ID: 1089357914

View in Genome Browser
Species Human (GRCh38)
Location 11:117867351-117867373
Sequence ACTTTGCCACAGATGCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089357914_1089357917 15 Left 1089357914 11:117867351-117867373 CCACACTGCATCTGTGGCAAAGT 0: 1
1: 0
2: 0
3: 11
4: 181
Right 1089357917 11:117867389-117867411 ACTTGCAGTATCTCTCTAATTGG 0: 1
1: 0
2: 2
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089357914 Original CRISPR ACTTTGCCACAGATGCAGTG TGG (reversed) Intronic
900308713 1:2023366-2023388 ACTGTGCCAGACAGGCAGTGTGG + Intronic
904133906 1:28296301-28296323 ACTTTGCCAAATATCCCGTGAGG - Intergenic
905443952 1:38012739-38012761 ACTTGGCGGCAGAGGCAGTGCGG + Exonic
909447828 1:75767185-75767207 ATTTTTCCACAGACACAGTGGGG - Intronic
913607977 1:120483410-120483432 ATTTTGGAACAGGTGCAGTGCGG - Intergenic
914767318 1:150650107-150650129 ATTTTGCCCCACATTCAGTGAGG - Intronic
915062753 1:153199975-153199997 ACTTTGCCAAAAAAGCAGCGAGG + Intergenic
916117521 1:161499762-161499784 ACTTTGACACAAATGAAATGGGG - Intergenic
916143990 1:161723781-161723803 ACTATGCGAGAGATGCAGTAAGG + Intronic
916169878 1:161993885-161993907 ACTTTCCCAAAGGTGCAGGGAGG - Intronic
916476097 1:165170380-165170402 TCTGTAACACAGATGCAGTGTGG + Intergenic
917203447 1:172542650-172542672 ACTTTGCCATGGATGGGGTGGGG - Intronic
918565908 1:185931667-185931689 ACTGTGCTACAGCTGCAGTAAGG + Intronic
921213359 1:212918088-212918110 AATGTGCCACACATGCCGTGTGG - Intergenic
921629624 1:217417899-217417921 ACTTTGTCACAGAGGCAGGCAGG - Intergenic
922254422 1:223880588-223880610 ATTTTTCCACAGATGCAGGCGGG + Intergenic
1063089725 10:2851815-2851837 ACTTTGCCAAACCTGCAGTTTGG - Intergenic
1064216004 10:13401204-13401226 AATTTGCCACAGACCAAGTGTGG + Intergenic
1064269492 10:13852111-13852133 ATTTTTCCACAGATGGGGTGTGG - Intronic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1065009923 10:21411704-21411726 ATTTTTCCACAGATGCGGGGTGG + Intergenic
1066397515 10:35040712-35040734 ATTTTTCCACAGACGGAGTGCGG + Intronic
1067412571 10:46077903-46077925 TCTTTACCACTCATGCAGTGTGG + Intergenic
1068459775 10:57312276-57312298 ATTTTGTCACAGCTGCAGGGTGG - Intergenic
1070698248 10:78579044-78579066 ACTTGTCCACAGATGCAGAGAGG - Intergenic
1071323992 10:84493718-84493740 ACTTTTCCACAGATGGGGAGAGG + Intronic
1072424536 10:95318799-95318821 ATTTTTCCACAGATGGGGTGGGG + Intronic
1075901857 10:126049594-126049616 ACTTTGCCACAGTTGCCATAAGG + Exonic
1077893892 11:6439687-6439709 ACCTTGCCAAAGGTGCTGTGTGG - Intronic
1080722785 11:34866261-34866283 ATTTTCCCACAGATGGGGTGAGG - Intronic
1080896264 11:36450958-36450980 ACTGGGCCACCAATGCAGTGTGG - Intronic
1082879138 11:58021299-58021321 GATTTATCACAGATGCAGTGAGG - Intergenic
1083089380 11:60184395-60184417 ACTGTTTCACAGATGCTGTGAGG - Exonic
