ID: 1089362857

View in Genome Browser
Species Human (GRCh38)
Location 11:117902484-117902506
Sequence CCTGTTCCCCAGGCAGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 296}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089362848_1089362857 -6 Left 1089362848 11:117902467-117902489 CCCTATCTGAGCCCTCCCCTGTT 0: 1
1: 0
2: 1
3: 15
4: 263
Right 1089362857 11:117902484-117902506 CCTGTTCCCCAGGCAGAGAAGGG 0: 1
1: 0
2: 1
3: 33
4: 296
1089362847_1089362857 -5 Left 1089362847 11:117902466-117902488 CCCCTATCTGAGCCCTCCCCTGT 0: 1
1: 0
2: 0
3: 17
4: 241
Right 1089362857 11:117902484-117902506 CCTGTTCCCCAGGCAGAGAAGGG 0: 1
1: 0
2: 1
3: 33
4: 296
1089362845_1089362857 7 Left 1089362845 11:117902454-117902476 CCTTTTCTGCTCCCCCTATCTGA 0: 1
1: 0
2: 3
3: 19
4: 319
Right 1089362857 11:117902484-117902506 CCTGTTCCCCAGGCAGAGAAGGG 0: 1
1: 0
2: 1
3: 33
4: 296
1089362846_1089362857 -4 Left 1089362846 11:117902465-117902487 CCCCCTATCTGAGCCCTCCCCTG 0: 1
1: 0
2: 1
3: 40
4: 413
Right 1089362857 11:117902484-117902506 CCTGTTCCCCAGGCAGAGAAGGG 0: 1
1: 0
2: 1
3: 33
4: 296
1089362849_1089362857 -7 Left 1089362849 11:117902468-117902490 CCTATCTGAGCCCTCCCCTGTTC 0: 1
1: 0
2: 3
3: 40
4: 690
Right 1089362857 11:117902484-117902506 CCTGTTCCCCAGGCAGAGAAGGG 0: 1
1: 0
2: 1
3: 33
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089362857 Original CRISPR CCTGTTCCCCAGGCAGAGAA GGG Intronic
900555765 1:3279625-3279647 CCTGTGCCACAGGCTGAGGACGG + Intronic
900735152 1:4295073-4295095 CCAGGTCCCCACCCAGAGAAGGG - Intergenic
901653171 1:10754695-10754717 GCTGCTCTCCAGGCAGAGAGAGG - Intronic
901668955 1:10842959-10842981 CCAGTTCCGCAGGCAGAGACTGG + Intergenic
903055034 1:20630004-20630026 CCTGTGCCCCTGGCACAGTAAGG + Intergenic
903606086 1:24576170-24576192 CCAGTTTCCCAGCCACAGAAAGG + Intronic
903774443 1:25783641-25783663 CCTGTGCCCCACGCAGGGCAGGG - Exonic
904422086 1:30400688-30400710 GCTGTTCCCCAGGAAGTGATGGG - Intergenic
905569412 1:38991704-38991726 CCTTTTCTCAAGGCAAAGAAGGG - Intronic
907371389 1:54005746-54005768 CCTGTTCCCCACCCATAGGAGGG + Intergenic
907919793 1:58901964-58901986 TATGCTCTCCAGGCAGAGAAAGG + Intergenic
908363932 1:63398205-63398227 CCTGTTCCCTAGTCAGAGTTTGG + Intronic
909563864 1:77033751-77033773 ACTGTTTCCCAGGAACAGAAAGG + Intronic
911058120 1:93724701-93724723 CCTGTGGCCCATCCAGAGAAGGG - Intronic
911268546 1:95773226-95773248 CTTGTTCTACAGGCAAAGAAAGG + Intergenic
911744983 1:101431632-101431654 GCTCTTCCCCAGGCAGAAAATGG - Intergenic
911958050 1:104262915-104262937 CTTGTCCGCCAGGCAGGGAAGGG - Intergenic
912171237 1:107101936-107101958 AGAGTTCACCAGGCAGAGAAAGG + Intergenic
912238660 1:107881362-107881384 CCAGTGCCCAAGGCAGAGAGAGG - Intronic
912557111 1:110524406-110524428 GCTGTTCCTTAGTCAGAGAATGG + Intergenic
913305282 1:117424203-117424225 CCTTCTCCTGAGGCAGAGAATGG + Intronic
914676893 1:149912851-149912873 CTTGTTCCCCAATCAGTGAAAGG + Intronic
915252822 1:154602694-154602716 GCTGTTCCACAGGCAGCAAAGGG - Intronic
915273736 1:154773883-154773905 CCTTCTCCCCACTCAGAGAAGGG + Intronic
