ID: 1089363591

View in Genome Browser
Species Human (GRCh38)
Location 11:117907482-117907504
Sequence GCGAGGAAACACCAGCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089363589_1089363591 -7 Left 1089363589 11:117907466-117907488 CCTCCATAATTAATGTGCGAGGA 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1089363591 11:117907482-117907504 GCGAGGAAACACCAGCTCACAGG 0: 1
1: 0
2: 0
3: 6
4: 88
1089363587_1089363591 -4 Left 1089363587 11:117907463-117907485 CCGCCTCCATAATTAATGTGCGA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1089363591 11:117907482-117907504 GCGAGGAAACACCAGCTCACAGG 0: 1
1: 0
2: 0
3: 6
4: 88
1089363590_1089363591 -10 Left 1089363590 11:117907469-117907491 CCATAATTAATGTGCGAGGAAAC 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1089363591 11:117907482-117907504 GCGAGGAAACACCAGCTCACAGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089363591 Original CRISPR GCGAGGAAACACCAGCTCAC AGG Intronic
902855064 1:19196544-19196566 GAGAGTAAACACCAGCTGTCAGG + Intronic
904952931 1:34258903-34258925 GAGAGGAAGCAGCATCTCACGGG - Intergenic
905355958 1:37384937-37384959 GTGGGGAAACTACAGCTCACAGG - Intergenic
911509552 1:98794387-98794409 ACCAGGAACCACCAGCTTACGGG - Intergenic
916738309 1:167627832-167627854 GGGAGGAAACAACAGCCCAAGGG - Intergenic
920008365 1:202849994-202850016 GAAAGAAAACATCAGCTCACTGG + Intergenic
921215784 1:212935711-212935733 GCGAGGCGACAACATCTCACAGG - Intergenic
921752957 1:218818638-218818660 GCAAGGAAGCAGCAGCTCAGTGG + Intergenic
1062915746 10:1240344-1240366 GGGAGTAAACACCAGGACACAGG - Intronic
1063178469 10:3573238-3573260 GGGAGGCAACATCAGCTCAAGGG - Intergenic
1064600083 10:16984867-16984889 GAGTGGAAATACCAGCTCTCTGG + Intronic
1065330796 10:24596718-24596740 GGTAGGAGACACCAGCCCACCGG - Exonic
1071800750 10:89057058-89057080 GTGAGGAAAAAGCAGCTGACAGG - Intergenic
1073473023 10:103735599-103735621 GCCAGGAAACACCAGGCCTCAGG + Intronic
1075330073 10:121567402-121567424 GCAAGGAAAGCCCAGCTGACGGG + Intronic
1075674782 10:124288893-124288915 GCCAGCAAACTGCAGCTCACAGG + Intergenic
1076738208 10:132468113-132468135 GCGGGGCAACGCCAGCTCCCAGG + Intergenic
1077256599 11:1586897-1586919 GCCAGGAAACAGGAGCTCTCTGG - Intergenic
1078141030 11:8693261-8693283 GGGATGAAACACCATCACACAGG - Intronic
1080617799 11:33960159-33960181 TAGAGGAAACACATGCTCACTGG - Intergenic
1082807886 11:57461619-57461641 GAGAGGAAAGACCAGATCAGGGG + Intronic
1084456888 11:69273181-69273203 GCGGGGAGACAGCAGCTCAGAGG - Intergenic
1084521008 11:69662868-69662890 GCTAGGAGAGACCTGCTCACGGG + Intronic
1084768293 11:71326390-71326412 GCAAGGAAACACCACCTTCCTGG - Intergenic
1089363591 11:117907482-117907504 GCGAGGAAACACCAGCTCACAGG + Intronic
1089738486 11:120565344-120565366 GAGAGGATGCAGCAGCTCACTGG - Intronic
1095420984 12:42023284-42023306 GAGAGGAAACTCCAGCACAACGG + Intergenic
1096226427 12:49869448-49869470 GCCAGCAAACAGCAGCTGACAGG + Exonic
1097316091 12:58172916-58172938 GTGTGGAAACACCACCCCACTGG + Intergenic
1099028762 12:77498528-77498550 GTGAGGTAACACAAGCTAACTGG - Intergenic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1105414303 13:20195066-20195088 GGAAGAAAACACCAACTCACAGG - Intergenic
1105451805 13:20506782-20506804 GCGAGCAAACTACAGCCCACAGG + Intronic
1108426897 13:50311754-50311776 GCAAGGTACTACCAGCTCACAGG - Intronic
1113290277 13:108898109-108898131 GAGAGGAAACAACAGCTAACCGG + Exonic
1121310522 14:92933005-92933027 GGGAGAACACCCCAGCTCACAGG + Intronic
1121465856 14:94115175-94115197 GAGAGGAAACAGGAGCTCAGAGG - Intronic
1125937546 15:43649424-43649446 GCGAGGCACCTCCAGCTCCCGGG - Intronic
1128068943 15:64781787-64781809 GGGAGGAGACACCACCTCTCAGG - Intergenic
1129785617 15:78308325-78308347 GCGGGGAAACAGGAGCTCACAGG + Intergenic
1135436306 16:22428896-22428918 GAGAGGAAGCACCAGCACTCTGG - Intronic