1086251800 11:84824820-84824842 ATGTTGCCACACATGCACTGTGG - Intronic
1086891798 11:92266998-92267020 ACTTTGCCACTGCTCCAGTCTGG + Intergenic
1089035317 11:115383591-115383613 ACTTAGCCACTGATGCAGGTGGG - Intronic
1089357914 11:117867351-117867373 ACTTTGCCACAGATGCAGTGTGG - Intronic
1089539133 11:119179501-119179523 AGTTTGCCACATAGGCAGTAGGG + Intronic
1091007953 11:131970719-131970741 TTTTTACCACAGATGCAGGGTGG + Intronic
1091204807 11:133812857-133812879 AAGTTGCCACAGATGAAGTGAGG + Intergenic
1092505073 12:9090397-9090419 CCGTTTGCACAGATGCAGTGAGG + Exonic
1092554554 12:9543196-9543218 ATTTTTCCACAGATGGGGTGGGG + Intergenic
1094517545 12:31147439-31147461 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1097041323 12:56157870-56157892 TTTTTTCCACAGATCCAGTGGGG + Exonic
1104760807 12:131296702-131296724 CCCTTCCCACAGCTGCAGTGAGG - Intergenic
1104818968 12:131664090-131664112 CCCTTCCCACAGCTGCAGTGAGG + Intergenic
1105674417 13:22654992-22655014 ACTTTGATACAAATGCACTGAGG + Intergenic
1106259723 13:28055868-28055890 ACTGTCCCACAGAGGCGGTGAGG + Intronic
1106474310 13:30084301-30084323 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1106748777 13:32734697-32734719 AGTATGCCACATATGCACTGAGG - Intronic
1106901769 13:34361065-34361087 ACTTCTGCACAGATGCAGGGAGG + Intergenic
1108427581 13:50319367-50319389 ACTTTTCCACAGACACAGAGTGG - Intronic
1112375402 13:98835579-98835601 CCTTTGCCACAGGACCAGTGAGG + Intronic
1113088090 13:106588623-106588645 ACTTTGCCAGAGAGGCTGTGGGG - Intergenic
1113139092 13:107127339-107127361 CCTTATCCACAGAGGCAGTGTGG - Intergenic
1115715969 14:36104184-36104206 ACTTGGCCAAAGTTGCAGTTTGG + Intergenic
1117437037 14:55725992-55726014 ACTTTGCATGGGATGCAGTGTGG + Intergenic
1118604445 14:67492460-67492482 ACTTTGCCAGTGAGGCTGTGAGG - Intronic
1119819169 14:77599234-77599256 ACTTTGGAACAACTGCAGTGAGG + Intronic
1120862704 14:89269161-89269183 AATTTGACACAGTTGCAGTTTGG - Intronic
1121220722 14:92283404-92283426 ACTATGCCTTAGAAGCAGTGTGG - Intergenic
1121423555 14:93832516-93832538 ACTTGACCACAGCTGCAGTTTGG + Intergenic
1123148076 14:106153612-106153634 ACTGTACCACAGACACAGTGAGG - Intergenic
1123717219 15:23041194-23041216 ACTTGGCCAGAGGTGCTGTGGGG + Intergenic
1123717954 15:23043681-23043703 ACTTGGCCAGAGGTGCTGTGGGG + Intergenic
1123718161 15:23044387-23044409 ACTTGGCCAGAGGTGCTGTGGGG + Intergenic
1124111195 15:26790259-26790281 ACATTGCCACAGATGCTCCGCGG + Intronic
1127706224 15:61549736-61549758 ACTTGGCCAGAGCTGCAGAGTGG + Intergenic
1129671711 15:77611303-77611325 ACTCTTACACAGATGCAGAGGGG - Intergenic
1130995322 15:88900290-88900312 ACTTTGCCACACATGGTGTTCGG + Intronic
1132352495 15:101148713-101148735 ACTTTCCCTCAGATACAGGGTGG - Intergenic
1136682185 16:31974357-31974379 ACTGTACCACAGACACAGTGGGG + Intergenic