916420304 1:164631918-164631940 CTTGTTCCACAGGCAGAGCCTGG + Intronic
918127230 1:181595426-181595448 CATGTTCCCCAGGCACAGGCGGG + Intronic
918520725 1:185412169-185412191 GCTGTGCCCTAAGCAGAGAAAGG + Intergenic
919834969 1:201567239-201567261 CCTGTTCCCCATGAAGAGGGTGG - Intergenic
920966842 1:210708128-210708150 CTTATTCTCCAGGCAAAGAAGGG + Intronic
921297917 1:213722107-213722129 CATGTACTCCAGGCAGAAAAAGG + Intergenic
921714696 1:218405974-218405996 ACTGTTCCCCAGGAAGAAATCGG - Intronic
921791017 1:219290649-219290671 GCTATTCCGCAGACAGAGAAGGG - Intergenic
922491636 1:226021731-226021753 CCTGTGTCCCAGGCAGACTAAGG + Intergenic
924657742 1:245988738-245988760 GGTGTTCCTCTGGCAGAGAACGG + Intronic
1063438460 10:6053288-6053310 ACAGTTCACCAGGCAGAAAATGG + Intronic
1064373941 10:14778707-14778729 GCTGCTCCACAGGCAGAGCAGGG + Intergenic
1067475188 10:46560217-46560239 CCTGTTCCCAAGGCTGAGGCAGG + Intergenic
1069566550 10:69467169-69467191 CCTCTTCCCCATGCAGTGAGGGG + Intronic
1070856369 10:79610836-79610858 CCTGTGCTCCAGGCAGGAAATGG - Intergenic
1071493480 10:86152412-86152434 CCTGTCTCTGAGGCAGAGAAAGG + Intronic
1073797821 10:107007210-107007232 CCTCCTCCCAAGGCAGAGAGGGG + Intronic
1074309941 10:112313487-112313509 CCAGGTCCACAGGCAGAGACAGG + Intergenic
1075333894 10:121595792-121595814 CCTTGGCTCCAGGCAGAGAAAGG + Intronic
1076350477 10:129811675-129811697 CCTGTTCCCCCTGCTGAGGATGG - Intergenic
1076514460 10:131036040-131036062 CTGGTTCCCCAGCAAGAGAAAGG - Intergenic
1077186278 11:1236789-1236811 CCGGTTCCCCAGGCAGTGCCTGG - Intronic
1077193732 11:1268404-1268426 CCTGATCCCAGGGCAGAGAAGGG - Intergenic
1077207262 11:1350506-1350528 ACTGTTTCCTGGGCAGAGAAGGG - Intergenic
1077289795 11:1783717-1783739 CCTGCCCTCCAGGCAGAGGAGGG + Intergenic
1077393492 11:2310318-2310340 CCTGCTCTCCAGGAAGGGAAGGG + Intronic
1078374094 11:10778238-10778260 CCTTTTCCAAAGGCAGAAAAGGG - Intronic
1079095191 11:17505413-17505435 CAGGTTCCCCAGGCAGAGCCTGG - Intronic
1080551248 11:33375893-33375915 CCTGTCCCCCATCTAGAGAAGGG - Intergenic
1081682970 11:45021840-45021862 CATTTTCCCCAGGCAGTGACTGG - Intergenic
1083296081 11:61716315-61716337 CCTGTTTCCCAGGAGGAGAGTGG + Intronic
1083779730 11:64911586-64911608 CCTCTTCCATAGGAAGAGAAGGG - Intronic
1084148974 11:67279294-67279316 CCCTTTCTCCAGGCAGAGCAGGG - Intronic
1084946785 11:72642779-72642801 CCAGAGCCCCAGGCAGAGACCGG + Intronic
1085711338 11:78831549-78831571 GATATTCTCCAGGCAGAGAAGGG + Intronic
1089362857 11:117902484-117902506 CCTGTTCCCCAGGCAGAGAAGGG + Intronic
1089567604 11:119380321-119380343 CCAGTCCACCAAGCAGAGAAAGG + Intronic
1089701222 11:120245276-120245298 CCTGTGCCCCAGGGAAAGAGGGG - Intronic
1089985456 11:122808667-122808689 CCTCTCCCACAGGCACAGAAAGG - Intronic
1090024121 11:123153227-123153249 CCTCTCCCCCAGGCATAGAATGG + Intronic
1091212137 11:133871235-133871257 CAGGTTCCTCAGGCAGAGCAGGG - Intergenic
1091373963 12:14377-14399 CCTGTTTCTCTGGGAGAGAAGGG - Intergenic
1092489083 12:8928705-8928727 AATATTCCACAGGCAGAGAAGGG - Intronic
