGGCCGCCGG + Intergenic
1053611215 9:39714910-39714932 GAGGGGAAGGAGGGAGATGCGGG - Intergenic
1053869255 9:42472958-42472980 GAGGGGAAGGAGGGAGATGCAGG - Intergenic
1054087039 9:60756248-60756270 GAGGGGAAGGAGGGAGATGCGGG + Intergenic
1054242305 9:62627480-62627502 GAGGGGAAGGAGGGAGATGCGGG + Intergenic
1054556431 9:66661998-66662020 GAGGGGAAGGAGGGAGATGCGGG + Intergenic
1054828609 9:69598566-69598588 GATAGGAAGCAGAGGGAAGGTGG + Intronic
1054879511 9:70130223-70130245 TGAGGGATGCAGGGGGACGCAGG + Intronic
1056799298 9:89680374-89680396 GATGGGAAAAAGGTGGAAGCTGG + Intergenic
1057047861 9:91899636-91899658 GATGGGGAGGAGGGGGCAGCTGG + Intronic
1057152475 9:92808057-92808079 GCTGGGAAGCCAGGGGCCGCGGG - Intergenic
1057747130 9:97761341-97761363 GATTGGCAGCAGAGGGAGGCAGG + Intergenic
1057752155 9:97802019-97802041 GTTGGGAAGCTGGGGGACGCAGG - Intergenic
1057832364 9:98417122-98417144 GCTGGGAAGCAGCAGGATGCAGG + Intronic
1059268937 9:113060595-113060617 GATGGAGGGCAGGGGGAGGCGGG - Intergenic
1059270073 9:113066044-113066066 GATGGAGGGCAGGGGGAGGCGGG - Intergenic
1059271207 9:113071492-113071514 GATGGAGGGCAGGGGGAGGCGGG - Intergenic
1059272340 9:113076938-113076960 GATGGAGGGCAGGGGGAGGCGGG - Intergenic
1059273475 9:113082380-113082402 GATGGAGGGCAGGGGGAGGCGGG - Intergenic
1059274611 9:113087826-113087848 GATGGAGGGCAGGGGGAGGCGGG - Intergenic
1060528095 9:124331865-124331887 GATGGGACGCAGGGTGGGGCTGG - Intronic
1061141696 9:128771527-128771549 GAGGCGAAGGAGGAGGACGCAGG + Intronic
1061151351 9:128829899-128829921 GACGGGCTGCAGGGGTACGCGGG + Intergenic
1061887988 9:133602432-133602454 GGAGGGAAGCAGGGGGAGGGAGG - Intergenic
1062578858 9:137221058-137221080 GGCGGGAAGCAGGGGGCAGCCGG + Exonic
1185661916 X:1735173-1735195 GAAGGGAAGGAGGGGGAGGAGGG - Intergenic
1187190314 X:17028198-17028220 TATGGGAAGCAGAGGCACGTGGG + Intronic
1189007181 X:37008876-37008898 GAGAGGAAGCTGGAGGACGCAGG + Exonic
1192201150 X:69067500-69067522 GAAGGGAAGGAGGGGGAAGGAGG + Intergenic
1193163169 X:78252351-78252373 GGTGGGGAGCAGGGGGAAGTGGG - Intergenic
1195592187 X:106642394-106642416 GAAGGGTAGCAGGGGGGTGCGGG - Intronic
1195937902 X:110142884-110142906 GCTGGGAGGCAGGGTGAGGCAGG + Intronic
1196050433 X:111298372-111298394 GATGGGAACCAGGTGAATGCAGG + Exonic
1196069420 X:111503653-111503675 GATGGGAAGCAGTAGCACGATGG + Intergenic
1196871329 X:120116028-120116050 GATGGGAAGTTGGGGGGTGCGGG + Intergenic
1200714307 Y:6520373-6520395 GATTGGCCGCAGGGGGAGGCTGG + Intergenic
1201019515 Y:9640784-9640806 GATTGGCCGCAGGGGGAGGCTGG - Intergenic
1202124252 Y:21554903-21554925 GCTGGCAAGCAGGGTGCCGCTGG - Intergenic
1202154756 Y:21874477-21874499 GCTGGCAAGCAGGGTGCCGCTGG + Intergenic