1136887355 16:33938327-33938349 ACTGTACCACAGACACAGTGAGG - Intergenic
1138067808 16:53960127-53960149 ACTTTGTTAAAGATGCAATGGGG + Intronic
1138556962 16:57776361-57776383 ACTTGGCAACAGAGGCAGGGTGG - Intronic
1140809988 16:78567722-78567744 ACTCAGCCACAGAGGCAGGGTGG - Intronic
1141633325 16:85300949-85300971 ACATAGGCAGAGATGCAGTGGGG + Intergenic
1203085098 16_KI270728v1_random:1179511-1179533 ACTGTACCACAGACACAGTGAGG + Intergenic
1144676690 17:17166609-17166631 GCTTTGCCACACAGTCAGTGAGG + Intronic
1146457435 17:33018591-33018613 GCTTTGCTGCAGAGGCAGTGTGG + Intronic
1153693321 18:7615685-7615707 ATTTTTCCACAGATGGGGTGGGG + Intronic
1157635438 18:49148870-49148892 ATTTTTCCACGGATGCAGGGTGG + Intronic
1157688761 18:49664135-49664157 CCCTTGCCCCGGATGCAGTGTGG + Intergenic
1157717208 18:49896173-49896195 AAAATGCCACAGATGCTGTGGGG + Intronic
1157749431 18:50165051-50165073 ATTTTCCCCCAGCTGCAGTGAGG - Intronic
1158176137 18:54658299-54658321 AATTTGCCACAGCAGCAATGAGG - Intergenic
1158862893 18:61610378-61610400 ACTTTTCCACAGACGCGGAGGGG + Intergenic
1162948263 19:14056483-14056505 ACTTTGCAACAGTTGCAGCTGGG + Exonic
1164037344 19:21466583-21466605 ATCTCGCCACAGAAGCAGTGGGG + Intronic
1164952890 19:32353508-32353530 TTTCTGCCACAGATGCAGTTTGG - Exonic
1165057153 19:33184902-33184924 AATTTCCCACAAATGAAGTGCGG - Intronic
925127810 2:1473342-1473364 ACTTTGTCACAGAAGAACTGGGG + Intronic
926177122 2:10603984-10604006 ATTTTTCCACGGATGCAGGGAGG + Intronic
935433121 2:102999385-102999407 ATTTTTCCACAGATGAGGTGTGG - Intergenic
937007243 2:118528300-118528322 CCTTTGGCAGAGAAGCAGTGTGG + Intergenic
937291724 2:120785913-120785935 CCTTTGCCAATGATGCAGCGGGG - Intronic
937598179 2:123695492-123695514 GCTTTGCCAGAGATTCTGTGTGG + Intergenic
945275796 2:207986339-207986361 ACTTTGACAGAGAAGCAGTCCGG - Intronic
946447038 2:219748784-219748806 TATTTGCCACGGATGCAGTTGGG + Intergenic
946517184 2:220425539-220425561 ACATGGCCACAGCAGCAGTGGGG - Intergenic
948800915 2:240433169-240433191 GCTCTTCCACAGGTGCAGTGAGG - Intergenic
1168966105 20:1898951-1898973 CCTTTGCGACAGATGGAGAGGGG + Intronic
1172600652 20:36180347-36180369 ACCTTGCCCCAGGTGCACTGAGG - Intronic
1180613899 22:17115079-17115101 ACTTTGTGACAGGTGCAGTAGGG - Exonic
1181333364 22:22111613-22111635 AATTTCCCAGAGATGCAGAGAGG - Intergenic
1181369538 22:22405151-22405173 ACCTGGCCACAGCTACAGTGAGG - Intergenic
1181633072 22:24161579-24161601 CCTTTCCCTCAGATGCCGTGGGG + Intronic
1182077737 22:27506390-27506412 ACTTTGGCACTGATGGACTGCGG - Intergenic
1182444370 22:30381434-30381456 AACTTGCCCCAGATGCGGTGTGG + Intronic
1182882243 22:33743566-33743588 ACTTTTACAGAGAAGCAGTGAGG - Intronic
1184476032 22:44721948-44721970 ACTTTGAGACAGATGCTGCGTGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950655551 3:14434129-14434151 TCTTTGCCTCAGCTTCAGTGTGG + Intronic