1095720003 12:45390436-45390458 CATTTTCCCCAGGCAGTAAAGGG - Exonic
1096065990 12:48741107-48741129 CTTGTTGCCCAGGCATACAATGG + Intergenic
1096222585 12:49841013-49841035 CATGTTGCCCAGGCTGGGAAAGG + Intronic
1096650707 12:53060748-53060770 CCTGTTTCCCAGGCAGGCACCGG + Exonic
1096841307 12:54380859-54380881 CATGTTGCCCAGGCTGAGAATGG - Intronic
1102499067 12:113338716-113338738 CCTATTCCCCAGGCTGAGAAAGG + Intronic
1103419405 12:120768335-120768357 CCAGTTTTCCAGGCAGAGACAGG + Exonic
1103458418 12:121085453-121085475 GCTGTTCCACAGACAGAGCAGGG - Intergenic
1104364884 12:128167901-128167923 CCTGGTCCCCAGGCAAAAAGGGG - Intergenic
1107126854 13:36855912-36855934 CCTCTTCCTCAGTCAGAGACTGG + Intronic
1107294176 13:38892744-38892766 TCTCTTCCCCAGGCAGCTAACGG - Intergenic
1107868966 13:44729684-44729706 CATGCCCCCCAGGCACAGAAAGG - Intergenic
1108440645 13:50449605-50449627 CCTGTTTCCCAGGAAGATAATGG + Intronic
1112131716 13:96532054-96532076 CCTGGTCCCCAGCAAGGGAAAGG + Intronic
1113505160 13:110811702-110811724 CCTGGTCCCCAGGGTGACAAGGG + Intergenic
1113564925 13:111314054-111314076 CGTGTTCCTCACTCAGAGAACGG - Intergenic
1114129376 14:19772090-19772112 CAAGTTCCCCTTGCAGAGAAAGG - Intronic
1115640421 14:35332321-35332343 CCTGTTCCCTGGGCAGAAGAGGG + Intergenic
1116666846 14:47787576-47787598 CCTGTTCTCTAGGCACAGAGAGG - Intergenic
1117024937 14:51609526-51609548 CAAATTCACCAGGCAGAGAAGGG + Intronic
1119136149 14:72222311-72222333 GCAGTTCCCCAGGCAGTGAGTGG - Intronic
1119383455 14:74242716-74242738 CATCTTCCCCAGGCAGGGACAGG + Intronic
1119385848 14:74257749-74257771 CCCGCTCCCCAGGAAGCGAAGGG + Intronic
1119780627 14:77274647-77274669 CCTGTTCACATGGCATAGAAAGG - Intergenic
1119893261 14:78198979-78199001 CCTGTTCCTCAGCCAGAAACTGG - Intergenic
1121266127 14:92603777-92603799 CCTTTTCCTCAGGCAGGAAAGGG + Intronic
1123627629 15:22238643-22238665 CCTGTGCCCCGGGCAGAGGGAGG - Intergenic
1123795372 15:23765534-23765556 TCTGGTCCCCAGGCAAGGAAGGG + Intergenic
1124302502 15:28556446-28556468 CCTCTTCCCCAGGCTGGGAGTGG - Intergenic
1126768958 15:52036128-52036150 CCTGTCACCCAGGCAGAGCCAGG - Intronic
1126913381 15:53438231-53438253 CCTGCTGCCCAGGAAGAAAAGGG + Intergenic
1127122902 15:55786629-55786651 CCAGCTCCCCAGGCAGGTAAGGG + Intergenic
1127282098 15:57501519-57501541 CCAGTTCCCCAGGCATAGCCTGG + Intronic
1129193210 15:73949609-73949631 CCTGCTCCCCAGGCAGGAAAGGG - Intronic
1129327359 15:74807985-74808007 CCAGTTGCCAGGGCAGAGAAGGG - Intergenic
1129328770 15:74816240-74816262 TCTACTTCCCAGGCAGAGAAGGG - Exonic
1129585293 15:76856830-76856852 ACTGTTGCCCAGGCTGAGTACGG - Intronic
1130358793 15:83160771-83160793 CCTGAGACCCAGGCAGAAAATGG - Intronic
1130751702 15:86719495-86719517 CCTGCTCCCTATGCATAGAAAGG - Intronic
1130835986 15:87650457-87650479 GCTAGTCCCCAGGCAGGGAAAGG - Intergenic
1131510616 15:93047716-93047738 CCAAGTGCCCAGGCAGAGAACGG - Intronic
1132806490 16:1777463-1777485 CCTGAACCCCAGGCAGGGAAGGG + Intronic
1134102366 16:11461173-11461195 CCCCATCCCCAGGCAAAGAAGGG + Intronic
1135547660 16:23376904-23376926 CCTGTCCACCAGGCAGGGATGGG + Intronic