1136185347 16:28585242-28585264 TCTAGAAAACACCAGCTAACTGG - Intronic
1139379800 16:66523324-66523346 ATGAGGAAACACGAGCTCCCAGG + Intronic
1149583001 17:57764371-57764393 GCCATGAAACACAAGCTCAGAGG - Intergenic
925048509 2:792933-792955 GAGAGCCAACACCAGCACACAGG + Intergenic
926104609 2:10142440-10142462 GCTAGGAAACAGCAGATGACAGG - Intronic
930317892 2:49819421-49819443 GCCAAGAAACACCAGTTCTCTGG - Intergenic
931233057 2:60390564-60390586 GGCAGGAAGCCCCAGCTCACAGG - Intergenic
932371214 2:71189719-71189741 GCAAAGAAACAACAGCTCACAGG + Intronic
932961580 2:76418618-76418640 GCCATGAGACACAAGCTCACTGG - Intergenic
937259820 2:120578251-120578273 CCCAGGAAACACCAGTTCCCAGG - Intergenic
938589317 2:132721527-132721549 GCAAGGAAACACTGACTCACGGG + Intronic
942016435 2:171821382-171821404 GAGAGGAACCAACAGGTCACGGG + Intronic
1173171224 20:40725605-40725627 GTGAGGAATCAGCAGCTCAGAGG - Intergenic
1173883038 20:46433311-46433333 GGGAGGGAACACCCGATCACGGG - Intergenic
1175336712 20:58200898-58200920 GAGAGTAAACACCAGCCCAGCGG + Intergenic
1177188084 21:17819539-17819561 GCCAGGAAACACGGGATCACAGG - Intergenic
1181459483 22:23077847-23077869 GTGAGGTACCACCAGTTCACAGG - Intronic
1182779302 22:32854958-32854980 ATGAGAAAACGCCAGCTCACAGG + Intronic
951371587 3:21856766-21856788 GTGAGGAACAACCAGCTCATAGG + Intronic
954243359 3:49311296-49311318 TGGGGAAAACACCAGCTCACAGG + Intronic
956997515 3:74844639-74844661 AAGAGGAAACAGCAGTTCACAGG + Intergenic
959101509 3:102015372-102015394 GAGAGGAAACAACAGTTCATAGG - Intergenic
962363542 3:134761472-134761494 GCCAGGGGACACCTGCTCACAGG - Intronic
966763678 3:183439311-183439333 GCAAGGTATCACCACCTCACTGG - Intergenic
967309868 3:188095600-188095622 GGAATGAAACACCTGCTCACGGG + Intergenic
968432702 4:568100-568122 GCGAGGACAGACCAGGTCAACGG + Intergenic
984562713 4:181289853-181289875 GAGAGAAAGCACCAGCCCACGGG - Intergenic
985627005 5:994251-994273 GCGAGGAAGGACCAGCTCCCAGG + Intergenic
988809604 5:34771464-34771486 GGGAGGAAATACAAACTCACTGG - Intronic
990816366 5:59790115-59790137 ACGAGGAAACAGGAGCTTACAGG + Intronic
995404420 5:111778387-111778409 GTGAGGAAACAGAGGCTCACTGG + Intronic
996607215 5:125337548-125337570 GCAAGGCATCTCCAGCTCACCGG + Intergenic
998868745 5:146531835-146531857 GGGAGGAATCACCACCTCATAGG - Intergenic
1001686328 5:173597503-173597525 GGGAGGAAACAGCAGATAACAGG - Intergenic
1009925391 6:70114449-70114471 ATAAGGAAACACCACCTCACTGG + Intronic
1012122319 6:95384216-95384238 GCACTGAAACACCAGCCCACTGG + Intergenic
1021695062 7:23268382-23268404 GCCAGGAGAGAGCAGCTCACAGG + Intronic
1024867824 7:53924024-53924046 GCCAGCAAACACCACCACACAGG + Intergenic
1028774767 7:94664317-94664339 GTGAGGCAACACCAGCGCCCGGG - Exonic
1029526194 7:101095479-101095501 GGGTGGAAACAGCAGCTCTCCGG + Intergenic
1030180956 7:106708636-106708658 GTGAGGGAACACCAGCTCTGGGG + Intergenic
1036979107 8:13448882-13448904 GCAAGGAAACACCAGTTTTCGGG + Intronic
1037036621 8:14177125-14177147 GCGAGGCAACTCCACCCCACAGG - Intronic
1037256926 8:16965770-16965792 TCATGGAAACACCAGCTCAGAGG + Intergenic
1047587871 8:126293880-126293902 CCAGGGAAACACGAGCTCACAGG - Intergenic
1061721640 9:132555646-132555668 GGGAGGAGACACCAGCTCCCTGG - Intronic
1062340116 9:136090416-136090438 TCCAGAAAACACCAGCCCACTGG + Intronic
1203553482 Un_KI270743v1:184480-184502 CCTAAGAAACACCAGCCCACTGG + Intergenic
1187186640 X:16992984-16993006 GCCATGTAACACCAGCTCCCTGG - Intronic
1188046006 X:25426598-25426620 TAGAGGAAGCAGCAGCTCACTGG - Intergenic
1190059070 X:47199353-47199375 GGGAGGAAAGATCAGCCCACTGG - Exonic
1190250030 X:48716178-48716200 GACATGAAACACCAGGTCACAGG + Intergenic
1198317311 X:135481081-135481103 GCCAGCAACCACCAGCTCAGTGG - Intergenic
1198684538 X:139213616-139213638 GTGAGGAAACAAAAGCTCACAGG - Intronic