953814943 3:46147493-46147515 AGTTTTCCACAGACCCAGTGTGG + Intergenic
954098325 3:48349013-48349035 ACTTTGGCAGAGATTCAGTAAGG + Intergenic
955148031 3:56339436-56339458 ACTTTGGCACTGCTGAAGTGCGG + Intronic
955984620 3:64559720-64559742 ACCTTGCCACATATGCACTGAGG - Intronic
956885367 3:73553789-73553811 ACTTTGCCAGAGCTGAAGTAGGG - Intronic
959260579 3:104074610-104074632 AATTTTCCACAGATGTAGAGAGG + Intergenic
960297081 3:115957483-115957505 AGGTTGCCACAGCTGCACTGGGG - Intronic
960452004 3:117821462-117821484 TCTTTGCCACATAGCCAGTGCGG + Intergenic
963507046 3:146199383-146199405 ACCTTGCCACAGATAAAGAGTGG - Intronic
964809219 3:160644650-160644672 AACTTGCAACAGATGCAATGGGG + Intergenic
968748736 4:2375143-2375165 ATTTTGCCACAGCAGCAGGGAGG - Intronic
969095374 4:4728863-4728885 ATTGTGGCACAGAGGCAGTGTGG + Intergenic
970319251 4:14859763-14859785 ACTCTGTCCCAGATGCTGTGTGG - Intergenic
970415039 4:15848299-15848321 AATTAGCCACAGAAGCTGTGGGG + Intronic
970935158 4:21561101-21561123 GCTTTGCCACAGCTGGAGTCTGG + Intronic
972162313 4:36242417-36242439 ACTTTCTCACAGTTGCAGGGAGG + Intronic
977390182 4:96399299-96399321 ACTTTTTCAGAGCTGCAGTGAGG - Intergenic
978275978 4:106950445-106950467 CCTTTTCCACAGGTGCAGTAGGG - Intronic
978895576 4:113883299-113883321 ACTTTGTCACCCATGCAGGGTGG - Intergenic
979920797 4:126493414-126493436 ATTTTTCCACAGATGAAGTAGGG + Intergenic
982608850 4:157548714-157548736 CCATGGCCACAAATGCAGTGTGG + Intergenic
982966126 4:161910595-161910617 AATTTGCCACAGATTGAGTATGG - Intronic
984384063 4:179032643-179032665 ATTTTGGAATAGATGCAGTGTGG - Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
985921335 5:2978572-2978594 ACTTTACCAAAGTTACAGTGAGG - Intergenic
988130746 5:27101542-27101564 ACTTTTCCACAGATGTTGTGGGG - Intronic
988440644 5:31228584-31228606 ATTTTTCCACAGATGTGGTGGGG + Intronic
989715601 5:44458670-44458692 AGTTTGCCCCATTTGCAGTGGGG - Intergenic
990651578 5:57906194-57906216 TCTTTCACGCAGATGCAGTGGGG + Intergenic
991172665 5:63646599-63646621 ATTTTTCCACAGATGGGGTGGGG + Intergenic
991629929 5:68646232-68646254 TCCTTGCCACAAAAGCAGTGTGG + Intergenic
994097355 5:95858988-95859010 CGTTTGCCACAGCTGCAGCGGGG - Exonic
994708876 5:103241528-103241550 ATTTTTCCACAGATGAGGTGTGG - Intergenic
999270885 5:150295758-150295780 ACTCAGCCACATCTGCAGTGGGG + Intergenic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1010877149 6:81120763-81120785 ACTTTTCCACAGATGGGGTGTGG - Intergenic
1013398212 6:109765140-109765162 AGTTTGATACAGATGCAGTTAGG + Exonic
1015465618 6:133544975-133544997 CCTTTGACAGAGATGCATTGTGG + Intergenic
1016272640 6:142306405-142306427 AGTTTGCAACAGAGGTAGTGTGG + Intronic
1016990679 6:149925861-149925883 ACTTTGCCACCGGCTCAGTGTGG + Intergenic