1136177144 16:28524981-28525003 GCTGTTCCACAGACAGAGCAGGG - Intergenic
1138717940 16:59045796-59045818 CATGTTCCCAGGGAAGAGAAAGG + Intergenic
1139398063 16:66656555-66656577 CATGTTGCCCAGGCTGTGAAAGG + Intronic
1140454636 16:75097970-75097992 CGGTTTCCCCAGGCAGGGAAAGG - Intronic
1141805019 16:86336582-86336604 CCTCATCCCCACGCAGAGAGGGG + Intergenic
1203139871 16_KI270728v1_random:1755666-1755688 TCTCTTCCCCAGCCACAGAAAGG + Intergenic
1142468265 17:148005-148027 CTTGTGCCCCAGGAAGAGACAGG - Intronic
1144876157 17:18398546-18398568 CATCTTCCTCAGGCAGATAAAGG - Intergenic
1145002524 17:19315202-19315224 CCTGTTCACCAGCCAAAGGAGGG - Intronic
1145077583 17:19868116-19868138 TCTGCTCCCCAGGCCCAGAACGG - Intergenic
1145156071 17:20545874-20545896 CATCTTCCTCAGGCAGATAAAGG + Intergenic
1148327240 17:46790386-46790408 CCTGGGCCCCCTGCAGAGAAAGG + Intronic
1148992730 17:51680568-51680590 CCTGTTCCCCAGGGAGTGTTTGG + Intronic
1149866712 17:60155083-60155105 TCTGTTCCCCAGGCAGGGCCAGG - Intronic
1150098339 17:62399024-62399046 GCTGTTCAGCAGGCAGAGCAGGG - Intronic
1151169991 17:72237766-72237788 CCTGTTCCACAGGAAGGAAATGG - Intergenic
1151309991 17:73287105-73287127 CCTGGTCCTCAGAGAGAGAAGGG + Intronic
1152022664 17:77788855-77788877 CCTGTTTCTGAGGCAGAGATGGG - Intergenic
1152035405 17:77869255-77869277 CCAGTGTCCCAGGCAGAGGATGG + Intergenic
1152559634 17:81071533-81071555 CCTCTTCCACCAGCAGAGAAAGG + Intronic
1157147250 18:45176406-45176428 CCTGTTTCTCAACCAGAGAAAGG - Intergenic
1157542542 18:48521935-48521957 CAGTTTCCCCAGGGAGAGAATGG + Intergenic
1159034109 18:63260732-63260754 CCTATTCTCCTGGCAGATAACGG + Intronic
1159671462 18:71226308-71226330 CCAGTTTTCCAGGCAGAGACAGG - Intergenic
1159813083 18:73040397-73040419 TCTGACCCTCAGGCAGAGAATGG - Intergenic
1160158878 18:76455975-76455997 CCTGTTCCCCTCCCAGAGACTGG + Intronic
1160691817 19:463815-463837 CCTGTTTCCCACACAGTGAACGG - Exonic
1161801588 19:6419291-6419313 CCTGGCCCACAGGCAGAGAAAGG + Intronic
1162327611 19:10008149-10008171 CCTGGGCCCCAGGCTGAGATGGG - Intronic
1162459444 19:10805820-10805842 CTTGGTCCCCAGGGAGAGAACGG + Intronic
1162785434 19:13031901-13031923 CTTCTTCCCTAGGCAGAAAAGGG - Intronic
1163187976 19:15652999-15653021 TCTGTTCCCCAGGTAGGGAGGGG + Intronic
1163266787 19:16226806-16226828 CCAGTGCCCCAGGCAGAGCAGGG - Intronic
1163463689 19:17454564-17454586 TCTGATCCCCATGCAGGGAAGGG - Intronic
1164602022 19:29568585-29568607 CCTCATCACCAGGCAGAGCAGGG - Intergenic
1165389212 19:35528682-35528704 CCAGCTCCCCAGGCAGTGAGGGG + Intergenic
1165947001 19:39449586-39449608 CCTCTCCCCCAGGCAGAGTCAGG - Intronic
1166072376 19:40394757-40394779 CCTGGGCTCCAGGCAGAGACAGG + Exonic
1167607587 19:50489669-50489691 TCTGTGACCCAGGGAGAGAAAGG + Exonic
1168310309 19:55456633-55456655 GCTGTTCCCCGGGCCTAGAATGG + Intronic
925882364 2:8363494-8363516 CCTCTTCTCCATGGAGAGAATGG - Intergenic
927100122 2:19781576-19781598 ACTGTGCCCCAGGCAGACACAGG - Intergenic
927420129 2:22922261-22922283 CCTGAACACCAGGCAGAGACTGG - Intergenic
928421366 2:31139560-31139582 TCTGCTCCCCAGACAGAGCAAGG - Intronic
