ID: 1089360391

View in Genome Browser
Species Human (GRCh38)
Location 11:117882157-117882179
Sequence CATTCTATGAAGAGGGATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089360391_1089360399 22 Left 1089360391 11:117882157-117882179 CCGGCATCCCTCTTCATAGAATG No data
Right 1089360399 11:117882202-117882224 TACTTAGATACCTTTATATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089360391 Original CRISPR CATTCTATGAAGAGGGATGC CGG (reversed) Intergenic
No off target data available for this crispr