1016992311 6:149938611-149938633 ACTTTGCCACCGGCTCAGTGTGG - Intergenic
1017007412 6:150038001-150038023 ACTTTGCCACCGGCTCAGTGTGG + Intergenic
1017260106 6:152376021-152376043 ATTTTTCCACAGATGGGGTGGGG + Intronic
1017806026 6:157946238-157946260 AGCTTGCTACAGATGCAGTGTGG - Intergenic
1018886158 6:167939850-167939872 ACATTGTCACAGATAGAGTGAGG + Intronic
1019503452 7:1377383-1377405 ACTTTGTCACAGCAGCAGTAGGG - Intergenic
1019837068 7:3398573-3398595 ACTTTTCCCCAGATGCATTTTGG + Intronic
1020672517 7:11135042-11135064 ATTTTGTAACAGATGCAATGAGG - Intronic
1022606381 7:31818788-31818810 AATTTGCCATGGATTCAGTGGGG - Intronic
1026137839 7:67679113-67679135 ACTTTGCCACAGATGAGCTGCGG + Intergenic
1028078460 7:86544577-86544599 ACTTTACCACAGATGAGGTCTGG - Intergenic
1031488020 7:122353160-122353182 ATTTTCCCACCCATGCAGTGAGG - Intronic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1032286193 7:130540005-130540027 TCTTTGCTATGGATGCAGTGGGG + Intronic
1033539649 7:142345018-142345040 ACATGACCACGGATGCAGTGTGG - Intergenic
1033918149 7:146353562-146353584 ACATTGCCACATAAGCAGTTGGG - Intronic
1034294865 7:149963245-149963267 ACTCTGTCCCAGATACAGTGGGG + Intergenic
1034811199 7:154133707-154133729 ACTCTGTCCCAGATACAGTGGGG - Intronic
1040805195 8:51387501-51387523 TGTTTGTCACAGATGCAGTAGGG + Intronic
1040885340 8:52256645-52256667 TGGTTGCCACAGATACAGTGTGG + Intronic
1041483130 8:58345150-58345172 AATTTTCCACAGATGGGGTGGGG + Intergenic
1041661460 8:60405421-60405443 GCTTTGCCAAGGATGCAGTCTGG - Intergenic
1044774544 8:95674712-95674734 ACTCTCCCAAAGATACAGTGAGG + Intergenic
1045716490 8:105053012-105053034 ATTTTCCCACAGAAGCAATGAGG + Intronic
1046405122 8:113763302-113763324 ACATTGCACCAGATGGAGTGGGG + Intergenic
1047043078 8:121020622-121020644 ATTTTGACAGAGAGGCAGTGAGG + Intergenic
1047858587 8:128939339-128939361 ACTTTTACACACATGCACTGAGG + Intergenic
1047923742 8:129661637-129661659 ACTTTGACACTGGTGCAATGTGG - Intergenic
1056502087 9:87219558-87219580 AAACTGTCACAGATGCAGTGCGG + Intergenic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1059052513 9:110941799-110941821 AGTTGGCCACAGATGCCGTCAGG + Exonic
1060156626 9:121324830-121324852 CCATGGCTACAGATGCAGTGTGG - Intronic
1060395430 9:123313168-123313190 ACTCTGCCACAGAGGCTGTGTGG + Intergenic
1061111982 9:128579710-128579732 ACTATGCCTCAGATGAAGTGAGG + Exonic
1193324410 X:80162594-80162616 ATTTCTCCACAGATGGAGTGGGG - Intergenic
1194357849 X:92909109-92909131 AGTTTGCAACAGAGACAGTGTGG + Intergenic
1197986357 X:132270061-132270083 ACTTAGGCAGAAATGCAGTGAGG - Intergenic
1199243751 X:145578334-145578356 ACCTTGCCACAAATGCAGCTAGG - Intergenic
1199247549 X:145624775-145624797 ACCTTGCTGCAGCTGCAGTGGGG - Intergenic
1200672390 Y:6110339-6110361 ACATTCCCACCGAAGCAGTGTGG - Intergenic