929531593 2:42756285-42756307 ACATTTCCCCAGGCAGAGAGAGG + Exonic
929581129 2:43082385-43082407 CCTGTTCACCAGGAAGGAAATGG - Intergenic
931673632 2:64672092-64672114 CGTGTTTCCCAGGAGGAGAAGGG + Intronic
933445804 2:82378236-82378258 CCTTTTCCACAGGCAGAAATTGG - Intergenic
935123011 2:100198593-100198615 CGGGTGCCCCAGGCAGAGCAGGG - Intergenic
935128757 2:100245819-100245841 CCAGTCCCCCAGGCAGAACATGG + Intergenic
935222381 2:101026673-101026695 CCTGCTACCCTGGCAGAGACGGG - Intronic
935992867 2:108737658-108737680 CCTATTCCGGAGGCAGAGACAGG - Intronic
936952380 2:117991230-117991252 CCTGTTGCCCAGCCAAAGAATGG - Intronic
937253654 2:120540018-120540040 CCTGTGCTCCATGCAGTGAAGGG - Intergenic
939904713 2:147897478-147897500 CCTGTGGCCCAGGCAGTTAAGGG - Intronic
940683305 2:156813860-156813882 CCTGCACGGCAGGCAGAGAATGG - Intergenic
942860259 2:180600743-180600765 ACTGTTCCACAGGCATAAAATGG + Intergenic
944052814 2:195490777-195490799 CCTGTCGCCCAGGCTGAGTACGG + Intergenic
944274283 2:197818361-197818383 CCTTTTCCCCAGGCTGAGTAAGG + Intronic
944752090 2:202719969-202719991 CTTGATCCACAGGCACAGAAAGG - Intronic
945682141 2:212927004-212927026 TCTGTTTCCCAGGCACAGGAAGG + Intergenic
946524118 2:220499334-220499356 ACTGTTAACAAGGCAGAGAAAGG - Intergenic
948012631 2:234662108-234662130 CAAGCTCCACAGGCAGAGAAGGG - Intergenic
948726338 2:239936305-239936327 CAGTGTCCCCAGGCAGAGAATGG + Intronic
948903165 2:240966238-240966260 CCTGTTGCCCAGGGAGAGCCTGG - Intronic
949025359 2:241765245-241765267 CCATCTCCCCAGGCAGAGAGCGG - Intronic
1169263443 20:4153752-4153774 CATGCTCCCCTGCCAGAGAAGGG - Intronic
1169285667 20:4305206-4305228 CCAGCTCCCCAGCCAGAAAAGGG - Intergenic
1169636149 20:7693981-7694003 CATCTATCCCAGGCAGAGAATGG - Intergenic
1169968402 20:11242600-11242622 CCAGTACCAAAGGCAGAGAAAGG - Intergenic
1170756676 20:19212068-19212090 CCTCTTCCCCTGGCACAGAAGGG + Intergenic
1170914843 20:20612810-20612832 CCTGTCGCCAGGGCAGAGAAGGG + Intronic
1171349506 20:24492007-24492029 CCTGTGCCCTAGGCAGAGCCAGG + Intronic
1172484596 20:35290827-35290849 CCTGTGCCCCAGGCAGGGGACGG - Intronic
1173251274 20:41365409-41365431 CCTCTTCCCCACGCAGGGAGGGG - Intronic
1173325003 20:42025236-42025258 CCTCTTCCACAGTCATAGAATGG + Intergenic
1173618326 20:44417385-44417407 CTTGTACCCCCTGCAGAGAATGG + Intronic
1173671402 20:44801543-44801565 CCTTTTCCCAATGCAGAAAAGGG + Intronic
1175412039 20:58776848-58776870 AATGTTCCCCAGGAAGGGAAGGG + Intergenic
1175769010 20:61611210-61611232 TCTGATCCCCAGGGAGAGGAAGG - Intronic
1175929580 20:62487411-62487433 CCTGTTCACCAGGCAGATCGGGG + Intergenic
1176214935 20:63943538-63943560 GCTCTTCCCCAGTCACAGAAGGG - Intronic
1176239222 20:64068178-64068200 CCTGTTTCCTTGCCAGAGAAAGG + Intronic
1176240431 20:64073487-64073509 CCTCCTCCCCAGGCAGCCAATGG - Exonic
1176660549 21:9630985-9631007 TCTGTTGCCCAGGCAGGGATGGG - Intergenic
1178664670 21:34536344-34536366 GCTGTGCCCCTGGCTGAGAATGG - Intronic
1179226703 21:39460099-39460121 CGTGTTACACAGGTAGAGAAAGG + Intronic
1179525167 21:41971308-41971330 CCTGCTACCCAGGCAGGGGAGGG + Intergenic
1179818329 21:43922222-43922244 CCTCGTCCCCAGGCTGAGAAAGG - Intronic
1180621435 22:17165173-17165195 CCTCTTCCCCAGGTAGAGAGAGG - Intronic
1181363173 22:22354369-22354391 GCTGCTCCCCATGCAGAAAAAGG - Intergenic
1181372410 22:22428915-22428937 GCTGCTCCCCATGCAGAAAAAGG - Intergenic
1181941284 22:26479424-26479446 CCTGTTTCCCAGCCCGAGGAGGG + Intronic
1181944196 22:26503078-26503100 CCTTTTCCCCAGTGATAGAAAGG - Intronic
1182448467 22:30403695-30403717 CCTGTTCCCTAAGAAGATAAGGG + Intronic
1184131005 22:42516296-42516318 CCTGTTCCCCAGGGACAATATGG + Intronic
1184141175 22:42578121-42578143 CCTGTTCCCCAGGGACAATATGG + Intergenic
1184648862 22:45910526-45910548 CCTGACCCACAGGCAGACAAGGG + Intergenic
1185232863 22:49693416-49693438 TCTGTACCCCAGGCAGTGACAGG + Intergenic
1185318406 22:50189120-50189142 TCTGTCCCGAAGGCAGAGAACGG - Intronic
949193851 3:1282496-1282518 CCTATTCCCCAATCAGAGATGGG + Intronic
950682223 3:14593179-14593201 TGTGCTCCCCAGGCAGACAAGGG - Intergenic
950981008 3:17304308-17304330 CCTGTTCCCCAGTGAGAGACAGG - Intronic
952112908 3:30145227-30145249 TGTGTTCCCCAGGCAGGAAAAGG - Intergenic
953663209 3:44905990-44906012 CCTGTTCCCTGGCCAGAAAAGGG + Intronic
953864535 3:46572877-46572899 CCTCTTCCCCCAGCAAAGAAGGG - Intronic
954464657 3:50647299-50647321 CCTGTGCTCCAGGTATAGAAAGG - Intronic
954579724 3:51696700-51696722 CCAGGCCCACAGGCAGAGAAGGG - Intronic
955507213 3:59644429-59644451 CCTATTCCACAGGCTGAGGAAGG + Intergenic
955596118 3:60592581-60592603 CCTGCTGCCCAGGCAGTGAATGG - Intronic
956267835 3:67417710-67417732 CCTTTTCCTCCAGCAGAGAAAGG + Intronic
956705667 3:71996750-71996772 CCTCTTCTCCAGGCATAGAAAGG - Intergenic
960357358 3:116670067-116670089 CCTGACCTCCAGGCAGAGGAAGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961930672 3:130529682-130529704 CCTGGTCCACACCCAGAGAAGGG + Intergenic
965400407 3:168206412-168206434 ACTGTTCCCCAGACTGAAAAGGG + Intergenic
968383540 4:115258-115280 GCTGTACCACAGGCAGAGATGGG - Intergenic
970227488 4:13874779-13874801 CCTTTTCCTAAGGGAGAGAATGG - Intergenic
971367136 4:25986289-25986311 GGTGTTTCCCAGGCAGATAAAGG + Intergenic
972558690 4:40206146-40206168 CTAGTTGCCCATGCAGAGAATGG + Intronic
973155263 4:46943746-46943768 TATGTCCCTCAGGCAGAGAAAGG - Intronic
974463454 4:62220987-62221009 CCTGGTCCCCAGGCAAAAAGGGG + Intergenic
976381207 4:84401171-84401193 CCTATTCCTCTGGCAAAGAAGGG + Intergenic
976931342 4:90570298-90570320 CCTGCTCCCATGGCAGAGATTGG + Intronic
977427789 4:96891145-96891167 CCTCTCACCCAGGCAAAGAAAGG + Intergenic
978742831 4:112157239-112157261 CTTTTTCCACAGGCAGAGAGAGG + Intronic
978882166 4:113718621-113718643 TCTAGTCCCCAGGCAGGGAAGGG + Intronic
981727653 4:147864248-147864270 TCTGATCCCCTGGGAGAGAAGGG - Intronic
983521456 4:168713401-168713423 CCTGCTCTCCAGGGAGAGAAAGG + Intronic
983572603 4:169225923-169225945 CCTGTTCCTCTGGCAGATAAGGG + Intronic
983903948 4:173166135-173166157 ACAGTTCCCTAGGCAGAGACTGG - Intergenic
984470982 4:180173160-180173182 CCTGTTCTGCAGACGGAGAATGG + Intergenic
984636449 4:182115531-182115553 GCTTTTCCCAAGGCAGGGAATGG + Intergenic
985199652 4:187471741-187471763 CCTGTTCCCCAGGTGAAAAATGG - Intergenic
985414813 4:189725429-189725451 TCTGTTGCCCAGGCAGGGATGGG + Intergenic
985680900 5:1255043-1255065 GCGCTTCCCCAGGCAGAGCAAGG + Intronic
985716908 5:1467875-1467897 CGTGGACCCCAGGCAGAGAGAGG - Intronic
986156923 5:5185022-5185044 TCTGTACCCCAGGCTGAGCATGG - Intronic
989561642 5:42858851-42858873 CGAGTTCCACAGGCAGACAATGG - Intronic
991542507 5:67745561-67745583 CTTGTTCCTCTGGCAGGGAATGG + Intergenic
991558545 5:67923681-67923703 CCTTTTCCAGAGGCAGAGAAAGG - Intergenic
992583324 5:78204772-78204794 CCTGTCACTGAGGCAGAGAAGGG + Intronic
995740578 5:115351934-115351956 CCTTTCCCCCAGGGAGAGGAAGG + Intergenic
996803617 5:127430125-127430147 CATGATCCCCAGGCAGAGCAGGG + Intronic
998569398 5:143243979-143244001 TCTGTTCCCCACGCAGAGACAGG + Intergenic
998897488 5:146815191-146815213 CCAGTTCACAAGGAAGAGAATGG - Intronic
999170571 5:149590681-149590703 TCTGCCTCCCAGGCAGAGAATGG + Intronic
999249825 5:150175962-150175984 TCTGTTCCCCAGGCAGGGGAAGG + Intronic
999626394 5:153525217-153525239 CATGTCCCCCAGGAAGGGAAAGG - Intronic
999894522 5:156015558-156015580 CCTGTTTACCAGACAGAAAAAGG + Intronic
1000998613 5:167983799-167983821 ACTGTCCCCTAGGAAGAGAAGGG - Intronic
1002025757 5:176395279-176395301 CAGGCTCCCCAGGCAGAGAGTGG + Intronic
1002071443 5:176680795-176680817 GCTGTGCCCCACGCAGAGCAGGG - Intergenic
1003850539 6:10218030-10218052 CGTGTTCCCCAGGCTTGGAATGG + Intergenic
1004293607 6:14390202-14390224 TCTGTTCCCCAAGCAAAGAGGGG + Intergenic
1005355854 6:24982853-24982875 AGTGCTCCCCAGGCAAAGAAAGG - Intronic
1005458894 6:26048815-26048837 TCTGGTCCCCAGGCAGGAAAGGG - Intergenic
1006296305 6:33171564-33171586 CCTGTCCCACAGGGTGAGAAGGG - Exonic
1006914002 6:37583090-37583112 CCTGTTCTACAGGCAGAGCCAGG - Intergenic
1007101625 6:39251649-39251671 CCTGTTGCCCTGGGGGAGAAGGG + Intergenic
1007313930 6:40969213-40969235 CCTCTTCCTCAGGAAGAGACAGG - Intergenic
1012258425 6:97060580-97060602 CCTGGTCTCCAGGCAGAATATGG - Intronic
1015708569 6:136114711-136114733 TGTGTTCCCCAAGCGGAGAAGGG + Intronic
1017373179 6:153736492-153736514 GCTGATCCCAGGGCAGAGAAAGG - Intergenic
1017521408 6:155206357-155206379 CCTGTACCCCAGGCTGAGGCAGG - Intronic
1019696751 7:2450590-2450612 CCTGTTCCCCAGGGAGTGGGGGG - Intergenic
1019781078 7:2940047-2940069 CTTCTTCCACGGGCAGAGAAGGG + Intronic
1019847749 7:3523490-3523512 GCCGTTCACCAGGCAGAGAGGGG - Intronic
1022417209 7:30188731-30188753 CCTATTCCTCAGGAAAAGAAAGG + Intergenic
1022832489 7:34082177-34082199 CCAATTTCCCATGCAGAGAATGG + Intronic
1024979522 7:55145639-55145661 CCAGCTCCCCAGGCAGGGAATGG - Intronic
1026301936 7:69105665-69105687 GCTGTTCCATAGGCAGAGTAGGG - Intergenic
1029712815 7:102308803-102308825 CTTCCTCCCCAGGTAGAGAATGG + Exonic
1032472228 7:132186828-132186850 TCTGGTCCCCAGGCAAAGAGGGG - Intronic
1034367947 7:150568033-150568055 CTTGTTCCTTAGGCAGAGAGAGG + Intronic
1035239386 7:157520048-157520070 CCTGGTCCCCAGGGAGATGACGG + Intergenic
1037293956 8:17381340-17381362 CCTGACGCCCAGGCAGTGAAGGG - Intronic
1038711368 8:29949994-29950016 CCTGCTGCACAGGCAGAGGATGG + Intergenic
1039385806 8:37134535-37134557 TCTGTTCCCTTGGCAGAGGATGG - Intergenic
1040578437 8:48674930-48674952 CCTGGTTCCCAGGCAGAGCCTGG - Intergenic
1041084354 8:54243203-54243225 CCTTTCCCCCAGGCTGAAAAGGG + Intergenic
1047258781 8:123237298-123237320 CCTTTTCCCCAGTCAACGAAAGG - Intronic
1047336414 8:123940827-123940849 GATGTTCCCAAAGCAGAGAAAGG - Intronic
1047697441 8:127416955-127416977 CCTGTTCCCCATTCCTAGAAGGG - Exonic
1048453433 8:134554626-134554648 AGAGTTCCCCAGGCAGAGCAAGG + Intronic
1049362465 8:142218767-142218789 CCAGTTGCCCAAGCAGAGAAGGG - Intronic
1049542306 8:143214194-143214216 GGAGTTCACCAGGCAGAGAAGGG + Intergenic
1049812009 8:144579850-144579872 GCTGGACCCCAGGGAGAGAAAGG - Intronic
1050168203 9:2788527-2788549 CCTGTTCCCTTGGCACAGAAGGG + Intronic
1054750127 9:68897245-68897267 TCAGCACCCCAGGCAGAGAAAGG + Intronic
1057755452 9:97831570-97831592 CCTGTCTCCCAGGCAGCTAAGGG + Intergenic
1059168964 9:112106471-112106493 CCTGCTCCTCAGGGAGGGAATGG - Intronic
1060476481 9:123990708-123990730 CCAGATCACCAGCCAGAGAATGG - Intergenic
1060509816 9:124223644-124223666 CCAGTTCCCCAGGCAGGGGAGGG - Intergenic
1060846166 9:126839290-126839312 CTTCTTCCCCATACAGAGAATGG - Intergenic
1060984253 9:127810509-127810531 CAGTTTCCCCAAGCAGAGAAAGG - Intronic
1061543439 9:131290383-131290405 GCTCTTCACCAGGCAGAGGATGG - Exonic
1061548445 9:131318268-131318290 GATTTTCCCCAGGCAGGGAAGGG - Intergenic
1062122687 9:134842145-134842167 CCTCTTCCCCAGACCAAGAAAGG + Exonic
1062547194 9:137069158-137069180 CCTGTTCCCAAGGCAGGCACTGG + Intronic
1062611104 9:137373834-137373856 CCTGTTCTCCAGGCAGACAGAGG + Intronic
1203638119 Un_KI270750v1:132829-132851 TCTGTTGCCCAGGCAGGGATGGG - Intergenic
1186251508 X:7672069-7672091 GCTGTTCCCCAAGCAGCCAATGG + Intergenic
1187137060 X:16558260-16558282 CCTGGTCACCAGGTAGAGGAGGG - Intergenic
1188131609 X:26441064-26441086 CATGTTCCCCTGGCAGCAAAGGG - Intergenic
1190677778 X:52796926-52796948 CCTGTCCACAAGGCAGACAAAGG + Intronic
1192144506 X:68672573-68672595 CCTTCTCCCCAGGCAGACCAAGG - Intronic
1192808196 X:74528283-74528305 CCTGGGCTTCAGGCAGAGAAAGG - Intronic
1193656674 X:84206707-84206729 CATATTCCTCAGGCACAGAAGGG + Intergenic
1194627878 X:96247340-96247362 CCTTTTCCCAAGGCAATGAAAGG - Intergenic
1196491904 X:116277429-116277451 CCTGTTCTTCAGGGAGAAAAGGG + Intergenic
1196901072 X:120383950-120383972 GCTTTTCTCCAGGCAGAAAATGG + Intergenic
1197842875 X:130768679-130768701 CCTGCTCCACAGGCAGGGAAGGG + Intronic
1199872211 X:151909575-151909597 GCTGTACCCCTCGCAGAGAATGG - Intergenic
1199947026 X:152678688-152678710 GCTGTACCCCTTGCAGAGAATGG - Intergenic
1199962655 X:152789766-152789788 GCTGTACCCCTTGCAGAGAATGG + Intergenic
1200064638 X:153498578-153498600 CCTGAGCCCCCGGCAGAGAGCGG + Intronic
1200164677 X:154027785-154027807 ACTCTTCCCCAGGAAGGGAAGGG - Intronic
1200402133 X:156025786-156025808 CCTGTTTCTCTGGGAGAGAAGGG + Intergenic
1201584555 Y:15546400-15546422 CATGTTTCCCAGCCAGAGAAAGG - Intergenic